JFIF,,AdobedExifMM*;JiP  >User1515 2014:01:06 15:34:192014:01:06 15:34:19UserICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ 2014-01-06T15:34:19.152User Cd CMYK }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzCMYK?+{ oF V|f;^3K!Eȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'QGB"V0ttTQE GZQE.'kIEEQȟ|UL'Q_P%?~~?OTO?7? Bt]^2{q[Y].wiiX(7CF-ӎEWEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_2j Cд/Gދ迶]6i:VǶzvi~"O[++Xb( 8U>!ߍa]b/(T8XT4Y¢"E6mGIE5r_sE`t_߉Q ?a?mQG6mGIE5sE`t_߉Q ?a?mQG6mGIE5sE`t_߉Q ?a?mQG6mGIE5sE`t_߉Q ?a?mQOlzԟX/?qG$%\$QEH?lth=î(K暏IKCkH?ko:O/oĿiĿ06(K暏IKCkH?ko:O/oĿiĿ06(K暏IKCkHxkc߉yԛ%MG$%\$QE_4O_u_EQ Z~_{>%MG$%\$QE8~׿?>%Mî(f?h/j?'/ : ")᯿k?:'gįiĿ06(|J暏IKCkH?᯿k?:'gįiĿ06(|J暏IKCkH?᯿k?:'gįiĿ06(hxW4O_u_ESwYh W4G$%\$QEI }Y?{>%MG$%\$QEߵW4O_u_EQ }Y?{>%MJ4SyZ$SW4oz?&  o"S*A^~Cn?_$M?5E>4R^_tG_Q 7`kdG5eGAD5x oFO^_tG_Q 7`kdG5eGAD5x oFO^_tG_Q 7`kdG5eGAD5x oFO]~gADƿY& ?&  o"S*A]#AD}OƿYԖIGC[H'fw5eGAD5x oFO^_tG_Q 7`kdG5eGAD5x oFO^_tG_Q 7`kdG5eGAD5x oFO^_tG_Q 7`kdNf?h=Oƿ_~$?0k`zV?`??h+MR[?]V}S)k9Wğiix oFO]s?? 7`kdG5aG?C-x oFO]s?? 7`kdG5aG?C-x oFO]s?? 7`kdJ?kh=_o(??kÿ?C?u|IO$o(??kthquO4M?5E>4R]s?? 7`kdG5aG?C-x oFO]s?? 7`kdG5aG?C-x oFO]s?? 7`kdG5aG?C-x oFOO{/o(?a֯8ԗ?ʏIGC[H'fw5_G=C-x oFO]~sߴ7? 7`kdG5_G=C- o~S(ho=??+(1G kڿ{'Zxo0ǡ#9kڿ{'Z_I"_}FGh?iOďiix{Ysѽ)j9Oďih?i}o\s/ ;ѽ(?h_=???wY{y4Q sW~пz~$KG$~!K?FGhH斏HCAg~G5]G9B- /}kڻs#Z?#u_7?E?w G4G?4o7ƊQ[ns~4HQ ;ѽ)ӿ/GQ ;ѽ)`?|H?ĴG?4o7Ɗ?j9Gi(?i}o[տs'Q ;ѽ(hO=?wY{y4Q oVПz>#IG$~!K?FGh?|G撏HCAg~G5[G7B% /}kڷoJ?#u_7?Eo ?4G?4o7Ɗ?j9Gďi(?i}oZno_왣?wY{y4SiVw?hOGih?i}ok_ڬ~z>#J?#u_7?Eߵ_?4G?4o7Ɗ?᭿j9?i(?i}o[~s_Q ;ѽ(h?<!?4ooƊ?᭿j9?i)_}{Y?^f# (h?<kc~f~M[~s_S"#w~dwG5WG5A% /&GhG撏HCAg~G5WG5A% /}?kOڴvJ?#u_7?E8~__o>3GJ?#u_7?E8~P?i1G$~!K?FGhZs_Q ;ѽ(h?<?wY{y4Q mU~y#IG$~!K?FGhG撏HCAg~G5WG5A% /}koگkJ?#u_7?Eߵ_?4G?4o7Ɗ?᭿j9?i(?i}o[~s_Q ;ѽ(h?<?wY{y4Q mU~y#IG$~!K?FGh=?i g% /}?k?ڴc?4?wY{y4SeVwh??i(?i}ok?ګk?Y#O ?#u_7?E/5UG3A% /}kOګgJ?#u_7?E֟W74G?4o7Ɗ??j9 7oi(?i}oZ~_s?oQ ;ѽ(h/<?wY{y4Q iU_y#IG$~!K?FGh|F撏HCAg~G5UG3A% /}kOګgJ?#u_7?E֟W74G?4o7Ɗ??j9 7oi(?i}oZ~_s?oQ ;ѽ(h/<?wY{y4R=?i7i)GDzk }ĆwY7?E;|G撝?3o7Ɗ_kڣg?Y#O _H5GqFGhYnc?S!5=}|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh=?i f%?g{o_Y%?g{o_g?F$4CsX{y4RX}i7s  }|F撏Huk3o7Ɗ_kڧg:?!9ѽ)ᬿj9 ?i(_;?FGh?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڧcJ?!9ѽ(?h< }k?ڣcJ?!9ѽ)?ᬿj9 ?i(_;?FGhh?< }F斏Huk3o7ƊOkگk:?!9ѽ)?ᬿj9 ?oi(_;?FGh?h?< }|G撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh|F撏Huk3o7Ɗ??j9 7oi(_;?FGh=if%?g{ok/ڠ~_y#JOHu1gOFGh?SoZC^FGhM~_ovCHu׵S\ѽ)?ᬿj9 ?oi)x /}kOڬu?h1JC/>{y4Q iU_y#II ;ѽ(h/<?wY{y4Q iU_y#IG$~!K?FGh|F撏HCAg~G5UG3A% /}kOګgJ?#u_7?E֟W74G?4o7Ɗ??j9 7oi(?i}oZ~_s?oQ ;ѽ(h/<?wY{y4Q iU_y#IG$~!K?FGh|F撏HCAg~G5UG3A% /}kOګgJ?#u_7?E4WokY#IG$~!K?FGhY~՝i ?q!?wY{y4SOiV?sIG$~!K?FGhh?<?wY{y4Q mU~y#IG$~!K?FGhG撏HCAg~G5WG5A% /}koگkJ?#u_7?Eߵ_?4G?4o7Ɗ?᭿j9?i(?i}o[~s_Q ;ѽ(h?<?wY{y4Q mU~y#IG$~!K?FGhG撏HCAg~Hk_ڬh3J?#u_7?E4W?G$4G?4o7ƊijߴGQ ;ѽ)G_gJ?#u_7?E'5WG5A% /}koگkJ?#u_7?Eߵ_?4G?4oƊ?᭿j9?i)@z 8K 6XEߵ_?4v׵qK8Lٿ??֊?᭿j9?i)"k'~%'b?[~s_SOB:o7Ɗ?᭿j9?i)?#u_7?Eߵ_?4G?4o7Ɗ?᭿j9?i(?i}o>>#1G$~!K?FGhN~ПƏ ;ѽ)_kZ?#u_7?E'5[G7B% /}kڷoJ?#u_7?Eo ?4G?4o7Ɗ?j9Gi(?i}o[տs'Q ;ѽ(hO=?wY{y4Q oVПz>#IG$~!K?FGh?|G撏HCAg~G5[G7B% /}ߵaGOā.(?i}oZݿi~4|H(?i}o[9B- /}H斏HCAg~G5]G9B- /}kڻs#Z?#u_7?E?w G4G?4o7Ɗ?j9Oďih?i}o\s/ ;ѽ(?h_=???wY{y4Q sW~пz~$KG$~!K?FGh?s/|i-!Oǵo}k_ڻ;BƏ4}huK?o7Ɗi?jG֏F:{y4R\s/I/_4o7Ɗ?j9Oďih_ֿi}o\s/ '?ѽ(?h_=??OZ{y4Q sW~пz~$KG$"K?FGhH斏I4Q wXz$KG$#[$Q3E}i{ 3hzZ5_VuVQm/QK=CMԴiM52][K$;) ~o:bXW)5;׎HWWDiʺ:  J ϭUwSQEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQE'Rm>!W?sc{EqQEQEQEQEQEQN OZ( )QEQEQEQEQE8)>=iIE P=ϯzT@>EuQEQEQEQEROA*@u(EQEQEQEQEQET=/EEREROAET*2袟L$QE%I(^~뢊)QEQEQEQEQEQE8!=xTQEHES(((((pB}NO( ?Ru:((((()@'{QE Aߟ}(}QEQEQEQEQEQEQNO?QEHQE((P (xOS}in9xttQKM(oQEu(EQEQEQEQEQEQEROAESz({EQEQEQEQEQEQEQE(4QN{O{EvSh((((((()=?x_֢)@(Z((((((((f(=>QE8 :((Z(((pF=9,SE*iqgxP: av>J(EQEQJ=>QE8!@hpAߟES@QKEQEQEQEQEQEQEQEQEQERŠ(4QE;_ESQN(((((((((((()vDZ_Ί)?8!_,w?i|OpE8Q?_(EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE.QK?QER>(s?Ɗ(ؾb(ڣtQE.)h(((((((((((((((((((((((((((((0O@MQK#EQ#EQc袊](ޟ()voQEl> (~EQ(6QQKQG袊<EQz(/Ey~^(?QE_ע(OQG袊<EQz(/E3؏Ǐ(}GQEŠ(aQEl> (ERloOQFGEloOQIcQFQFQIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER`zʊ(ھΊ(=ERy~^(}ERmoOER`Š(((((((((((((((() (_qi /4QIқҊ)?BRGPi((((((((((((0Q(QOl}?(i֢)v(QEQEQEQEQEQEQEQEQEQEQE!tQE4:(P)(((:QE4q֧=?EN;ʊ)XvC(EQEQHT(>hiF9)QEQEQEQEQEQEQEQEQE4q֢)c (AEQIEQEQEQEQEQEQEQESJ i@}E„t ӟEeQEQEQEQEQEQEQESJ폧QE0ES(((((((0Q(PvZ(*GQERQEQER#?(?U p}EuQEQEƒQER:tQE%QEQEQEQEQEQH@=EQL)?( QE};d_~ ßx^?5SEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQE'Rm>!W?sc{EqQEQEQEQJ< (^Oע)QEQEQEQEQE(QEHxדQOEQEQEQEQEҊ(zTQEIEQEQEQEQEQES׏(((((('zE P:~gQN((((() ׯ꧄'^*@tZ(?3֊)ԴQEQEQEQEQEQJ*@uh}QEQEQEQEQEQEQO{E P:ǽQKEQEQN OoSEuS Ea$9)(zQEE P:ǽQKEQEQEQEQEQEQES (OQO((((((() S׏8x@=9(S((((((()=QO /QO AEREQEQEQEQEQEQEQEf(=ES(E(((P 3ES?4QE8 aE?t')(((c)sҊ(QE-QEQEQEQEQEQEQEQEQEQJ=)| (w$QE8()h(((((((((((P4Ih=(_NrE8*ߟ(U?(`b(((((((((((((((=4QE;kEQKQE.?S)TvEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE'QK#ERoOQF~?(aQE_EQz(`?QEl)v/Ɗ(j:(~B(~B((((((((((((((((((((((((((((((((((((((((((=FhLA (~TQE&OEl_OE?Š(`4QE'袊CGEl> (cz~(kz*(F((((((((((((((((((((((()ERmS*(bE_ע)67>)Xv?QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&)0PEi6/E4?SL~Sv7Sv7QE&)0GPGEQEQEQEQEQEQEQEQEQEQEQEQM*QM1Ί(a)#QEQEQEQEQEQEQEQEQEQEQM*QM1QE4ߗ4QE6(((zpfE҃OQ^){)m-QEQEf(?_E„{4QE6(((((((((SN?QE0ESH#QIEQEQEQEQEQEQEQzрzE0:aAۏtQL*ö~XvӟSiQEQEQEQEQEQEQH@=hiAۏ}hGQIEQEQEQEQEQEQESJ (POQL((z҆#;QEFSj@S#E%QESJ ((G?4QE6(((((( QE}A-x?n+~ ßx^?ڵSEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQE'Rm>!W?sc{EqQEQEQOO^֢*@EREQEQEQEQE O_ʤ QE<:TҊ)h((((xBzQEH (((((('QEJQKEQEQREH*"QEROAETE((((((a[ފ(}OE((((((}z_xBz O=hKEQEQEQEQEQESQEHQE((((((z E𞿗袊xtQE-QEQEi`;:(iu2(P ?QEHwJ(: QEQEQEQEQEQEQEQE뢊)QEQEQEQEQEQEQEQE(R{~S?ʊ*@?SE1NQKKEQEQEQEQEQEQEQE>QE<(?uQEQEQEQEQEQEQEQJ=QN{ES(ퟯQN((( OAF@qEnϽSퟯ?jisۏTQNOS((P (pC܁E=QE:((((((((((E>3ESҊ(QE-QEQEQEQEQEQEQEQEQEQEQF =4QNJ֊)?SZ#?~b~b)p@;tQE-QEQEQEQEQEQEQEQEQEQEQEQEQF 3ES?QJ ފ(rE(~TQE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQF )v)v7(]~ER~^(=MQF?S)v)p=(Z((((((((((((\EQ#EQERoO&GQ?Q4dzQE.ܾΊ(}Go__Q(޾ (s“z(?o(?o(?o(=M'GGGGGA(b~i7AQ}?S4o>(b~h}4QFOѼhyE?F?_6/ƍ~El_OϠƊ)6REl )Xv?QEQEQEQEQEQEQEQEQEQEQEQEQEQEQE!tE7bn4QM1~<!#hߗ4Ҭ;~\E6EQEQEQEQEQEQEQEQEQEQEQEҪ{~\QEESJ0ퟧQM((((((((()QM(;d~)l(:QEQEQEQJ)?)q}(P?8:QE4:S((=FhaA"(=?ES0GQ(((((((((PoQE‡?袊f1EQEQEQEQEQEQEQER*QEž??US#GQEQEQEQEQEQEQEQM*oQE‡?QL(((((())=ETd֊((PHE€)G?E¤vE<z(EQHT?֊(ӟQRA=?ڊ)iP=(''?:(((((()B4QEJs_ފ(QEQEQEQEQEQES׏_E P:~gHEZ(((((('^(}OE((((((zǵQR?Ҋ(EQEROJ(ۿE<: >=EQE8!>_*@{sES((((((pR}QE< yTQE>(((((((zROJ(=?֜Z(u:(((((((=hxCߏ֊(Q?_(EQEQEQEQEQEQEQEROAESE;gZ(QEQEQES?ʐ:QE8G/SKxP:L.E(()X)?SZ(QN((((((((()(OESES((((((((((P z(=?SpC?pAܓSҊ)v?;jE:(((((((((((()@'4QE.S)?SZ(ؾb(m_AQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE. (]{OERoj((]E4QE.tQE.1EQEQEQEQEQEQEQEQEQK*({N(cz~i2=G(aRo__Rg(.QE_פ=4QKz)QE%QEQEQEQEQEQEQEQEQEQESJ)QE袊aVTQE%QEQEQEQEQEQEQEQEQEQM(>QE0s?ESJQEQEQERGC(SN?E҇<8>_E)QIEQEQE€QE4:(:QEQEQEQEQEQEQEQE`4QE0:(PQE((((((((Po)b) ӟe2(((((()QL)?4QE0:ǵQIEQEQEQEQEQEQES /tQEFT?֊((()aB:s}?5 `z~GS)h( (?UQQGZ(((`K|߲W߇G(((()@'QR'E(((((xQEH/QO(('zZ(=*2~j(S((^=: (((((( OOϵQR?_E((((((}z_xBz O=hKEQEQEQEQEQEQE P:~gQN((((()B4QEHOQO(((? aq۟?ʊ*@QOSv)((=(~?QEQEQEQEQEQEQEQEO*2{?Š(EQERQ#zaC۟cU p}8EQE!)n=(AEQ_r0?%O>o+W|#߂m,WE~QEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_HM> ?sc{EqQEQEQEQEQO ]OҤ ]OҊ*@RJ(((((*@_h((((((zTQE<:QEQE~=$QR'?Zz(tQES׏_ET~=袊Z(((((zQR?x)QEQEQEQEQEQE8)>8)>T@ P>SQEQEQEQEQEQNO^>/UQRzE((((((a[ފ( (EQEQJ?҂@E @:犌*( ')(4QE<''?:(QKEQEQEQEQEQEROAESzQOQE-QEQEQEQEQEQ@QO{ϭ8!>QR{ԁ@?QKKEQEQEQEQEQEQEI(x_֢)QEQEQEQEQEQEQEQE'QO{E;gqES(()X׏! u4QO;M.; QE8: af=E(() (w?QO((((((((((pF>Z(w9(pP: ((((((((((( O@iB(=8!@hwɧh@((((((((((((=4QE8#oQNQE;bQK:? (((((((((((((((?QK?QERg(vh]袊\QEQEQEQEQEQEQEO]M?:(}E& RcI/]϶)<_];_IR“sQE-&O袊J(((((()p}h]67 EŠ(OQG;Ɗ(=OQE.OEmQ:(~B((((((((((((((((((((((((((((((((((((((((((((((((((((((()EQ?!ERm_OEQ}?SERl ((<Ҋ(}GQE&EQHUcQFJ((((((()r}Oh~Bsz*(ھΗy?Rl=_Ry~^x?E&?_޾ (ޟʗ#~b)0}ih((((()0aQE4QE4;QE&(Miu}h((((((((((((((BQE7b(c=x(ߗ4QE6((((((((((((*P) (4HhP=hAAGPh((((((((()T)?CZ(a(EQEQEQEQEQEQEQEQEQEƒQM*ö~袊mQEQEQE!P{OG(S(((((((zǽQQ==ES#QEQEQEQEQEQEQHT?֊(ӟ=iIE P>JsEZ((((('QEJފ((((()IQRA)h)@'QO Z\E%FI=MQIE8)?O_֊(}OE((((( ET=*(((((()II袤 ?Ru:((((() ׯꢊ*@tZ(EQEQEQEQEQES׏_ET@E((pR}EHL.{qzΊ)QE~= >QE>((((((('QE< y(EQEQEQEQEQEQEOTOTQO;SQOEQEQEQEQEQEQEQE4QKM(f(=ES?4QE>((((((((((=ES(Eb((((((((((z (=?SpC?pA'?8 Ί) pt)ih((((((((((k:( ~QE8 Ί(QE-QEQEQEQEQEQEQEQEQEQEQEQEQF 3ESEYG (/)v)p@QKEQEQEQEQEQK#ERoORn_QE/{“zSܟ4AǏ]n(h&RdEQEQEQEQEQEREER>)|ER(ؿ_1EQGo袊\AQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&QI}?QI}QHcy (,?hMϾ(MLCQEQEQEQEQEQEQERoSE&=T(sNp?E7)wCE—z)6R`–)(((((~TQE&MQMcŠ(}iVTQE%QEQEQEQEQEQEQEQEQEQEQEQEQEQMڧTQE4;QE!C(GPhJ(((((((((((=@*P(cy iv'(Q8oc(:S0GQ(((((((((( QE҃G:(PEb((((((((( 4QE4:(Ql?hmQEQEdQM*oSÞiCžoxau((B3ES _4QE4ESh(((((((a@zqaB=ESh((((((B)aOC z)S#JJ(((((()n?*2uj((((((( (?UQQGZ(()A#aAۏcƤ;QQGQ_r0%O/>_/W+~ ßx^?uSEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQE'Rm>!W?sc{EqQ@QR?R?E}QEQEQEQEROJ('zQE(((((zǵQRQE:((M,j(ZmQE @:(EQEQEQEQEQET=*((Z((((()=?3N OOEHR?_E>EQEQEQEQEQEQE P:~gQN((((() ׯꢊ*@tZ(EQEQNO) ;EHs_ޣ.ON?[EeQEI(^ϧ(EQEQEQEQEQEQEQE<(?3֊(QEQEQEQEQEQEQE (~EQ(6QQF?_(}GQEŠ(aQEl> (cz~(cz~h67?Ɗ(cz~h67?Ɗ(*ñʊ(F(F(F((((((((((((((((((((((((((((((((()6M4QE';Š(b??Ɗ((QEXv?QEQEQEQEQEQEQ:QE&)ۘwΊ)6/}`4gE3؏Ǐo_q(oOK{Ί)0GPGKEQEQEQEQEQM*_ʊ(=袊i#hB;~_4QE7u(((((((((((())l(P QE7k*((((((((((((SN?Ҫ{cZ)?CZc?Uo˚iV.hM(((((((((iE>J(P?QM (((((((()QM(;qΊ(a?NQE6((2GC(SN)~OQE0:xu=8iuQE%QER)?CZ(GQERQEQEQEQEQEQEQEQEžQE(J(((((((POU4=8>(#B=EmQEQEQEQEQEQESJQQ#QE6(((((( QE0DZ?ES#)((WܿLI_ϗK <[!?R#GE]~U((((((((i?/N:QG#WE]I+Z(((((((M}*#p7hT'u*:(ZZ(((((z_*J(((((3*@((aHHh ˓ӁL( ֊((((((('QE tz((((((J=ڊ*@u @:(袊(((((}z_( O)QEQEQEQEQEQE8!=xTQEHES() ׯ,_˽T@rzq}QKL(a[ފ( (EQEQEQEQEQEP=('>QE<: (((((((z (?U<')b)ih(((((f(=袊xP;~'*(EQEQEQEQEQEQEROAESz({EQEQEf(=w)Tvן0*(S2OS(() (w?QO(((((((((pV=ES~)@(Z((((((((()=(Rz (sSgGl)v)(((((((((((c_(#?pE8)QEQEQEQEQEQEQEQEQEQEQEQE'&(c)?SZ(ؾQE8:EREQEQEQEQz E{~4Ԋ(r?Ro_8vigETvΓ{{(`{J(((()v]>3ESҊ(=OQE.tQE.(Z(((((((((((((((((((((((QEO](4QE.?_)|Ҋ(?QE.O(=OQE.MQFOETvE`zQE`zʊ(((((((((((((((((((((((((((((((((((()0=(0=(M{OEQ}?S4QEhMEQ?)<ERb??Ɗ(aQEQEE>4QE&1EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER`zQE4QE';Š(b??Ɗ(ޟ)0}hJ((((((;_E9?Rb?nK}Ra?N=4QM((((M{iA?ESLgERa(EQEQEQEQEQEQEQEQEQEQEQE)~?(c=x(UcQIEQEQEQEQEQEQEQEQEQERPւE4L(;dQE4J??SH#4:QE%%QEQEQEQEQEQEQEQESJ폧j(c?QL*GQERQEQEQEQEQEQEQEQEQEƒQM*GoQE(()A#i@}xQaB=x`{QE2((iU=(=(f1EQEQEQEQEQEQEQESJQQ#(EQEQEQEQEQEQER{{EFPJ>QLF)#QEQEQEQEQEQESJES ӟ0)WµQEQEQEQEQE8)>֊(BEREQEQEQEQE~j(EREROAET?犌*(tQESׁ:QEQEQEQEQEQE8)>֊(}Ҋ(QEQEQEQEQESHwEQEQEQEQEQE8)>QRE((((((?({EQEQERފ*@tZ=8)iQES׏_ET@(EQEQEQEQEQEROA)~}Z((((((((pR}}hO< y>(袊(((((()=QR_~1EQEQEQEQEQEQEQES׏8)(QEQEQES?hy(S ')((c^?QE< :((Z((((((((l}xE>QE<: ((((((((((c_pF=9xAJ(ZZ((((((((((c(OES(ퟯQN((((((((((()v?QNr?QEފ(QE-QEQEQEQE. )B1폯!`;(ygM޾)v/>ؤaŠ)@))i2OROERQEQEQEQKES7>٢)|SQElQE;袊Z((((((((((((((((((((F(ޟʊ(f(=ER~^(=OQE.MQF)p=(Z((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((~B(ھΊ(b?QIz(O/EŠ(_qERa?EQ*(((((((((((((((((((()Tʊ(=袊O,?hn?(TQE%QEQEQEQE#袐*v?QiAؑzQ'E,#;z?Rma*\ЃE6((((n=)<؟QE4?)HhJ(((((((((((z~QE4ESJҊ(#4QE%QEQEQEQEQEQEQEQEQEQM*4ߗQM1EҬ;~\JsEmQEQEQEQEQEQEQEQESJZ(c?aR:ERQEQEQEQEQEQEQEQEA(a֢)H(J((B3N G*(_GƊ)Hx 4QM(f(ES QE6((((((( (??֊(GQERQEQEQEQEQEQEւEƒ0DZ?E?uj((((((B(aOC*2EQEQEQEQEQEQEW_L5'cg+^ ßx'_+2QEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQERi> oc{ErQEQEQJ< (^OQEJsES(*@p9?TcQOZ(P袊(QN(((()@'QR'E(((((( ֤ ֊)ҤQKEQEQEQEQER'h(QN((((() ׯꢊ*@tZ(EQEQOO^?[HXz({eTQKL(}z_( O)QEQEQEQEQEQE(Rz~f(ן9)QEQEQEQEQEQEQEQNtQKM()=QOQE<: (((((((((c^?QE< :((Z((((((((z ҀOA(=N{Ί)~ϵ8 ~1O(((((((((()=QN{?Z(}(v)h(((((((((0OA(֊(O?j(Gl(v1EQEQEQEQF 3ESR(7z(ؾb= (cO($QIEQEQE'QN ǷsERg(pAܓz(jE((((((((((((((((((kzʊ(ޟ)vQER~QK}袊]袊\A (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((=ERl_OQIz(O/EŠ(ޟ(F((((((((((((((((()ERl_OESLc??ERl>QE4*(((((PHMRS/N?QM(;?J$袚P }QHUc; E6((()0PESJ/4QE'{4QE4ߗ4QE6((((((((((( _Ί(?_E҇ QM QE%QEQEQEQEQEQEQEQEQH@=E!QM(;qΚPv?S 0S 0QE6EQEQEQEQEQEQEQEQEA(a֢)H(J((((((((T߈)n)b(((*Q#?(?U<8=x>(GQOJ((*Q)=Š(GQ((((((((1ES )QEQEQEQEQEQEQE0=8>i@zq}?TQL*Gz=袛M(((((BES {4QE0:(((((?''x Gb}E(QEJyע)QEQEQEQEQEgET=/E%QEQEQEQEQEQOO^?[OO^?[E t tQKKEQEQEQEQE~= y(EQEQEQEQEQEQE P:~gQN(('x,_˽T~=2(QEQOO^?[ET~=袊Z((((((a[ފ( (EQEQEQEQEQEP=)@'T=O?O ?(AO)ih(((((z (Z(QKEQEQEQEQEQEQES׏ES¨ퟯ4QE:((zQE?4OxP;~'*arzq}QNQEQ@)~?:(߉)QEQEQEQEQEQEQEQE8+ע)s}(xtQE-QEQEQEQEQEQEQEQJ=(QN{O{E;gqN~QNQEQEQEQEQEQEQEQEQE'QNESҊ()h(((((((((0O@MQN4QE;_ES?QN(((( OcESazie/(yc?i`?E;joahI=I)(((E{csES_)v/>آ)W~TQE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQKcQKhw{QE.h](~B((((((((((((((((((((((((((()p}K*(FC(ǷtXΊ(ޟ67?Ɗ(O3F~?(}GŠ(}Gl> (J_/<G袏/z(_K/]FO6S?Š(=Ol (bѱ}袗b~iv/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ(ؾ6/Ɗ)6Rl6S?Š(=Ol (`?Qz( O,v?(/z(?y~^) gA#h~I(~F?_MM(cz~hޟ(ñʓk*(FC( )(((((((((((((((((((((((((((jʊ(ؿOsESLc??ERyghM(v?QIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQESJ?) ď{E,#QIomQEQEQEQE(b:EҊ{cqN{QM1Μw~QHQ8nS~<:(–)((((QOl}?(i֢)v(EQEQEQEQEQEQEQEQEQEQEҪ{~\QEESJퟧ?z(EQEQEQEQEQEQEQEQEQzрzE0>QM({sΚP?S0GQf1EQEQEQEQEQEQEQEQEҠ?֊(?j(T(((((((()?(aB=(EQEQE($t8i@}=?Ҋ)?j@?QL((P*(Ul9)QEQEQEQEQEQEQE!PzZ(({sQE(((((((TzBE09uB:s袙L((((((a@zq( ERQEQE'RU?~x<9:r}yS*QEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWQ&Qo>Z ~O|A7OWQ_ 'ڹ (B}huQEQEQEQEQNU'?QRJ((zQR'e??QE>(ET)h((((xBz(((((()IZ(=jPtZ(REQEQEQEQE(QEHES袊(((((pR}QRzE((xBz E P:~}2(QEQOO^?[ET~=袊Z((((((}z_( oES(((((P ?Ԡ~=w@>E%>(((((()I(*(EQEQEQEQEQEQER'{QE?ESQKEQEQN Ƕ> xAߟҘ_~j( ')(('QE< yTQE>(((((((( OAES~QO AEREQEQEQEQEQEQEQEI)BQE (_qI(ޟʍFF))((((((((((((((((((((((UOaQI}QIҊ((a?ERQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEݪ{OERyc?(iCESJ((((2GC(*P){hPvNz?QM({N>QM*GPiRQEQEQEQE4QEESJ0ퟧQM((((((((()ESJQE4E1ERQEQEQEQEQEQEQEQEQEҊ{cqM(>QL({sΘP?SH#4:QE%%QEQEQEQEQEQEQESJ폧j(P9)QEQEQEQEQEQEQEQE!)c(T?֊((( ?ʊ)=O;E0E? 9J((*Q)=Š(GQ((((((( QE0E(J((((((zB(S)=Š*2L QE%QEQEQEQEQES ӏꢊ*2u袊 )*y~ɟ<]gz_ŝ9>Q__z((((((((_8F"ODӎEQ~qh((((((+Aɟ)T>5=G_=^E|/\QEQEQEQEROO*@ry?QO((w?QRJzES=h(=(uQEQEQEQEQN OZ( J(EQEQEQEQEROAE(@=RQNQEQEQEQEQEҊ(z_*J((((((a[ފ(}OE((xBz E P:~gF\?E() (:ǽQKEQEQEQEQEQES׏ES=huQEQEQEQEQEQJ'h^< yTQOEQEQEQEQEQEQEQ__z((((((((_8F"ODӎEQ~qh((((((+B?(_s ~O|A7OWQ_ W!EQEQEQE=( p(()IHHh ׹p?R(zQE N_֊((((((P QE @:OQO(((((Ҋ*PϷoHyע}>((((() QE tQE-QEQEQEQEQJ*@u(EQEQN O?HHOފ*@}}J=8oSQES׏_ET@)h(((((xBz(EREQEQEQEQEQESSQR @=EuQEQEQEQEQEP=('E(Z((((((z (Z(QKEQEQN OoSE?0QOOSERQEQOO^?ϧ(QE:(((((((('Ί(QE:(((((((( OAJ)?SZ#?ߟTvu-QEQEQEQEQEQEQEQz Eڊ(?ESQKEQEQEQEQEQEQEQEQER'4QEQE7k*((((((((((((((S*(cy (Q8)(((( S0E҃E8I?*(=?8:oSJvAsEQEQEQH@=FhiA"(=C(AA)(((((((((BQE0q?ESJ0ퟧQM(((((((()QOl}?(P?0:(GQiuJJ((((((()n?Z(Ul9)QEQEQEQEQEQEQEQE0ES QE6((zpb;*(?]<8E)QIEQEҠGtQE0?QE2(((((((?))QEQEQEQEQEQEQE0=8_o0=8_oTd~=2?QIIEQEQEQERS}<9:r}yS*QEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWQ&QO>W#o/hB()Bh(=(uQE(*ENoOT~_֊)9EQOO^֢*@(Z(((((>QRJ(((((('OO^?Z*@TZZ((((('QEJz((((((QEH/(EQES=i (F\EeQEQE P:~gQN((((() (:ǽQKEQEQEQEQEQES׏_OO^>/UT@@N(((((P (xAߟo֢*Lb((((((('))QEQEQESK('1EeQEQEꢊ)QEQEQEQEQEQEQEQE8)=ES/TQE8:QEQEQEQEQEQEQEQE(QE8!qϭ((((((((()}hxAܓQE袊Z(((PdQN{?ZiuJ(_s?i(:)?QE(()B( ~QE8 ESQE-QEQEQEQEQEQEQEQEQEQEQEQNǷtQE/{Š(?)v?QN(((((((((((((()p}K*(ޟʗcz*(}E.(_NrE;b.?(=Kzʊ)ih(((((((((((((((((((((((TQEO](O3ER> (= (/EXO(EQ}QK}?S4QE?ERzQE`zQE`zQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&QFQFQI}?S4QE?ERl(=OQE';QE_ע)<؏4QEŠ(ޟ(ޟʊ(?)##EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQERmS/IOaSv/>_q}E_IQI“a?Rma*M;_EGPG֊((((((((((((((0Q(UOo(bŠ((}=袊iR:ERQEQEQEQEQEQEQEQEQEQEQEQEAQM(;?Z(P)((((z:pv9iA#?8I?/E4N SH#:)(((UOoˊ(c?iVESh((((((((B3ESJ~)?hmQEQEQEQEQEQEQEQEQM(?Ҁ}?1E‡?nOE3u`QEQEQEQEQEQEQEQH@=EQL)?QL ((((((() ~?EC۟}(au((:QE4>O SEB=R;E6(B3ES z(GQERQEQEQEQEQEQEQEC۟cTQE0:EQEQEQEQEQEQE€QEFTFTRSh(bJ|oWY/cg?gNO/W^e^((((((((/i?QE5m4_t((((((((*7 )g\_~%W•QEHQRQEQES ?!`>Tj"=?Z(J=ڊ(B}huQEQEQEQEQN OZ( OΊ((((()II袥 OΥ OΊ)ih(((()=?3ET@>QE:(((((zQE O_ʊ((()@'{PHh^~~tQN袊('z*@{Z(EQEQEQEQEQES׏huQEQEQEQEQEQEQEQEQEQEQEQEQEQKz \QE(F=9Ƕ>4QK?yg(z]E.tWE.` ((((((((((((((((((((=h]*(cz~h]~ER~QG;Ɗ(=ER_OQK}EQ?*((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((() ?(ؾ)6SQIQE!#h67QI?Q4QE&QIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER`zʓ~TQI}?SI}?SEORbŠ)6QM}ERma*M;_Eb:QEQEQEQEQEQEQEQEQEQEQEQEQEQE!hB}QE4?QEҌ=QE4:>QEQEQEQEQEQEQEQEQEQEQEQE4*(cy (Q8)#QEQEQE#")T=>QM1Ql?iE6((BE҃袊iC۟tQE4:QEQEQEQEQEQEQEQEQEQL(;qΊ(#)QEQEQEQEQEQEQEQEQE0:aAۏtQL(G?4„{?3EmQEQEQEQEQEQEQESJ폧QE09tQE2((((((()n?:(*G_Ί((( NGhP?H}ENJ((1ES QE6(((((( QE0E(J((((((POU4=8>(#zǽFTq?Q_p1?%?OO>?7W߀+^ ßx'_+k2QEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQEgIE;nk{7Ŀzd(?>QE-QE(?Z('zTlQN袊(z_*J(((((xQEHES袊((((P ~h^Oשד袟O((((P ( y?^(EQEQEQEQEQEETҊ(((ד2袟L$QE%I( )QEQEQEQEQEQEQN~M$((f(c)XO(QEQEQEQEQEQEQEQEQEQEQEQE.=)YG (wɢ) ((((((((((((((DZ_Ηk:(>ފ)|Os?Ɗ)4(.((((((((((((((((()p}ERoOERoj((]E4QE.tQE(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((()0=ERmS*(sERbŠ(1~<QHQ8) )##EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER*aEҋ?!E) =,}ibkFQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_#EDk_k{7ĿzV (ΚXsE(t'QIE8)>=h(?:(((((('QE t)h(((('?j'?j( ((((((zTQE<:QEQEQEQEQEQE/UQRzE((((((z (wxt)h()~?8ϵT@?)TQKL()=?3ET~8)QEQEQEQEQEQEQE(QE<'袊xtQE-QEQEQEQEQEQEQJ?Ҕ)=Sz<'QE<: xtQKKEQEQEQEQEQEQE`4QE4QE< :(QKEQEQEQNǶ>4hw9)a (cO(EQEQJ:(#?QN~QE:(((((((((((c(OES(E(((((((((((()v?;kE8!@?(C܁z(yc?iXO(ڣtTvΊ)((((((((((((((((?QK?QER>(s?Ɗ(ؾQE;j:(t((((((((((((((((((((((((((((=h\C(TQE.GEloOQFS)vQQF?_(}EQKz(/Ey~^(?QE.O(=OQE?Š(`?QEl (EQz(6SQFO(=OQE?Š(`?QEl (EQz(6SQFO(=OQE'袊<EQz(/EŠ(aQEl> (cz~(cz~h6)0}h0}hJ((((((((((((((((((((((((((((QE&=)6/QIz(a?QI?QM QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQH@=@?ZEQOl}?(7 (c{(##JJ(((((((((((( QE҃EQM({J(TEQEQEQEQEQEQEQEQEQEQE!hiAۏESJ)QEQEQEQ:QE4ߗ SL~88*(#>AsEZ(() OES ~QL*Go}hJ((((((((f(ES 0ퟧQM((((((() ~?aOC? (GQL ))(((((((T߈)nJ(EQEQEQEQEQEQERQES zES#)(($t8i@}O{ϥTeH=ފ)QERQETen}_QEEQEQEQEQEQEQES ӏꢊ*2u袊J((((bI|_oW?<c_gNO/W[W-^((((((((/i?QE5m4_t((((((((*/ 'g\_x7:_ *sQ3ӁE:EgET>ޟ}QEQEQEQEQJQRQN(((()IZ(BRފ)ih((((azQE(tz(((((('zQRE((xBz{J(ZmQE Lu۷^(EQEQEQEQEQEZ( O)QEQEQEQEQEQE_ESן9)QEQEQEQEQEQEQEQEQE8!>_ES)((()~?_K(?j(iOA^)0=I)(()}hxAߟtQE8: (((((((((((c(OES(Eb((((((((((((zP v4?϶h_NrE8*ߟ(U?(S((((((((((((((k:(c{ E/)v/QKGo袊v1EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQERŠ(kzʊ(ޟ(a?QG{Š(OQKz(QE.OEmQ:(~B(tQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&0=(M袊6/hMERbŠ(?QE&?_((ޟ(F(F((((((((((((((((((((((LQEWE)3؏Ǐ)67(B QIEQEQEQEQEQEQEQEQEQEQEQEQEQERPւE&~?n~?(?ji֢n?n?(GPG֐:>QE%QEQEQEQEQEQEQEQEQEQERP(iA"(=?QM*GQERQEQEQEQEQEQEQEQEQEQEA?)?CZ(a?NQE6(((zpfE҃# qQE0E6((B袊aAƊ(a?NQE6(((((((( 4QE4>QE0sע)QEQEQEQEQEQEQEQE0>4>S L LE6EQEQEQEQEQEQE֊(?֊(ʑ~=J(((((((P*(T߈?Ί(EQER#?^*2?S}QE2EQE!)=Ɗ(GQERQEQEQEQEQEQEҀ}?Š(ʑ=ފ(EQERO}x;{:r}yڿQjQEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWQ&_Q?>W#獿n'oj$Mr4)ʤ*P~QE-QEQEQEQEQRETQEQEQEQEQE(?ZP ~QR'ԁ?QOEQEQEQEQE(j(=uQEQEQEQEQJ=?֊(דQE>((azRފ*PtERh(z_)Ҋ((((()IET@>袊uQEQEQEQEQEQOO^?[OO^?[E tz:ǽREQEQEQEQEQEI=MQIEҊ(=:((((((((QEQEHEREQEQEQEQEQEQE{c^l}xE< O;QE>EQEQEQEQEQEQEQE{c^(_pt)h(((((((pB}(?ESA(((P 3ES~Q?O(Q?_asۏTQNOSERQEQJ=QN{?Z(G֊(QEQEQEQEQEQEQEQEQEQEI(pC܁E~1ES@QKEQEQEQEQEQEQEQEQEQEQESN ǷS_ygEOb}(QE--QEQEQEQEQEQEQEQEQEQEQEQERʊ(O3ES_)v/QKGa袊uQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQK#ERoOER>)|Ҋ(rEl_s}ER_OERzQEQEQEQEQEQEQEQEQEQEQEQE>(?)v67?ƌQ(ԛE<܏o_8_/o(?o(ryEl (b~h}4QFOѼh`?/GG _0wQz7CQz7CRl> ](aQ}CQAF?rE&Gё?1Ema*2BE>4QAu}hJ(((((((((()6AQE?ERl)<_) gEQQIoLCQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE!hM袊ME,#QHUo(GPG֊((((((((((((((*P) (?_J袚P ҇nTݬ;(((((((((())ltQE4ESH#QIEQEQEQEQEQEQEQEQERQ(Pv?QM({`Eb(((f1tQL(;qΞ$袚PzfTQL((z(Pv8)XvӟQM((((((() QEžQE¤uQE%QEQEQEQEQEQEQH@=E!QL)?aOCE0E0ERRQEQEQEQEQEQEQE4>O) E(((((((T߈) E((B)(??֞*(GZ}RQEQE0=8_oQQGQ)((((((iP}ER=ǯ{ERO}x;{:r}yڿQjQEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWQ?S/(}_5KGO< O^O\%(((((aET~=袊Z(((((>H>TҤQKEQEQEQEQET=/E%QEQEQEQEQEQRETQEQEI&*P{Z=8j(S(('x*@~QE-QEQEQEQEQJj(^~뢊)QEQEQEQEQEQE{4QN ~n?_QE:I=NhJ()BOES~QN QN(((((((((=hxCߏESҊ(@?EREQEQEQEQEQEQEQEQEQE`4`4QNNE?SQE8*ߟ8*ߟSQEQEQEQEQEQEQEQEQEQEQEQEQKcQNf(s?Ɗ(Q?_(t~QE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQKz (kz*(a?QKz(`?QE?ERzQEQEQEQEQEQEQEQEQE>)v?ԁ67)7/袗aRo__R~&(<4QKz)4QE%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE>(?(?(?(?(?(?(?(?(?(?(AQIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE#QK3EÿtQFE?Kh4yh`?R߯Z)<KzhGѽ}Rl>޾ (ޟ\Q(އ򥢊##ERQEQEQEQEQEQEQEQE&QI}?SERl(c?Ɗ((a?ER`QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&?*(Q}9) ~QM_qERGPhJ((((((((((((z~P֊)6/v/E4:itQM*÷4ߗ4QMEQEQEQEQEQEQEQEQEQEQE4ߗQE4:(Ql?hmQEQEQEQEQEQEQEQEQEQM(>QE0:(AEQIEQEQE(b:(=aC۟t{Z)#:((B(aAƊ(#>QE%QEQEQEQEQEQEQEQM*>aC۟tQE3u((((((()TӊiU=)#?Ί)((((((( (??֊(GQERQEQEQEQEQEQEQEC۟cTQE3u((:(?j@Eu((a@zq}?TQEFTQIEQEQEQEQEQEWLu' '^s]_xg~ӽ9>Q_c_z((((((((_8F"ODӎEQ~qh((((((+F?cS(On?|@_>xnr4QEQEQEP=( y?QO(((()IN OZ(=*@}}J(S((((O(:QEQEQEQEQEQEI=hJ)I袊(__Ҋ(QEQEQEQEQEQE @:OQO((((() ׯ꧄'^*@tZ(?3֊)ԴQEQEQEQEQEQOO^?[ET~=袊Z((((((?(~=袊Z((xBz 袞s_ޣ.ON?[EeQEI(^QO(((((() ( (EQEQEQEQEQEQES4MSןO^SQEQEQEQEQEQEQEQOO^?QO~QE:((((((((c^?QE< :((Z((P (xCZip=(Q?^L=Nh((c(O?j(((((((((()BOES~)v(QEQEQEQEQEQEQEQEQEQE`4`4QNNE,w'?_E;_KGo袝N(((((((((((P )lEXE;gqESA(((((((((((((((f(DZxtQE;c{QE_(]ERQ:(tQEQEQEQEQEQEQE'')v?&@@hc{M;_EYG ?QK/2<Q}'{QK}?&\A MZLS(((((((((\CQEm>)v7?Ɗ(cz~(}GQE)|EQz(`?QEl (b~(b~h6/Ɗ(ھ(((QKEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER`zQE`zQE`zQEmS/ERl_OQFOE~?(EQz(O/Ey~^(}GQEŠ(ޟ(LC(:>QEQEQEQEQEQEQEQEQER䎄(:(=KAQI}?S4ϠƊ)6R߯Z)<җx4QI](_qKOqRma?KzE&1EQEQEQEQEQEQE)6)6SQIQM(QE[TQE%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQIz (Q}9) ~QM_qESH##EQEQEQEQEQEQEQEQEQEQEQEQzрzE4SJ)폧SL~4?QE4ߗ4Ҭ;~\E6EQEQEQEQEQEQEQEQEQE`4QE0)nOE(J(((((((((UOl}8QE‡QM*GQERQEQEQJ  SJLSÞ?QE0:pe=EbEQEQE!Pz(c?aR:(((((((((ES ퟧ4QE6((((((( 4f)=L)?(GQL ))(((((((P/(ʑ)((((((BES z(GQERQEQJ (P*x_G~TQL*G_Ξ=hKEQE4>O*2{_8)QEQEQEQE}=d_^ޟO((((P ET@?QN(((()B*P{Z(EQEQO {wSKZ(@DXj(P ?QEHh}QEQEQEQEQ@QE O_O~tQEIEQEQEQEQEQES=O{ӂ=O{EHsRE:EQEQEQEQEQEQEHފ(((((() (:ǽQKEQEQOO^?!`:]袤 O˓ӏEQE8)>QRQE:(((((()~=Ί({EQEQEQEQEQEQE''S?t?T@?*@tQKKEQEQEQEQEQEQEOTQE< >QE8:QEQEQEQEQEQEQEQE(RzǵQOQE<: (((z Ew)v\?S֊((l}xE>QE<: ((((((((((c)rOES)h(((((((((pF=9c_(ONʊ)TvQ)((((((((((()(OER_s?(:? (((((((((((((((mc:(a)|O)(\~TQE-QEQEQEQEQEQE.?QK?QIGqRg)7QE;_Hdx(ؿ_1M`?QE.thtǹ_ʊ(=Nh((((((?QKo袊67 EŠ(OQKz(϶(])vAQE`Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((()0=(6?)6/Ɗ(=ERbŠ(?QE&?_)67(M;BEQEQEQEQEQEQEQK:?(=@?.M{OKRl_q}KRy~.haR__E&GLCRE%QEQEQEQEQERmS/ESv/>)OQQ#ᚌO E6EQEQEQEQEQEQEҠ}(9(EQEQEQEQEQEQEƒQEuj(((POUH߿*GҞ= Sih(ϽQQ#zǽQM(+&? g' u~5wNt1E}~((((((((i?/N:QG#WE]I+Z(((((((L_}?KGO< OFP ~QEHO')QEQEQEQEQE8!<S~Tj@~QKKEQEQEQEQE O_~QEIEQEQEQEQEP=('sETQEQEZB@QRQ'QKM3*@(((((('QE tQE-QEQEQEQEQJ'h =*@{Ҋ)(((((('x*@?QE-QEQEQEQEQEQO{tQEHQKEQEQOO^?[M,j({eqE() ׯꢊ*@tZ(EQEQEQEQEQEROAESzQOQE-QEQEQEQEQEQJ=ڔzǵSHw)Ҋ)h(((((0OA()@uQEQEQEQEQEQEQJ=hpCߏ}hxP;~'*(EQEQEQO{ΚXx@=\u0zEQES?QE>QE<: (((((((((4QE8!E{QO((((((((((P҅'Ί)3T*(QQu:(((((((((()@'4QE8!ERc?hv)QEQEQEQEQEQEQEQEQEQEQEQEQE.]4QE;(]϶(vtQE-QEQEQEQEQE. )vR>z)|O`E;b7=EW~TQKI{Ί((((((kzʊ(ޟ)vQER~QK{Š(ھΊ()h(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((M~TQE&MQIz(O/EŠ(ޟ(F(((((((ùΊ) ?ooc(_q}KRy~^x?E&ܾΊ) d(EQEQEQEQEQE7jQEbG=袊i#hB;~_4QE4:>QEQEQEQEQEQEQEQEQEQEQEQEQEQM(>QE4?QEҌ=QE7u(((((((((()!iA"PvȢiC?=C(GQM ))(((((((((zESJ~){(mQEQEQEQEQEQEQEQEQM*o}hi֢)QEQEQEZPt?j(Oz?QL(ö~4AhKEQEQE4>O QE„theQEQEQEQEQEQEQEQM(?QEFPhmQEQEQEQEQEQEQH@=E!QL)?ž?EuGZ((((((){EC۟cTQE2(((((((ETeHEQEQEҠ_9#?y=@AQM(Tz((GN뢊+&? g' u~5wNt1E}~((((((((i?/N:QG#WE]I+Z(((((((L_}?KGO< OO^\% t)h(((P ~hTU"O}>(((()IQEJz(((((('(: ((zPN94QR'e??E>(x*@(Z(((((azQE(P:~tQE-QEQEQEQEQJ=)@'T*@uQOEQEQEQEQEQE8!=xTQEJz(((((((=:(((({w?4}FXa?QKM(?({EQEQEQEQEQEQE(Rz~f(ןES袊((((((pB}NO(?5 @=9u:(((((()IxAߟ?ʊ(QEQEQEQEQEQEQEQE8!>_QEuh}QEQEQE8#xAߟҘ_~j(4QE%QEI?QE3ES~QNؿ_1ERŠ((((()XΓ u ~4QJ ޓz)XOC E.M7yQK?*Mz~QE%QEQEQE`4QE;kEڊ(OQK{Š(ھΊ(QKEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQERE`EmoCQEEQ?Q4QEER> (~EQ(6QQKQE_ע(OQG袊<EQz(/Ey~^(?QE_ע(OQG袊<EQz(/Ey~^(?QEYEŠ(aQEl> (QE&GEloOQFGE>4QE>4QE##)(((((((((((((((((((((((((((((M~TQE&MQIz(=(Q8)6)((((((?Rm_ARo_QE!E/oR)67>ܾΊ)Xv?SC(((((BQE7b(=(Ql?hiu}h((((((((((((iU=TQE4;QE4{qESH##EQEQEQEQEQEQEQEQEQEQERʐ=GTQL1cE4J0ퟧSiQEQEQEQEQEQEQEQEQF3ES z(P?QLF(((((((((iU=ES ?_QE4:QEQEQES0?z(?]<8E¤uAsEQERZ(PvZ(T߈?Ί(EQEQEQEQEQEQEQEžQE(J(((((((Pv_袣*GQQ#JJ(((((( QE0袊auQE%QEQEQEQEQEQM*z(*Gz(EQEQM*oSÑןQ_Q_z((((((((_8F"ODӎEQ~qh((((((+G_(Gm~R@7xO7u?S诅둤((zROJ(B}jP{Z(S((((x*@QEQEQEQEQEQEHQRQEQES=i E(tz>Ҋ)iRO(ןע)QEQEQEQEQEҊ(Bc>ݿQE>((((((=:!ǷEH*@EQEQEQEQEQE8)?O_֊(}OE((((((?({EQEQE Cߏn?E*2EQE/UQRzE((((((z P (TꢊxtREQEQEQEQEQEQE?ESQKEQEQEQEQEQEQES~)Tvך(EQEQF 3ES~Q?O(in?_QE:EQE'QO{Ί(Q?_(EQEQEQEQEQEQEQEROAES~QN o*(EQEQEQEQEQEQEQEQES1폯8#E8 sϥ< sϥSSQE--QEQEQEQEQEQEQEQEQz E}QE< sQEt((((((((((()BEESҊ(ڣytQE:((((QE.~?M;#?ǹ?S/!(:M,ǿsEܓ(((0OA(?QK(/)v/)p@QKEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQzh]{袊](aQE_ע)vSQK}?SEQGa袊\AQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEOmks{qwwRROqq<(`%yeG!#5gv!T@Ug` 32I=x'Q_n.eC4my&|O^6m$Ua?2M.qX6Uʾ~$\æ=5-&hcjAer>Q4W/X?$K ;򻍿/r}Vr*(ψ]}?l3Ӿq/s? KP׬ ||^h:O$rR[*(\l 7eQg'|e?ۯer?~ݟҊ~_7Wd#ᆓgxLd-E>02Zjƃ 5/ G ڧ9NK~:00EDʟz7N?01_%=QQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI?!ERm_OER_qh6SERy~^(}GQE&GEOJ(((((((((((((((((((zERl_9)XQEڊ(a?ERQEQEQEQEQK:?(ڧ_ʗ{}SJqzp~_עCGӷSJ҂B(:REQEQEQEQM*qES|_)?(u~QE%QEQEQEQEQEQEQEQEQEQEQM*QM1QE4sע)QEQEQEQEQEQEQEQEQEQE4ߗҪ{~\QE4?SL~S ZiR;E(((((((((SO(P?QL QEQEQEQEQEQEQEQEQL(;qΊ(a?O(EQEQE($t4QL(N?ϧb~_(Pi(KEQEQE0=8TQE0E(((((((=Gފ()֊((((((( H@=Gފ*2?Tene2(((((()QER:tQE%QEQEQEQEQEQM*_ϽQQ#?E((dI|SPq%^u,Lw<9֊j?:((((((((i?/N:QG#WE]I+Z(((((((K?}KGO< OF(zsǷ:zsǷ:(@ (((((QEJszQE(((((OJ(QE-QE(?Z(^Oר~o}GEQE(((((('(:ǽQKEQEQO {wSK}?ڊ*@*2J(EQO{tQEHQKEQEQEQEQEQES׏(((((() QO^~뢊)QEQEQEQEQEQEQE(RzǵQR?Ҋ(J(((߉$)~JaAL$((l}x)~J(: QEQEQEQEQEQEQEQEQE>QE<*֢)QEQEQEQEQEQEQEQE''S?}S?EOQKEQEQEQEQEQEQEQEQESES~QN~QE:(((((((((((DZxtQE;=ES/QNQEQEQEQEQE{~|RR(?.QE.?'袜4E-7$9(((QE.~?(QK}QNھ)h((((((((((((((((]{袊]4QE/{Š(rEOb(ڣytQE.)h(((((((((((((((((((UVfUU,B%U$HxuE ?QZGu_ٷ]#~մB |6WK'Pt_OXHB6i|-s~&Xt]:L0!od%ܤ4nCo #lⲚL){/_p`~_i:nDWg qwq+> YVm[}wfı>"3?|!IM{ YO9-m$UdaSB;S!8_Rh g+̶0cqAwy¾oP}[_tufDMyj7si\Ҽ=hG40 TK+i&,hqP?.)QEQEQEQEWw9tjLKxQxSBk%e%?u7+]gSԴ攸)^?\DW|>I/^?o,A#9ܤ) O70Z+fЍNWMtķ峳U 7|/oz]qq!?dҴx?HEXV&[(K\akUS B2Oݍ.-%VLO}M|_%|DQI|"ث4O2YǪؤ5:4 fHCOW.D%h/Κ΅xzkNӮ$EsQ"GtWYy"bⳤmOCB=L(((((((((((((((((((((((((((((((((((((((((((((((((((((~TQE&tQE&)<Ҋ(}EQI?QERm>)(((((((((((((((((iU=TQE!Aؑz(/) Eb((((PHMRS/N?QM(;?J$SJ{ӃSvd4QIEQEQEQEAQM(;d~)lƊ(GPϽQIEQEQEQEQEQEQEQEQEQEQzE‹?QM({J(AA>QE%QEQEQEQEQEQEQEQEQH@=@!tQL(;}J_4QM*ö~XvӟSiQEQEQEQEQEQEQEQEQL(=1ESJ)#QEQEQEQEQEQEQEQH@=EQL)?(TERQEQERQN GE0~?:(GQO=h())=ES#QIEQEQEQEQEQEQzEƒER:ǵQIEQEQEQEQEQERZS zQ??֊)S#JJ((((((ϽQQ#zǽQM((((()A*2t_(dI|U_cWgOd(բ((((((((/i?QE5m4_t((((((((* #g[_?|$@O:+ \ B}hN((((xNQEJ8QEQEQEQEQE(?Z(TTQE>(( ]OҚXszEH*"IERQN O*@{_)QEQEQEQEQE8)>֊(=huQEQEQEQEQJ'h ?Ru:(((()@'ET1ןnz(EQEQEQEQEQES׏_ET@QE:((?Xs?>QRA=?ڊ)iQES{w?QRAEREQEQEQEQEQEET~=袊Z((((((a[ޜa[ފ*@{¤(N((((((xCߏΊ(~?QEQEQEQEQEQEQEQEO_ x9b0cZ@ڥHLN?vLwrP0Z o迩s+ԪQEQEQEQEQEQEQEQEQEwK!K3<|:塏\ƥ<>GQb"obZ楧_;'k)][ӵ> WQ*XyӮ٭,.FTI`}GOp{qE Owqx[OW{('H'iMHAXXih|Sx]M~?QUQE%QEQEQEQEQEQEQEQEQEQHTQE:(Ql?hmQEQEQEQEQEQEQEQEQH@=FiSJ~EŒ;gsL(ö~4QMEQEQEQEQEQEQEQEQL(;qΊ(#(EQEQEQEQEQEQEQESJQE0:(:QEQEQFHqEҪ{c<9E„t4QLQEQEQL(N?QL*GҊ(EQEQEQEQEQEQEҀ}?Š(QM(((((()n?8_*2?uj((((((iP}QEFP?ESh((((({ >9 #jЅU}ZQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_E@LK$~Tx3qu?S诇`1(((()=?>QEJsQE:((((('ETҊ(('zZ(=*6rxEeOJ(TyES袊((((P ( y?_ES袊((((P )@' y?^^Oע}>(((((*@xt)h((((pR}?oz( ?ES() ֐.QRA=(EQEǨvߕ+j@n ݅F+VA5LfhڮOOX/?V 7%gP<_h_P Mu Kn<e]M߈7@+.z}!??*QkpzDߎ"/6 C}Me4O}e]|k?P il2<6@?%?L0Gҟ+1plo,ѦNl>;̚t4\ܶ{(4?H2|6HcV)3~bU(Z )c𶛡޻#VjEgOLH-4ip:߆&VV31}9u~!xGH֐j)\Ots#\ny7k_t]_MpO6Mgj'4%Jp9xG)r1E|z+#`?S(ؿ_1K~b(ھ΍袗~B~B()h(0~*Q>!?|U6C P[$znj5[qOB Sqk4-xD.wmZ7uRm7eIB_2 1 Hf*Zp4Pnէ9l`u}OAN_u-*|%Ꮓ,ŮƲNmuBwRyz߈kYgo'b摣Ycclc$t9%B7K43kmQBQ<^ZT(((((((((((*坦iuAեMͭմ[\B L;G"1UՑ]J 0r H 8[|o0ф'͹,d4ȔcQ?Љޟ脭Mz/yp ?z͢(((((((((((((((((((((((((((((((((((~T6AQzʊ)6/Ɠb~hbM?ϾhѰz(O'袓aRl> ((PQ86ޟʊ)0}i0}h((((((((((((((((((()ERm_OERl(b??Ɗ(ޟ)0GPGERQEQEQEQEQEQEQEQEQEQEQEQEQEQEҪ{~\QEOQEl(AA)((((E4ߗ SL~Sv7SЊ( -RQEQEQE!tQE4Ί(=hiu((((((((((=FhaAۏESJ??QM QE%QEQEQEQEQEQEQEQH@=FiSJ~EŒ;gsL(ö~4QMEQEQEQEQEQEQEQE!)n?)H(EQEQEQEQEQEQEQzEƒQL*GoQE((B3N GOE0Î/tQL O=h() ~?EC۟ʊ(`QEQEQEQEQEQEQE!PzǽQQ=eQEQEQEQEQEQEQL(N?ϧPOUS eH袛M(((((iPz}袊9(EQEQEQE+RG?|={:|#}!E ~VQEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWP%Q>W ~5xE|1\%QEQEQE O_QEIEQEQEQEQER'ڊ(B}huQEgET;}Zc?aϿ*(d֊(EThZ(((((>QRJ((((((zU O_ʊ)ҤQKEQEQEQEQESׁQEH(Z((((()=?>QEHES袊()I袥 O˓ӏEQE((f(=?֚\EH?ң.OQKM(z (TQE<: (((((((( Oo*(w9?Ҋ(A((((((((xCߏt袜yhN((((((((pV=ES~QO @(Z(((((((((ESQE8 :(QKEQEQEQJ=)| ie.hw?4?:(@?M.Ǿ>4QKM(((l}hp_֢){h\EREQEQEQEQEQEQEQEQEQEQEQE`4QE;kz*(=ESSERQ:(: QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE>?RoOK?R>}E_KQKz]E~~ğD("Kv!_em{ʄԴ+JĞ9*?<1'hY>xB9t-dZȡ3=Uf!U?(ǨhRAfçk|ka7{KoaP_xC :UÛ,޴D /[N^lXYW_GQoǧF0dvs*;Q_w%?`q/úO O62$3xzi6L+u`=?D?IC%U $pL>geB=*K(޸aM+q6n1j7 u{>-<>Նjҹ]:ItnHhilCOPcy (1~<!#hϾ)67>M;_IoAAZBEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIz (QEOQE?QM*ñʊ((((((((((((()QE4ESLgESJ)(((( QHUOa89at#iFJp`zEb(((iU=TQE4:(Ql?hmQEQEQEQEQEQEQEQEQEQM*>i?QL*GQERQEQEQEQEQEQEQEQEfzE4:iAۏtQL(ö~4Œ;gsEmQEQEQEQEQEQEQER{Ež?ꢊ)QEQEQEQEQEQEQEQE!PzZ(({sϥQL QEQEQ:QE4>O=P?R?e-QE֊(?hauj((((((( 4QE0:(AEQIEQEQEQEQEQESJ}ޚTc?>QQ#zǽFTq?QMEQEQEQEQEQE4=>QEFP?ESh( )#||]Wwo^ӽ>?چOV((((((((_8F"ODӎEQ~qh((((((+I?(?m~VxG?<^ OJ(P;( ׹)QEQEQEQEQEHQRQEQESIHXz(@DXa>QKMzQE(P=ES((((pR}QREREQEQEQEQEҜazQEJz(?>QKKEQEQEQEQE_*@{_)QEQEQEQEQE(QEHES袊()IzEHs_ޣ.ON?[EeQEQE(P:~}袊Z((((((ۿ袊: (((((((=:!ǷEH<: ((((((pR}?oz(?4QE:(((((((=(zE((Pj T~SAa$?j((pBz _)QEQEQEQEQEQEQE()s}hxP;~QE((((((((ox'(*p@:O((((((((pF=9)rOES)h((((((((pV=>(p_֢)TvןQN((()}i _E,w'4;4QN @)}(zEQEQF 3ES1EpU>huQEQEQEQEQEQEQEQEQEQEQEQF 3ESEYG ({{E;袊Z((((((((((((((((i?.*(ޟޟ_,#/{Š+~~?(c+8ym3=v 𷇵h~Vs #5@MѵmEOFӮ=bnUO$_?ǔP ;C[PonjOO.W>7'_"K~ׄu[ ^~w֬d1^iZ懫jz^k =3: ,n&F{kN9bUU#YJ#CEr %QEQEQEo?ࣿoٳ2z\Gǟ9nﮤqqV.um^-,St7,xc4H@YuKŽR{ +?pm|k~$}]+-ޛ:n&㿈:1go/G+@3׀?{i;yMԢux|_NmA%--1GߨFC3[URAp&lk%%P3v9E>UUN((|Ch_w/x:wтJ4k=Fm<ȝtnl]1^X\YṵH'$ddE*) $+5G'1H5}@v-+oc xPOKMڭ;k_E{% (~EQ(6QQF?_(}GQEŠ(aQEl> (c}QFGEloOQFGEma*(F(F(TQE%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQH@=@?ZETRS/E|v/>O/J(}GŠ)6ޟʊ)0}I*((((((((((((((((n=)<؟QE4A?QM*ñʊ(((((((((((()ERS)?CEҬ;~\E((()A#4QM*>~OQE4?SUl9Ӂm-QEQE`4QE4oQL({J(AA>QE%QEQEQEQEQEQEQEQEQM*o}hi֢)HϭQIEQEQEQEQEQEQEQERQB3Eƒ4q?EҬ;g^Ul9E6EQEQEQEQEQEQEQEҀ}?Š(#?Ί(QEQEQEQEQEQEQEQEƒQL*GoESh()#Ež?꧇ʊ)bEQEQM(?QEFPQE(((((((Pv*2?QE%QEQEQEQEQEQM*oM*oEB:s/]09)((((((ފ(ӟ袊w )#||]Wwo^ӽ>?چOV((((((((_8F"ODӎEQ~qh((((((+I?(?m~VxG?<^ OJ'ע*J((((()?N(BhuQE(( y?^gQO袊(;h p(((((P QE @:OQO(((()@'( OR=(N((((P ~QEHx)QEQEQEQEQEgET=/?E%QEQE(j T?֣/Ҋ)QESQEHES(((((xCߏn*@(Z((((((ۿ@E t(((((() ׯꢊ*@tZ(EQEQEQEQEQEROAESz_)QEQEQE}qHX?֊*@{£.{qE:EQE(QE<'>QE<: (((((((('QE< y>(EQEQEQEQEQEQEQES폯zpV=E?~OE8: SREQEQEQEQEQEQEQE8#E?袊pt)h(((((((0OA(QEO:()h(()X$QN?Gl)lŠ)IMQIEQEQE8#EESES(((((((((((]{ǏES֊(?)TvEQEQEQEQEQEQEQEQEQEQEQEQEQEQE''S?;kE. ]QK_Es(iψlX"qn+xc]hzqa;sEr ir>'ztp>:|ZsP5[I`}p`&YO<=~H͞owtgP5 q-Cפ׎Nu#/7ߙE~ 6oopAi B0(@q""ET0: +?OfҾ#[|+ݾw$ <#i 3/:yHiYKQ KɗF|f(fmlӶNDc7#Q_/3??c<|>>|7K='Iu櫨1$>6K*Zq~0dy9pbf9ђ쓥Y%KO㟎 / Ƴ)¶"n4jQ`g]W7!}_nG.nLqs=4H}7 =lQEQEQEQU4K{++yon6fHmGit(ѤTʊTfbUTdIEY?^+#u ]H dZŻIklYh<xweok~+mGO?z\C w"r|lf]*I-+3S8_v?^ރ$_uR\b((((( ;} QxmOĚf,__<֍Y={RvB-g~^]qX 7 &:ꯂd8o&lDm.WcxRLĖp1ۣY\̇,?Փ'(f*((((+Va}/Z; 6'e™ >TKK 5懧յKPA?cf4?-~~ &XҵR&r䖉&#,e}ـaS?AE%eEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIz (A ({M(ؿOsERl (;QE_ע)6QEQŠ(ޟ(k*(C(((((((((((((((((((((((n=S*(ؾފ)<ғ(c{MϾ(c7k*(((((((((((((((iU=.(iv'(B QM*GcERQEQEQEQEQEQEQEQEQEQEQE`4QE4oQM1)Xv?QEQEQEQE`4MSJ/40S ҜO֊)NJ(((*P(av?QM(ö~4QE6(((((((((*QES ~QL*Go}hJ((((((((=E!Pz(?ja֢aR:aR:(((((((B3ESJETeH?hJ(((((((T߈?Ί(=(QEQEQJ  S /qO?ϥS CEZ() ~?EC۟(eQEQEQEQEQEQEQL(N?ϧ(#?)QEQEQEQEQEQE4=>A9(GN뢊m2(((((+&Z#|6/>;7ƯΟ_Q_7_իEQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQE$S' ]?mo/+=nP_Z(QEQEQEQEQE"sQRQEQESׁ{O8bz]P;( )QEQEQEQEQE٢_/J(ؾ~1Ev@(|oǯ)k~|5m|@vZ>9;ĞӴ b.5xrk>mOqfZ>KLm^V,k'YEi4)! Rx$d7 ixuU `F;`W_3{֝i~4~_|_yeG~lWonU."Û(z妦өx屰ǨW>cGJr}vu/ iI?9?i2|Om?tw# _kC 1[Ai0C *q"(U+pҵih((ai!m#ͳx6yU6ޱ75 l| H-d巶[/".њؐ8i,o'v'Մw)eTVF6B?'fz򳨢(b/oM|&>۩_EϬqx;0˩F,n$.5i۾5?CҰ&;hvϴFwPd6Ez?{"~͟$ѼGѯfxW!gi>4 iz.0mW iWOQͬڐ;Gyw`/xEߍ(E-1Gӣe8tTJ Gf AwpCz#qWW5EQEQEQEQEQEQEt >x>>_~  GkM[@'}[DtۤJeɎhQq=w0]\żѱY"E"02:)E*08 G"^%šCbo-<[i_|/{"-3\vJ+Ip<'MYݥ~x:nXBoJ'I'BI5A(%qԌ0a#؊+ꖊ((( -*߶IH~ֳkPx"{L~jJ0xEF< woN湯)o :#*Z#I(YFP2MG4bX3J@TE%ޝywOe}cs=Oեݬ͵ LHȌ̎]+YI   lQSh(((((((((((((((((((((((((((((((((((((~TQETQE4QE&O)<ERyghBQF)0}ERQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEҪ{ ?MMؾQI_EݍݍQHAA E%%QEQEQEQEQEQEQEQEQEQEQEQER`Š(_qhO,?hiV/(EQEQEQEQEQEQEQEQEQEQERQ(PvȢ)nOE)((() SE4qÎS 0ퟧ80= Sih(( QM(;qΊ(=hf1EQEQEQEQEQEQEQEQER)?CZ(#>QE%QEQEQEQEQEQEQEQM*oSJQL({sS ?TQM 1EQEQEQEQEQEQEQM*oQE‡?袊f1EQEQEQEQEQEQERQ(ShauQE%QEQE4>Jxr:(#?3RzE2(B(aOOtQE0:(((((((ϽQQ#zǽQM((((()A*_ϽTeuB:s/]SiQEQEQEQ_o2$O=CWπk/ w?BWLjEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQEoR[~@_|GځtW5RQEQEQEQN OZ( OϽQKEQJ=?ւqɢTs?aS:(*EN((((()BET@>QE:((((('Ҋ*P?(tz(((((pBy<*PEREQEQEQEQESQEHES(*@?Ҋ*@QOSv)(QEH/(EQEQEQEQEQE~oQRA)h(((((xCߏn{w?TSZZ((((((=:((((((()I袊 _E((P ( ϷS EQOSv)(('Ί()QEQEQEQEQEQEQE8!>_)E(((((((ff)~?ZxCߏ֊)Tvן<*֢u:((((((()X׏QO;QE1EREQEQEQEQEQEQEQEI QOQE8*ߟ4QE:((()= u8xTMSퟯ?jisۏTQNOS((P 3ES~)|tQE8:EREQEQEQEQEQEQEQEQEQE()rOERQ~<:(EQEQEQEQEQEQEQEQEQEQEQEQES?;kEIJjI#*GjB"(B$p<$E'-K"~-._ j}nu_gn <̰=I-LjgiD&%{ԋ csW7 4,U|P‚ ?0|grLS+1 YϬ?hߏnTepQOE}/> |S3_?o>;C5MWİc7~_SiKR-m.J܄ksm{ћ+ŵk˩6I0sD)MU,'|YӅ' $N9 ץW ((((+71_|)|7| AC;m䯪?g-Guly7+i{kڂ{_Jӛ=XAW_LVQEQEQERq??T_Wھ?=K4wٰ]w}Wķ@ci\%Էb$gE3 ^ c{MB>1vp<݋0oWmĞ5sE|g|W >N|]_O,Y |2VãC&Ľ iWLPS\3?IpH%/gQma.#8Ca^Hc$o*NX( Q_᷂>߆R]$[o e cѶX?.|9m5;5 Q>g޳q\3_?_"_/E0sJK? o._i Z?~"tHk_x:$,|<̞gտׇ+[3 SdسRG={9k6 ζ=XA򢿴jN(((j7UWhXx߅8 ψę xCC?koo2iEl.+lt};RlJ֙>]%V˷|\JA  3XY$sOA?<XY.lOnt/j++ẈEs+6re?5|![_'#q,86:t Y`DAY3_-}zO @2?E26>%TxuεxWW{SuRceگKۛNn.y>,ݘfbYbzI'4W)U(((((((((\_uSҦß{MaRH]ͫ#T ֎`i~YX:H3{y2cCѼ5h~tEme6pi6-,᷉rvWQpġ"44^#B"ePҁp(Z(((+?oB-m|Ϡ_墵Փw59m%PcrIl/uvZbbthJg^[%#0sڃ'dAǻrMW^T(((((((( n>ҟbj̾I&|86>X"m([2mKSէc? C|ֵ '5h ء3/,w!15ɇhF~+A袊((((F1~TuXxsHEbƝ.ycV; W>aEX}Kx$f~"D קQaQM1<!v'(?>QMñʛcRRQEQEQEQEQEQEQEQEQEQEQEQEQE4ߗQM1Ί(a)#QEQEQEQEQEQEQEQEQEQEQHTQEOQEҌ=QE6(((f1 SJLSÞ?QE0:pu=8iuEQEQEQM(>QE0:(AA)((((((((BQE0QE0EQIEQEQEQEQEQEQEQES ӏ1E„{?˜PQE6EQEQEQEQEQEQE֊(?֊(ʑ~?EQEQEQEQEQEQEQE0=8>(PQE((B)P?H}ENJ((_袊:ǵQIEQEQEQEQEQESJETetQE6((((((ސ=>QQ#?etQMQEQE}>e_>;7ƯΟ_Q_3_իEQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQE%SIo?ϛ+<#ߍm/j~_ %IEQEQEH_ETQEQE~`=ϥTҢ$QE%Z( OϽQKEQEQEQEQET=/QRQEQEQEQEQEi@'EHR'E>EQEQEQEQEI*P{Z(EQEQEQEQEROA*@uES袊() }}?J(FXa?QKM ET=/QE%QEQEQEQEQEQN O=((?3֊(QEQEQEQEQEQER=:(AEQEQEQEQEQEQO{tQEHQKEQEQEQEQEQES׏_ET@uQEQE8)=! u4QO^0O袟L$QE%f(??֊(AEREQEQEQEQEQEf(?(QKEQEQEQEQEQEQES4MS?SA~1EQEQEQEQEQEQEQEI?(x_֢)QEQEQEQEQEQEQEQEQE(R{~QEESQEQEQEQE{c^:(sSK?SS Rh((c(O?j(GoϚ(EQEQEQEQEQEQEQEQEQERO@hpC(?QN @(Z((((((((((((kӶ?S{҄=pAܓzpAܓz(ڣyt;ǟE_/ -WVEg0/]֧ywv>["7[4s\ Hǘo43Xvk $ug)ZfV,/I;pYrMnF V8 :G=qE? +77_Q↭㯋jqn,~&ZFt|[eOұSO630Zw+}=|(%?e"Šg6(|- A oBD<-iB5vZ64+M<~!E{MiS(kHAnzVrOԭe'Xٍ2HX@9Qu=J>Iuħw?!|6j=Nj<<' cOrm92oo,ϙguqj;x[#܇"YGqEpVEQEQEQEMiWT [,;~?|md϶;xN?ln2<˛= (1[kې}O=7˪ʹn_c,Vu]؜E}[TQEQEQEW_OkolEY țc~Rծit Irֶk'_'O|CjapD&v1?yzJU#Q\IN?Dc[ooxJEGƯ{?_:qfM#Rm* {Ëmj~'?s:r6lѿqz|?5t3iaR9sO+n?4W/_EVQEQEQEQE ?a"3k}?S|gÍF!tO1+'~S.Ӯ\vnد$cj|RBh﯆ (Z!K/I/؋@H_Q/Ļ W|W/R\N+S LZo1|+[@n rͨO5$'@-WmCCYoE~נU(((+_Ɵ~Vi,Zxf)t߈'HV qI//Öfeqifm_R7?|{o\eZ[okm ;6ۃ#P<' Q_˽xeP((((((((((]G"xǏB2 7¿~4k6xBѺƬ0_ m/ FB_Kw6w7{VmuCЖT@֊((((+?SKq3\5#1ϿN>FIp:bXE_ voy⹘䦳whs@@+pn%$+*+7cz~kRoa}E&򢍇~E?E)|E&O/FO/Kz(=__3A^~'FYOmO~^o/|mg c1k ״i9@-6=YV*4JyV>9Ķ,GԐ`O?Ü7o(chnaX緸9YaPIHHFWGF*AA A #ֺ*ZZ((((cmfVx"xjj/7rD(ؾ(}4Q}?S4Qhb?yh=OR߯Z6Sy߯Z6Sy߯ZO/Kzh?Qzh?Qzh}GR__l> (޾ )67QKOqloOdzQHUc0}hLb(((((((((((((((((((((((((( QIOoMERy~)67QM*ñʊ(F(((((((((((((((0Q0Q(S8S8iv') c??E|Sv7>iR;iR;((((((((((((iU=.(itQE4QMF(((((((((((iE>J(P QE4:}袊J((((UOl}8SÞi֧E¤uzE%QEQESJ폧j(P9)QEQEQEQEQEQEQEQEQE4=QL({QE(J(((((((zB(Stž?뢊au((((((()A(P:(EQEQEQEQEQEQESJES ӟA9(GN뢊w )#||]?wo^ӽ>?fOV((((((((_8F"ODӎEQ~qh((((((+K(7k~VxG?<^ OJP;( OϽQKEQJ=?ւqɢTs?aǿ:(S( (SQO(((()IET@)h((((xN NQRJ:QE-QEQEQEQ@QE O_QEIEQEQEQEQEPxQEHQRQEQES=i (֣.ON?[EeQEǷQR((((()IET@>袊uQEQEQEQEQEQO{u Cߏn󢊐: xtQKKEQEQEQEQEOJ( Ί(J((((((('x*@?QE-QEQE8!>_R;EHs_ޣ.ON?[EeQEI?QEHw)QEQEQEQEQEQEQE8)=QO;QE(((((((z ҀOA(?xOSxP:ǽ<(ފ)ih((((((z (8?֊(QN((((((()B?ʊ(O?j(((((c,SE?OA^)bYˊ(EQEQNES)QEQEQEQEQEQEQEQEQEQE'QN4QE;_ES ((((((((((. nn$H`yd`1F$; 4*N$z$ (>DÁ_M|?k)%֧ 0V tv>fxk\F,z]3D*bR7݊C#W6 /_NJ۳Ugn&GC+] FǕEwVU~ |E[D6%a?ކ+WlS-u@ՙ$W3/ڏquX| |FZF,[[=|Wܰ^2X~#iuHKQVHl}N+FSY/rO3ZqWq ߪxC_qx1B+@cmģ@70QERŠ(ޟʊ(ҏ#œ? |@{ch?h_U/i|XFs; ƺ}slΡ ݖؿֲ6p-@>VcӖg5=m_/ڿC+(((<$w h]JŏkWN[>¶R /-0WO3jJk d۱+ Oel_?Q\č_ +rv%(tGx#+x\ҢG{+jΡsz#"nvi [A{=2'c7rF'lvw,A-'&D\HPg&NJ( ;+8&;{[[kxY.n&d I8VweU$#23UdI( o_|CK5={Viw th:6 +G=5 ʍE0 W=;M2d47S0EIl*8iW>?4W&y%/0]Cß 2~tO|m87L2o1T 7ad}|}TjŠ'OKS:oj xxcxᏁ#.o {O>.|aei1],R7?⏌ u P7V6/<Ʒ*bNі)$r' #:WE_(VEQE_HVY]Wl ?M)@|wq/q:9 {"o 2@#8Vߎ9@Wv55QEQEQEru[i?i_ F<[km,w>-|7|!MzuƱo gH?D^&㙼5|q7>'$Xj XU% ,FBm`hKu@|#PP0q_ʕx5gEQEQKz ({ u8cz~haQI}CRgE&?QQz)vSg֢b~MQ_l#wA}3+,|u)?t5 #á5?T7]m02?kuE}]QEQEQEQE4?OutYk/2y0Ic#1 E~oxyAgNrN\mE|\EEQEQEQEQEQEQEQEQE??_˖|Q3LFNB\,KL%v.џ_OcKM36s89'^}yݷzƄvᮞ(((<[_߱ĖtmUihVml/2>soZ.VR?bڲQ?-WɕEQEQEQE>(?(?(AQIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQK:(2}OhQF?*(޿b~h}4R_qhp?FO3QIz)wCYG)w Fޟ)r=G(}E-#QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI{ʊ(ؿOsES|_)6j(kQEb((((((((((((((=@?&(b?&~?(?ji֢iF9a?O(b((((((((((()TӏQM1QE4E((((((((((=GTQE0?QEҬ;g^(EQEQERa?_(?jxqߏTQM*÷8zE6((iU=ES ?_QE4:(((((((((QE0:(EQEQEQEQEQEQEQESJ폧Ҫ{cS ӟL(GNS)QEQEQEQEQEQEQH@=EQL)?(AEQIEQEQEQEQEQERQES zES#QIEQE($t8a@zqx_G~TQL*G_Ξ=hKEQE4>}袊O)QEQEQEQEQEQE!z((GN_ES((((((w >99<񷃎9^Ο_Q_'_EQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQE%SIo;ϛ+<#ߍm/j~_RQRQEQESׁY>QRJzES=h:QEQEQEQEQEgET>ޟ}QEQEQEQEQJsN Oӹ(__Ҥ u:(((() ?_Š(@EQEQEQEQEQE*PtEQEQEQEQEQE(j(^O~QE>(((((('x'x:ǽHފ)ih(((( ET=/?EEREQEQEQEQEQEETQEQEQEwT@(QEQN O?ESן袊}QEQEQEQEQEQEQOO^?QO oE(((((((l}xc^(*x@:O(((((((xBz}?QE< _E(((((((()=QOQE<(QKEQEQEQOOQN;Θd袟: S EQEROA(Ohp@=(QEQEQEQEQEQEQEQEQEQE8+ߟQE8G/QE;gZ(QEQEQEQEQEQEQEQEQEQEQE.>_%_^iyu{$lfk_@sujdѣ<[d]Mo9<YKEV ʐFiˍ˻gҊX/B$AlkAogC*Hob۷X|1q{~]BIѷNt1egoj1#cڦ UWTWUZ((+ൿ PW?n&&Koc`u"ȱ@cV cԕ5 zt\zWp^((((((hس.Vj_ǗQOïk:SI0j0\|qe"I5} Q}ls{8epWf AX|hEoE}3[T(((+Ϳ/U[Ư).07$ Z OV "$jIo>=XǍrS4#>r@؊ȧ%F\AQEQEQEmgZ<Nuƛ`i|aψ(~&-&ɞOsk_vH ! !1bw6/ 'Wp^((((R6ş$_M+kw?O!*፽Α[^t~8cM(T~+.Iv4ٯٹ;.!_lZ][qB+zɷ[SЊ+ZQEQEQEQ^wc|O'kg{t߈R-;A݅ݯ<=?">\F_G=O%džuitbXXjזҲz矟g˧dX_0ykିޛ3ßt 'rQ;vQ0 ψ4A$[*Ƥ09YW j";n#^Zv?髟a+*PQE_ע)vSQFO)v/QFOEl_OQF)p=(ի '+vK}Ē ov;cҡ@q _^c0 cJ+&EQEQEQ_ckq=ld бMfXd' ;9l}LǺJE|wXQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIz (A (A (A (j:((ؾ(bEl (E_ע(OQI(6oQEEQ?QI#ER`QEQEQEQEQEQEQEQEQE##񢐀z~Ra<:(ھ )6/h}4Rl )|oE'=4Rl> )wŠM)wQIʊZ)((((((((((((((((((M?*(}QHc?iF?( EQEQEQEQEQEQEQEQEQEQEQEQEQE4*B{cy iv'(M({`E4:M E%%QEQEQEQEQEQEQEQEQEQzEҊ}QE0sQEҤuQE%QEQEQEQEQEQEQEQEQH@=@)n?_EŒ=QE6(((zpfE҃<81ϭS ퟧ?zp 4QM((UOl}8QE‡?QE1ERQEQEQEQEQEQEQE`4QE0:(Ul9E(((((((zQ(?aOCaR:ǵ0Gڊ))(((((((POQL*GҊ(EQEQEQEQEQEQEƒEuj(((Po*@>ER=ǯ{m-QEҠEB:s/]QM(((((){EB:s(EQEQEQEWLI{P*| #i)ЅUoZQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_g=K?ǹkL~VxG?<^ OJ)@'E*}*6~ (TtPxQEJ?ʊ(EQEQEQEQER}QE(t)h(((3SƤT/񢊒((((P ET@?QN(((()B*P{Z(EQEQRL.NO~QRFI=hJ)BET@?QN(((()@'ESQRQEQEQEQEQEQES׏_E(P:~}@tE--QEQEQEQEQET=*((Z((((( ET=O?ES)h(*@M.hޣ,Oj(EQNO^>/UQR)QEQEQEQEQEQE()=O?ES)h((((('(xCߏ}i~?(H?Ҋ)ih(((((()=QO;ESQKEQEQEQEQEQEQEROAESzQN o*(EQEQEQOOQN;Θd袟: S EQEROAESQO~QE:(((((((((4QE8!:(w?QNQE-QEQEQEQ_U_bjJgOwKe{Wק= |{.3nA+ HV#DG'kK hk6Zy%I2d}XGE~ϟhSo߳t-CTM-*hJ 58SeJe2{f^?g^V4&wv_H9Jܻ*{ Ǩ?giCm'oBg_X|:M^J1KjlpbKPu-sYqlI A8?UӢyݏ~X'oyQ&_$@72YX/=ڮ>&~?|o)}5_|9櫫C3djw7vJI+q I 'o9%5]9Og v`ބ],m4n[_PV>(((3: U|cƟ'U\_S4 gKymG~=i h}nl^V."Q_%xQ((((k:(OhV7{w-$w=ϟx'F Q7o6Q񞅠ۓF|!Z\,`UfxyeuK똢_`;Vn]^Vh(((;"ao~?-lkW j&>o[aLd篖hԕC佤)>h v}k/R_MtE-eEQEQEQEQ_= ; ~>WN[tY k:ݗ%ľWbt<䰕]A>j^m=1,X':di-A瓜ٷ[ |4Ww=QEQEQEQEYK|6?goŻ'?_T5rZ+xSE#Ҽ1C4A.YT׵/9[M> oH`$5@2H2C$uۢOܞW0_[^*ΦK-M~X/ [qg iζ"wk뚾}uo>*o5NB9- v7H搴HK+Lzv{~NMUQdzΊ]Rn__E/=4R_z)ZL"xx>e':۟ Ċ='ޯ;UOgdž'h5Kcn-TC{[cOAZ\4?7ι= >`_޽}][4QEQEQEQEQEQEVVh%4?W4]F#z}@O{KА2bh)XaHz28*؂( 4Wg"7s*7jwcͮ|-ҵ>O/j> mF9<_Ì]qdn#TgM_qΚ&[L6}9Ky&MdUw gF9_?ؓkyy'ςxS,-?.5'- $Pe3ީ=xbsiZsmZ;bxsq0j5 3"Q~>YX>㲷Ӭtx?~1ծ_tPXXʵ0^_\Z?ٯB֗L;{@4gA+(>'4W/-K0ok߆ xGD:YjNˆAqk!rO]z}Ė6wQC%GUWS#Ped%YJGyʭ}QK}?S4QE.QFK?bYKW=|qp|OowM!!cX<]!Di@vo-9;Ck"I1prOx_WW%uQEQEQEQEW'Oe⤴k]#o4w ^x 4>%ejWX.5X|IM6= =ZQD`5EsڒmcW^ET((((((((Enދ>lln/=d&_Aju8YOt+_w!Jz? }Ba[X~7cE~פպ(((+Cuح|6$ u~ؾՖ<ᤳ$:X c|#C_[TP|J+v7?ƾ?(ޟ((ޟ((ޟ((ޟ((ޟ((ޟ((ޟ(i?QFQFQFQI:QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER`zQES/ERl_OQIz(O,v?(<O)6oQEERm>)((((((()r}Ohsz*)6/Ɗ]~E&ORy~ފMϾ(ܧtSJ򢝐zhF((((((((((((((((LQE4QE7 (Q8)#4QE%QEQEQEQEQEQEQEQEQEQEQEQHTRQM(;d~?_E4J??SH#?ޚAA>QIIEQEQEQEQEQEQEQEQEQEA(iA){(mQEQEQEQEQEQEQEQEQF3ES ~)nOEb(((zpfE҃<81ϭS ퟧ?zp 4QM((QOl}?(aC۟tQE3u((((((() ~=袊aOCQE(J(((((((PoSJ (#?3L(GNϧf)(((((((ފ(#?Ί(QEQEQEQEQEQEQE€aR;~#:(EQEQM*Ҟ?)u `zJ(REQM*_ϽQL(GNQL(((((){EB:s/]QM(+&_ g(u>4N֔GBi*7Z((((((((i?/N:QG#WE]I+Z(((((((4Jࡿ|g{#@O:+U ?0}(bz]J)IQEJ(Z(((( ET(}QEQEQEQEQN O=)ITҥQKKEQEQEQEQE O_QEIEQEQEQEQEP=('sETQEQEҐ.QRA=(EҊ(Bc>ݿQE>((((((zTQE<:QEQEQEQEQEQE8)>8)>T@>RSQEQEQEQEQEQO{tQEHQKEQEQEQEQEP=(''?:((Z(0OA({tt袞FXRh('x*@?QE-QEQEQEQEQEQJ=ڊ(/TQE>((((((( OAJ?Ҋ*@?Hw~1O(((((((f(=袊xP;~'*(EQEQEQEQEQEQEQz EQO~QE:(((l}i E< :a~ע~1L,OSv)(((=?)TvןQN(((((((()B?ʊ(O?j(GlyQE((((((GJ_? K?g'E4nԗ^C緽;Y^\kKxWo HS'j ׳ 6GQAJ(ab48*"ʠU:RQEQEQEQEQEQEAs ri<|R5*y3='9?V3}|>f^{U((iu~'@~wT.ᆪ_A)xK-F<|50R`"ywmZ匟8W{6oSb+޽6EQEQEQ_M?-wᆹvO~wI|c,hHYm-~8ڒߋS{Kmֲ%T)?֊#'5%eNf(s?Ɗ(Q8)QEQEQ_O ξaMEm<7灮tBdW|]ra]u 6fz'XeudQ 坫 `f'Ξم~:ʿEQEQEQE,vK >"ZKN.nox+cAq;>HB Wc^*rٱ`qfQ0SG"8*ұh((((J~*?~:uwq-~c~?4@'12Pm&ݤ ZG oYej$_H.`Cinx'mi ɢ:EQEQEQEQEw}ig kT_~_N<M|Z|G/lnp?7 a z/r0}bAFOF% FVK d꒐#IAq>uW_-V.IsEQEQEQEQEQE>4Q^6e_ h~!|!//WXJSQеxa.j jM"-aai1I[a x2oG\OFEAb24WŸiJ|ԣFeZx]s7%_QB6X<AhZGtFִ뉿B|/M;Ś-1\&,[;ϴ<KxǩT5 9Ԏ}+ jJ(((((((((+ ?nI?Dž>#k=Q5Ҿ!x.Y8WiHngԆ xzO#_/;bJ:dž5{=kL!29Xmn!I*9R*êG+~B/8Ox_^ .4/:8t%KnBUeIW=W֖^[Au dq+RCB2(ʬEQEQEQ_.M⏂_Gwi-Ÿk}smyi< >մd |}o,d1|Bhf}/EINe?gQ-[`݁F2HJ:ot v/|XR_OQFtQE.QFQK: QEQEQEQE_L?_g f35|#>"t־*<vHVω5}R<]ΪU<#RArmI vAFv殞(((O QEB=)QEQEQEQEQEQEQE!QE0>ž?E0:auQIIEQEQEQEQEQEQEž?Eu(((((()A>sETeQM((*_Ͻ<9ytQQ#?ԁQL(zǽQQ#?x)QEQEQEQEQEQE4=>QEFP?EW۟LI{P*| #i)ЅUoZQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_i>CkO_?(Ƅ-83yh(;h(((((*?Ҋ(@EQEQEQEQEҔzQEJҤ^OE}QEQEQEQES=֊(BEREQEQEQEQE~oQRAEREROJ TJEꎊ(xBz?_QR((((() ֊({EQEQEQEQEQE(Rz~}BE @:]JEuQEQEQEQEQES׏F:Xga-|yKNGwe|IQi>(y=!t}[0[]5MgeCY6B.Sa V[`BTHnr}Gr| ~siho]?þ4|6:NX[3)M$J^i$v+h---AmmC1D8¢I8dNI&@t`WcV)h(((((((4o,Ut=' 9>es#s#?|'//>=&QZ2Ok bpE~וJ((+O?\y׿ iC^Zÿ%-]ҿ乔c1~o kmQ 坩EǧopXVΜمȀ4W^W袊(((_ {+kmijww[7 x?~@bZ;IXʖt+ <ivYAqmwltoϰQ0SWE|gXQEQEQEQEQEQEWpOm|' |OfV*75;t>&9>\xOr٨M-Z}=><0o1AZzk|үVBW_V֭QEQEQEa c iQ}OSt xG.qٻC֫m;K#,Xh|=4Ar|}ݽtUuw$7W6¾~])7/ygE7z)vz)^9<=wP&f!89ncRђUX^Hŵ̖ϹySañ2(xUd_)Wb׾-36Cy߁^2IiWSͣ "7H񟅦4ŭV:5^߇gj%Ү^"Jjx LY"h$'*&ס+7Y ǸxIk袊((((((((($ȋ$r+#dt`UՁVVRC)H A<zhsE._ge | t %DA]xb?Ïj 2GDN.?G)H|;G_h7+qs2e ->fw0*Ggu!рcS8 !?P8Rz)<((Au?iXh%Gn{⯀G\Y[On&EDM|>/_qWhk>C>7G߱U m:8[FILt=U|mbkS$J<i>פ%O+)pF|?sU-$9dCrKi9$Q6'fZhı)((((((((=FhB{n4QE'QEŠ(ޟʊ(AQIEQEQEQEQEs*qE(sE';Š_0w(gho_kz*)r=GE7u(((((((((((((M{iAؑE҇ESJ((((((((((((S/HUOaSLc1tQM(M(EmQEQEQEQEQEQEQEQEQESJqESL~QL*Go}hJ(((((((((Pozb(=?ES((() ~?Ñ?4QL1AE>)((z(ShaR:Z(((((((( (?Z(GQERQEQEQEQEQEQEQE€S ӏE¤vE0EmQEQEQEQEQEQES ETd~=J((((((Tz((GN뢊)QEQE~=*2t `}?j(S( ETe(eQEQEQEQEQEQ_n3@?R'#y*| #i)ЅѕoZQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_i>CkO_??O袊uQEQEQEQEQJ=(QR'ԁ?QOEQEQEQEQEQE#bѩ "x"&^5+mP#4_U#h{}֣d*uQ?(֯fWǭP[ICS{O $EPnĕZ~͞@>ۯk,:>O[KzYF:E}!J=.4Ki .FI'}EQ[q~_9gyu(?_&N>}ԯ${!UhD٬A&n*s1mT{R\GKH?Ѣ}o V"w &wDhLj񒽼^>ensV_2_Aj6䏧a06p?_ njͿ&j20ol"';L vӁۖs5~ נ=@zdEkgS }iEw_3 W%<9>" |\k盐7O$ c-^j Ӽ[m1-X/Ȅ}8 *+'h%G>x+?o7ŝ^!^^VͧcPӴR^?x/ZE.`fؤ} P[sZݕ>ru]:[PH%"p8BА g\Z+'_j)SZZ(((((((=袊xP;~'*(EQEQEQEQEQEQEROAES~QO((((O?jaq۟TQO A'4QKM(f(=ES(ퟯQN((((+goƏ?>=k:7~cY7 c4+Fxޭɞzxا 2hH",){i6Asa Qh?e*MIcԆi2Zu{yqv=>f=ߐ,(?h7-.~8}4Pl7xfO| my]~,YŷZ5,Ҷ_V?g [mSV59F2!6uz!mjQOE~x :x Eyx0n㿉_5/GOվ!ˠFO%kf;Oma+$1ƣڦvä@KƊO"^5C]?`{>ҖSʐyuk%jMigx|+̼q@xk]_"un|O.s/oaeIa|)b-uڕQk6C<ASMȊ+Bc_j:/ȓIc'ÕTY\/3}B:9-|_k`ϡ铦SoޏSͻݸumgkA~Ӛ+N(((((((((2_:Aچ͟3n<ϳXs?oy~>HeA81XTSE8#EEWupMg_? ~';o+?x—?&[ZlW.y-q}S6O|_*}kw va _P(Z(((+ /#;HjꛥG |K."8%?OmJ c{$+y{&.;%1`xW]E|Q__W?EQEQEQEQEQEQEE?kgWVk"??>4|0ؓ?P]!NPJ"DF@}U> ZASu+3!{jb/mEQEQEQ^N|2_om# >L|uM{ ԻjG|G5iھF 2j ~>e5r:yY0GŅ*J!A kKZ{񢒊J(((+VS>' N\ypi~-x;foB tBp_ ?-.ݨ!$>xĐZ` @?@-ؚm_7KV袊(((( jk_Tov.?$"n< ӣE(Q C/|Vǒ5F>}"x^8W%q^(((0OA(kE}Of(ygERc?h< 0n/?qk_ xh9_hsgiHMksбGe6-nn" Ŵ8+{8JC)*ÐA Q_%amto~۟ioY,6W>6XY!)4jr<ϊuKfxǽcOX|Mfպ~mh2&1%F녙|¿>Ԛ+?_L/N`Fy?~.6k/ R;#>(rG;:嵥}T#N#SrVwp{Zq[ˍ'\?O4WgmiזY\Ewgwm2x7RX wꮌ+) U 9EZQEQEQEQEQEQEQEQEyσ|IGF~+x3v @"ӧfZ>}KmlFZj}}k[>hBTvtn>duWRA# {{Q_V>-i/o3/> F7]u WA=Y|WIKNmYb@״{Zkfo&g*FɝA q x5GF#=2;`4WՑQEQ_UcxU<'As6!›=GPcfH_ G}6^Ig -sPuqsf/QgcԛH#z8ܿ/QItQ_S_\VQEQEQEQE _L;<;$(i,tF0GtPxW5Vc>"YxZh֗gu}ww@5K㯂|cBM e#^-@zxX,2 Vfi.8l frrW_:VMQEQEQEQEQEQEO}KF#E$hrZtWnUX[[JUh:fΛE5/7?"%/b+礚vy1o\"-N?S'gLӰly7@PGQ_M}/ZQEQEQEW|v_/E>_M8tIJw\Y, =G쫧VhkJ9'8چimx-tI'lv񴌫vFvU5"3T+g~6Z_ǿ~7n|g{'%xTg0 sƾ ?CZPڊn?)۔I:? )h((((((((((()QE7b(c=x(UcQIEQEQEQEQEQEQEQEQEQEQESJ)SJ)QE4{Κc=E¤uTE%%QEQEQEQEQEQEQEQERP?ES _4QE4sע)QEQEQEQEQEQEQEQEQL(;qΊ(#(EQEQE#SJ폧?S S_(`(()A袊aC۟}(au((((((()b(QM(((((()AiP{~")#?Ί)(((((((ES E((((((=GQQ#?x)QEQE~=(GN_Re:(B?QEFP?(QEQEQEQE3RC|x |?kJ|#}!E]~֭QEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWO?R(i?|_<_~=Ɵ6xOE_W'M((((OJ(EREQEQEQETry?ʤTTQOEQEQEQEQE=POE t?Z((((((z_*J((pR}HXz(@{EQKMxQEHES袊((((P QE @:OQO(((((*@@袤 p((((((aET@QE:((((((=:(QE-QE()=/? ӟh8~cM|Dwe.cx>oUд4!A?^r¾ź\vSe<,a#.n3Un\y p?EU߲w%uO|,?j_وĿ>]zpL̾|;"Y`82n%);t(:}v^ c_9t '<7MZt.v". mE^{K;;>A (t`KEQEQEQEQEQEQEQE z. x?h1~7iO}mY5/uXtwADv3W5EQEQEQEQEQE(RzǵQR?Ҋ(J(((((((('Ί(Q?^huQEQEQEg4*$nXgzY 5{:s,IHJv7o~x3 |R<2pO~h:y8u$Ubݕψe_XmϬ2܋!8ڦ[+{GLJ+>5~C6~_ ~ %9u>!duy4ǼkXLJ٤0Vu7# j~ua+yf HR2CHbh_c8뢾O~($7ŰǏ߳go6prNkk3Om.m>GS/xKubɹ%&x=-Oi6FѤ ,ʡuMB3ʲ$en"H&닂BinpWk$iڊ{O={_T>(((((4}#:N^hZՅޕō^n^=]C-I ѼnY$q,i,RG$R*rFૣ+ h֊??8 f/߶EiGs&vIhNL| in©nTWo̚O^#|]I(ia,4ēyh9?`,@~O!eɼ b/WA>GJγh((4f)~?_ӂ~pAߟt?袝:)++vP_N_CS]'Um/Ĺj~T|!(?M_SCzrczdnPFBۇ([2EaXۯ| +y]]i]O]7ߴuo__Dr"Ù|)oʜ97j]3#@Nˍ^IbvfQT_Q?1suq_.>%}7Œ|!{o;"o@Ag.[,x&bcm}2ݔ} [cPР/Es7.{ߎJۍ;xº^َ >"!K9dҴɂ&R J~?(P Ko 22hN/&V.)b1,h_BT_iz dŻ[}G"2MOGE~J]?V_TKt? m{g+Q<3O$okž ++?z}iZDRs/#6_>Dֳk4o5څ⼐\O$g!].Q<*c'{ns8uppHz3NWp^((/ 4gG?? %xSսHS|,Q.D22)wdgp5-;R< @k`ظnhn(((OS|j>>O?~)4x/ \jm9֬qdAEլ`|S]w+/Q_"4rF̎]IVGV  E~hA >)QEQE((4RQ?E;)`)visj+S ;\}/Wᇅu[C ozĭ4__pK@(V'i~gxDQXۻt g)>;'55n!$(==]=QEQEQEQE2Re-m: #m#|Eh¸Ҡ8#W4xVYӰ1y2D@놌+/Ru4~?J+s¢]ES?QKEV x}5s4*[d>\\Hg!vr1[x^v6D.B.=֬ٶۘNq }sE}~WOEQEQEQEQE_HGVFɪ`TZ :nJCϏQq=NKprc3F?9ҸE.ER_OERŠ((((((((+_W1^Gy=~_l"xú ]_v:~y>y-}2G䉘6tk#5KN%-/''9$\C(%dFRz&?#bog: u6o~~\7-#6iGco7>[͊:I4t)qpj'㯍|v&[mkM|LOVyW H= =޿w>ç~_/Z\7[o {| VJoKu+A~jk:>92l9?cU=B:eDt>?S+gq8j;wZ&E#Z |}}u) l|Lk>[#L\n= r;%PI`B(((((c-~~ߟ :6+k~tە)~ |%eVp* \1iTK7ЪyH[?jt2>ޞF9ţX9cY?wCwnG"D<:3#d1vᑃ؇=~~?o?~,;Oq ɧxCx76ZuFEK{={iaD<=ZxEӵ}B& )qm!yӬI FJH'E4z:=(kfEQEQEQEp>Oÿ|&]'!wS𧌼)A3\ugUd1kyk,}p_X\^q[+MJ{{yFE*Â89VRFVeWRVzz+_F?LW&ݞCƷ2-o\x^{ǒ)-"X4IdGlu}mu8Ugԭu~u9>3Z[fyOk|@׭$nn.l<]減='J, u+66lʤ`-co:PI)ZZ5Do_W?9JS/> ]Z_>֏[Fz4 t+L1Z[ƍ4Ksq {Y_k;Km>;{h#HBF98UdĒIB0Q]Y(((O; k{|=%>'vɤ|.ccxRٚ;m'?i[:{r#Q1j1C!6usFCWp)8'+Sjφda}_(%l (b~(b~h6/Ɗ(b~h6/Ɗ(b~h6/Ɗ(b~h6/Ɗ(b~(=OQE?Š(`?QEl (ERycEQz(/Ey~^(}GQEŠ(c{QEEQ?Q4QE&*(C(((((((((((((((((((((((((((()6/hO,v'QM1~<QI(}ERQEQEQEQEQEQzEݫ袊ME,#QHUo(QEQEQEQEdRP(a9Q}9/?QJ{{QM(ö~4SQM QEQEQEQEQEQEQEQEQEQEQERP֊(_qhi#hiVTQE%QEQEQEQEQEQEQEQEQEQH@=@!tQM(;~҃EŒ=Œ=QMEQEQEQEQEQEQEQEQE!(ES 0ퟧQM((((((()QM(;qϭQL*ö~袊mQEQEE0:x~_עaF9m-QEQE€QE¬;gQM(((((())=ES#QIEQEQEQEQEQERQH@=ES zSTQQGZau)((((((Tc?>QEFPQE((((((zǽQQ#?x)QEQE~=(GN_Re:(BEB:s/]QM(+&g g(u>4N֔GBh7Z((((((((i?/N:QG#WE]I+Z(((((((;J࡟|埏z#Q74Wuh(( (S}?Ɗ(EQEQEQEQEBy<OT'tQRREQEQEQE(?Z(TTQE>((((('QEJ(Z(P ~QEHQE(xBzQEH(Z(((((>QRJ(((((('x'x:H?֊)ih(((()=?3ET@>QE:((((((=:(((QE<''?:ap:rO*@QOSv)(zQE O_O~tQE<:QEQEQEQEQEX..$XmW{tbGYQ.UgeDVwf 31ª,I $sG^WyWi?zmS] j kX<hr{{+l][qI $"O>G2Ki"f3RNV]$0Uجٰzu;Q_k`?/et6qYƿemwo'>"km{n).C˩G.y$MG-[w#mmJܡf\wJ 2؟*8 44a/ԮEQEQEQEQEQEQEQEQEQEQEy?6g]~vn) |IûHW_ßk ?ToȇшZ?h((('((uQEQEQEQEQEQEQJ?Ҋ(ESQKEQEQN OoSE?EbX((߉)~)b(+wߴ'h[5:UxC9<)xA.|?j$׼#Yn|WX5QC=Ǽ|{ZkkRjMw ݭnv_=orjkvN_qe`0=3AE_ O$K> ULHNXO_+`ԼFx}?OwGv*U@FpKd8xaqR%MDִ P>ס_ }3ZTQEQEQEQEQEQEQEQEVv>!5M_4oB4Zѵk;}GJN[-GL浾)mm xݔH9"XFXPWGFYIVV2 ׭R]O&O?׿Ϳ~"|Ԧi"Ѵ{xey.5?]x7Xv]˪j:p|Sm /49"$>`̖R:m%p?v^=W'#?yUVpUN ~N((<|H>x#F:=ηoQ8A-,gxeV06w2LOw'5=m#h h((((>•?km~<%b6FqG`"hfx:xVZ`yQL?фe"INN}6/`T&CǟYZ)QEQEQEWCj~ gm"lzmK!wiH#5=[\AsDE&{>x;ӄo_G:w, h[#noS;w̓.=򂜍ջ+~DEXk^iw yk}]sՆmݝgOo4r+7IQ$$:28 = yV>(((+?/,ev~#~OԺƟ>kڄ璱뗚9\d`>/ZO~"\KetMS\ԾOsE~-WU:(((((((((((((((+ ~ ͝ŭ➽z2|3V5-{ឥmnfm6G{5[G4WձO(((UsME^XE.O)v/h؏*U5 ~%Wja4߇o!mt%l/vob4 PZAR_z#u&0M3X=6U`dnRfzӮ|0$9BcL&Dh((((?WW~|L|{i7:&]4C= U$Q,E8(ZvYwiqE=k,3FRH`x<`i #Q_ſK :Pյ߉NOizm:of}>Gf|3pjŖ ?$]FH>mMK}V,E$`I+vHo˂Z&L-n@8?TW  ?sÐ$SxK{Z|@$%Eo2~욇5hB IujHݠտ39Ykq;~;,~W+sz4=Kb[&v9}m` mq[L[>Bg?E +OJ( {gi-kkHA?ÿ;Hʣw#E?rMu|ȒMCLvU֯"ݚkI,^{aɩO Xm`Q_ xW<iz?զԵ`!eZ =7uepͥAe_j]4J4 &|.F$KDwq0hA:hsfoOPxQ_O? >|;_^o SI𿃼'hM!Fۙ&;.5-[RԵ;~* ?Mp[[($ՙwv%vgvgfcTU ?yS(((nW'3|B~/Ft X) 6:#6%YZMS^-b+MgĺCJo叞Ot 藚֢˷M@,n!s$Q,8r"U6(wbz(?(8?hωߵϊ_o-_gŏ_x\3(aGioDygþt v晬M.i_[oA_k:e)<O)v( QIEQEQEQK:(ڧ_ʊ]?SJ =Gz)bE8:oҬ;d)(((((((((((B3ESJQE4:(AA>QE%QEQEQEQEQEQEQEQEQF3F3E€ҀQM({sΘP?SH#4:QE%%QEQEQEQEQEQEQERQ(Pv?QL(ö~4QE6((((((((*QES ~QL ((( |yE0?SÎ~QL zE%QERQES z(GQERQEQEQEQEQEQEQEƒQER:tQE%QEQEQEQEQEQEQQ?in=(GQ#{QE%%QEQEQEQEQESJETetQE6(((((( ETe(eQEQE!zpb=ǡ?oj(ӟEuQEҠEB=EWLIwQ*| #i)ЅuoZQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_w<C??k?_??O(((() h:QEQEQEQEQE(( y?_ES袊()޿饀?TҢ$QE%=Z( J(EQEQEQEQES=h(?>QE-QEQEQEQEQN OZpR}zEHRzQE:EQEQEQEQEh y_QO((((() (:ǽQKEQEQR=:ip:s}tQO,O_ʊ)iP=(''?:((Z(((((dƏ ~>#xQgbmwD?^)_š8-sV%Zauj(4K9/og9ڸXHqs3b8-,.JHPdzQ_}}f&ޗm?6Uִ?_ cJ%R;Z6r|Cխ8ne>u[ ÿcb~n~69Ėf*>wJ}$V>2(QEմ% PbO4-.!$2F>!VAqErOSxP:J>O QE-6(P (xOSEtz((((( W瑥p{ o3n] 7F#!Wdź͈MGE޹X=>ƆؕH?Ț++آ(((;w-E5U{8L |VWmuKR9(ASR?yIxuڗ-M2|Fׄ!i> x;bwCk _ZE}NN2d rxdoCe_>d}qE) A`8 A_?E%QEQEQEQ_7[ПP˿&P7~ n!RX^K}nRk T4KmklG|:U=7c#(o[ثWHz@/XERc#qE}[TQEQEQEQEWB^mSi~Ξ)NҬk?hW;6' ijZTnTiznM׍ticHK+F4jM"JGSYxmkeCGȢn((((((((( T9S]{G8OC-; 0b|Mo3OG[џG ҃?^ fxG:#71xHp}gMbۭo"mg#_v[Ds\F}c5+@#yz(((*8++P[J 'iGf?V~&]2,~]ڻc |c?hIsтTE~ח*(=4QE.~?(#?v?(t~QE-W#%&?-iUܟO jwEֱ5'7&P Өx'$cI&fo 4)AE+袊(((~`~߳k{"_i˙|3kt/x^'dV A>(/ Keys\GaꋉGXFWi}xeNڣΊ(((+r;bo\}ˍ^9I o ny=4J޳k3hWncB~F\_sOREQEQEQ_'n|1S '5a_b|;6 Ǐ70G?'x6c-FD,ޞ{z0?cЊ+c (((((((()p}h]]QE/QEXO(~1ERQ:(~B(*A|G;أ3xcߴѾ[j cHl"WIѯe[[^Og 09c:hs^k_9TbwtL.A!⫚+ׯ~:(((+<5X`IvQ}{^QBF> eeTW@.##> B: 7au+șz"<* h((,MKrE$l$ԆGFԆV ApAz(|?:oJ?hyëozG?AXEW4R?:a2_kpsx Bx= XC䕀m^%V'/{ Q L7?QZ(!g5׵օQEQEQEQEQEQEQEQEQEQEQEQEQE?~=|$/h?&\dt#0KIeVx% 4,.kᏈ~=έ%d^=*qBwqLK,(ق4swMrkstW]yT((((((((((((((((((((((((((((((((((((((((((~B(ھΊ(ؾQE';QE!#h67>)6QI:? (((((((((((((((((()Tʊ((;?ES|؏4QE!V/(:QEQEQEQEQER)|E3؏Ǐ)XvhmQEQEQERP֊v󢐢opE4?QN==a?O)ЏQM((((((((((BQE4qEŒ=QE7u((((((((()Tӏ4q֢i?4{Ί)H)H(((((((())c(Ul9E((((((((UOl}8)nJ(EQEQE#SJ)폧<9E„t4QLQEQEQL(N?ϧb(#QE6(((((((ES ӟ)QEQEQEQEQEQEQE0=8>a@zq}?QQ#L*G_Ί))QEQEQEQEQEQH@=Gފ(ӟ YF#HHakA v8cy]z~4Ux/?|EOf~񆃪xgZtziir_խhXjqmiK[ew\Lז\Fos LDYc/t (܎VpAЌ_Es5%QE P:~gQN(('M,j(ZmQRESQKEQEQEQEQEP=(~=Ah__?S:\1^Y!^iHiX*{zosE; :/Y(1ǭx]OYR xWJ{| 4MRC~/4ķ2}KS] >gʷ֨8&yb(%ڽ>ރ$=]IEQEQEQEQEQEQEp>'|6M[SVԑso,|r>#46"K‚ǀMU7V<39R Rp?3E~S|^?&mO.ԭ,~h9 ܈H)m|4𷉼)V{~g%7\wYOgpNR Ge U=DY _x\xjYa<#YC]bŸRp[?!}O9U!\5j~k->ݪ#yR(r߳e5N%{o_?k4ˡRh?a}//Ev~/_OBu:N:9F;0E)i$&*MT?>?+OrtwTeXt ~'h1bGt_ J{;xXoÛ,$n_Џ5զP7فGi[/`E|1^G,5M7Au&h(SY+tC~i{mt?C#dwWU`x ]_eoQ_vwγP Ooӣ?yy;0ߌ\fn |~5^fW?jzh0A(((((((z (Z^\A=[Z$7ȱAoo J4ҺGQI$@UfeUR*YP2I$'ES +1xs,7u).4Eaq^ DI ]=Su!٣F]Le;1yBYW#`nz+UOPj7+g._ 4)NՓ(tK;Secmh7[lg$jr8\f^\ʣ$cYF>3{{Q__?IoZ ~Mwl#-_־8]\Θ&h~.3Ӣy;+ KHQ};MUJ  iRMQ#Q'**TTo B-O_~ {CAG#OHb42l,-,Lc@? *Q^Wh$Ȫee`C+C)H#hk~?`=nQIwk/s,LJmn]ZCs )R@bxoژ#Qд{n9۞ᤅ[єA4hyP!h6/ ; ۟ '[Lj>AtQrrg oi mt_h4%K$5C4vU䨹w@X]ߢ>HW ~[~(-'Ou:K_۵]n'{RKmYu8'R94ӻndCqՋVqmhܯк((((+Oۻ cJiǞ>7~էKK 3Ğ[]]z -PJt۫ȢGEF> voGV}Z5HBOo{mp~0x̱!La%7i䑺H<_HBwkY Kb]oS_-kb~ {۰Mn.'񢿨* EQEQEQE|s~Ԟd_ߵAWm*SixaоZI_VhɒԚdVhœkg8V]:I- ' >HaoLQ8=p(|o?/AxPpQkZrT* ou+ۋH"$j?9o.u Z{ˉfsyie؜pͳbrXO'&j%QEQEQEQEQEf(=(,ʊ_,w' NڣytSK?4SORO֊_/$\L[q78nt_{cᎏ=jgs6 .zb\m/|k?ضV,Rdbffo 5WvU=QEQEQExwGmEį٪/ ʩ~|E| :<գa%Ct}@.E1[+˂O>ʵ%?b +* @+.)h(((zERoa?({ t'>~d7~9xAHOxcX-$y\BF9lZZ]_AeeWwR6YDDPI$$ *UI'>5CTK;6_>3!t:<{cEu֡=H[Cÿ ^J_J_n7*po pZ<0h`<+9nYG@{_U(((+_>8Y]x0:Km|OhɌ {Dro{էތ7p,c0^~9_T9j++(((|+񷅾$|7N#\K/oPҵU]Xjze6"*$MJE#XymneI!sGG\G E*#RC)_ Y|24_ ~ϿM`5 Ec;=$~vl [j:>mbqC/ U$Emm37d  ;՜r`>6EQEQEQEQEQEQEQEQEQEQEQ_~Qo w]#j&j3x'mwmqx4Coso&iqneRGMRþޒG__6m_7V2=߉/-t./4 Z{C{g 9 t~ǥ[aD塇 id$4̪Fpܗ-?*ǻ~+~E..Q#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FQ#FRRQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIOaQM(E1؟ǟ)<؏4QE&EQIʊ(((((((((((((((() QE݋?ϾhO,?hiF9)#QEQEQEQEQE7jQE1؟ǟ)l(AA>QE%QEQEQE($t'QM(>S??E88ʊiFJ)ЏQM((((((((((iE=8)3tQE0A)(((((((((iP{HTE4?S ~S aR:EQEQEQEQEQEQEQEQHT(?j(T((((((((=FhaAۏ?Ί(#(mQEQE! GCEž?R?֊)H?AEQEQHTETen}_QEEQEQEQEQEQEQERQES zQQGZ(((((((Tc?>Ҡ_9O (h(((((zǽQQ#?x)QEQEQEQEQEQE!z((GN_ES(() OG^G~QQ#zԀ请?'UGo;ZTЅЕoZQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_y;R_POnOϟ~??Ou7Oo,Nj<}[->Zj`l"J?oRt8ʋ˅"X=sVEtW2͑vā5අO2ox>?V@;.e7m_,Wkj,akP\]nxŢr~+ouٛ*ӯĿ4L0]^?z'‰bB7 *=iWHM dZy}H-Ao?W"Oq=k{\`?sũYڂ\nE¸%Wmakwf:p۷{Ԃ(D_3+'|6 i> Ɖm0,clm@@H@"ƒ?*.?wkVxb+ qt|L~JO|[ =ÿ \?>e"8c +s.ޏ_A ;k+v x)̎#Q_@>단QEQESׁ}}?J({eqE()~=Ί()h(((('QREW| GG]K&xJ-F^rs]jZv[zխWt:W4w;kkxZIdm2pG,$hʊ]c?EW a g3i4Xr_hO6>0vaus W<+dMK6Uп^^\ЎmcP \܅8&`lw4vBeJن! 6:\_-QEQEQEQEQE ~M |U'?mB!h35%'z֙iC@uO%?<'jT 4IްY)ʟcm61PZ(m[WchkZ]]Ə}ujzuDo쥂2rA2HaOY!%GXd'hFHe##p}E/߷ů^~0~_>0| / oݯ {L!Ɖ 2[qj4|NtGM-^,4Y=kWz3!Pe7dy:*d(YN8<G'֊**(((((pB}ET(ݿ%տgzt_=Ѯrw1 ;O>;0h!| ^@'լ%do#|_} 'T\8aZG=G!C utw>W~F_/ קiz^*in|~,]MZ '6 LRi \ SNO|#~ 64PU{:09vzXy7(!=`Q_ԴQEQEQEQEQEQEQEQEW?_e0_~~<_,L'ktIwtiz֛&[}-x9խwpuo G9YP*L ЀGEuu=-QEQEQEQEQE#X~KvW~:|H]:_?jvZ2Kk OW<'7v7vu˝;XEѼfwV4Vi%|!f32;d˂{Ao@y>{@_Usj֩O׭ V-Y ;{|?ckJ垙~uS ^&u&nbKdo9l+NgT'QRגJ\(Ɩis*Cݿ~;θ ?1NQ]OqO)|q&'<7{x;]<3m Q&+]n=6<wPʠbx'qm,O20VYRTE/~%boo^yg%CgL{{Xp[uYiikYNCgwZ^/ T:)fBMҨThfPv]k{K3J~nЏB9+B((((2ٚ-\p:ßkk{o닏 Eҧw5)x{> Qou8wgF&4?Ɵ=ܺ]ɂ3ql\HfWc;QLIX _ 3_'EQN;Ί(A( LGۋYf]+pL:[|Jף?|׋o=+lap%oeKp9vaI+j(((Ho7 gm}5So 4y05r\֘`ZZFU]Qw:}Ofk?Q|D?~2GTWWEQEQE'QNE!`:yc?h`?Ɗv]9E4z~QE%QEQESEk7O~ߌ e5݇ UJ|V@u krrtOR %]D]ۭTq]5WU(((+>;~< n>dO> UR_-j;8M32hǦwbl}N3k/U\ukpOABc_(QK}(pt((+/?) Uirqk7L\\tuOj!~oMt:oz+LeQEQEQEW>|*GW⏈- ~*ˆ'Z1n\Ŧ3P]wRג|n7.ot=1<Tj?cEM|E\QEQEQEQE?f_\oos_Ĥ-/gU'+|q/ğg3DT_y?:qA) }.?J+ R(((n_ǟJWmo>"<=7>IܰMs> f`^8_j$g7Vӯ Y y-|Мz .m~dE?*)h((((((toGկN5M>R"fO+w%{[wtdh³%*l4ԇwHt|={E0,0#ѡV>UwѮ5FvG:fkA_OiIL$o+%?d&uĚÏ])Y2?:5 5r]WR|T4Rښfff85{gRRVsҩ=GWs QEQExźŇ|+k>&:igXn_[it7o7e5,0q"Co!Pz*FP I=Q_g _Ɵ_SYvK}㟏wi/QD,YKh7¯a! _x乳b ]jNW ]DmvsWb$eo>~~WK2L5ow?h?VW^6%]GHmWï ]9dthmSO}E࿇T~eMy:lWUk >x.9qfG\,OHٷ|.Fے}qGI]Y(((}_Jkc&{:u iZm^ܼvv66uwu?GKXt$=R"TQJUx̅s31Tړ&|}/ 4W3_W(>%~<w®O u\FeM/> 0dN&,L 拯".m[YB\@gs㝸#9Wtn#>E}[(((((((+>6~?f]Egf$Wi>3/~5+'uiou[Y!i6Եm3FkVO\k ;{$c4pI S]eP;~ʊEࡿv;mo\u+ևwON'tCQy!c [ՕKROŴB[?Z~dؿN}mc$XafCYsj2 Ǒ0u^Q__ioߏ[[G$ :ڝAflt=mtH"K-!_u=WR֯%5[ۋɏ'gj c3R(ʈyF/#cԓ(#eQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQFQFQI}?&tQFOѱ}?S4QFM4QIz)6SQz(=OQIzO/E_ף?QI)6QQQI?Q4Ema*6R``E%%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQERmS/ESJ/4QE'QE(M;_ESpGQ(((((((((((((((j*(PvES|؏4QE4*(((((zESJQE4A(nTQE%QEQEQE($t'QM(>S??E88ʊiVE8z)REQEQEQEQEQEQEQEQEQHT(>hiF9)QEQEQEQEQEQEQEQEQE!PzBQL1E¤v?֚TE%6((((((()A袊aCŠ(GQ((((((((*QETen)֊(((UOl}8=PO<0=S)QEQES /tQEFT?֊(((((((=FhDZ?ES#{QEQEQEQEQEQEQE4=>A9(GN뢊m2(((((){EB:s(EQEQEQEQEQESJETetQE6((?'U!AJ|>x_>d`AyLkj((((((((_8F"ODӎEQ~qh((((((+P(_ggicgyT_rt((()ʤRy?J(@Ԡh((()@'E(P=ϭQN(((()޿袊 p(()I袥Q3=(E(?Z('zQE(((((aET@EQEQEQEQEQE8!>'QRA@{E--QEQEQEQES=h(?:((7''-,Weqk#:׏>-+.׼9tT𵲹+Ȥ*|ӿ~$qYsz+ao \T2O8hҢ(((_ĝ;5+'O/I<)w|+pT_f2\fɦi&<>L N<`m搜}?ƭRj֣{jy72^J@qs4H@w'a,4M#Wy$c՝س1,I?Z'$󢳩QN O$E(P:~gF\(EQE"K|?6隵G>$ )Yn`KoR( ue%֓WO>5NԣxtX_N$נ7+-"`K`4ھkGE~{+.jQEQEQEQEo^|aF/j|M=NE5{L*}]9N?* ^={@0򌞡;MùEpvVVZeZZ~koeaaeoI ֶG6ƑC$qQ***"DPUT 1WT((((((((((((_ _t_46Qj';xZ-toqyxnho|OU5ŦD%miƞ?8|V9>$é(y9i.lc_;e@-Eu՘|ÎYGѽR{k[.imm"xn-)dhVXUxY]C쬬UVRU  <yYS?tQO oE(((׃llR~5{a# /. {VS7xIgkHLJ#Iei·E203u%}5=uO$MtVͺ~+E~WuSQEQEQEQEQ_4~ߵbً?A-Av~&צ ' n%I"T5lA{C=Jˋ-rZ&^1@B#BAK$@[#ѝ($8_T~ӿ?lh!_%:Ơf4/nifm3"м?m6>[^5׺֩)S#vE+xTR x dE%c#JrXvQ_>VE2(((|# ~σ5C^/g4oWZMZ=j&'ov׶sjk{. ึ;y;dh]dDaʺ:)@4!A_to(7EGk WG.xAD$ӯukI<9m;šq+Oxx^yoNʻ@F|TK]WHFu-QEQEQEU  -KUc/[%{cftT}憉V{>RtxĶwI&[u t٢ 5oUﴰ?(((ڧd>hC!GR3zHKtH:6i% (UW֝:(((]|"1>|O\KB.;wI앰2DK'~ѓ3j'NGOs 1E~U!2(X+ߟeR(O?j)lTSퟯ?j)n?_QNI=I)(((l}hp_֢)v(QEQEy?g*~ Mq_?'֌?狼)@t(6`G}O6O{iȾkx$ {} U)'+@ ֢((( ߂ #FMghouW>4h)i6+ ы? u#(by|Y*Rz}5omrܟ SMz3E=|/\QEQEQEQEQEQE?k߆&? Ycd~8xوO1SJ.<#q#e+ςHF:Pomۑ-8b9LjW/^W(((¿~٨vx~ a-_XLg=pVV!;;[!ӂ{P}F8VuGZt ?#E 3_5QNǷtQE.(_,w'QNؾΊ( 4?E$ቛj] ~"x{J#}iEn zEi^htf{cQ/a֮ؖT=mEQEQEQ_Yo?_Oſ5ؒdĞԧi2K `c0nk"I4M"rךm{4.sF~4o[E|?q{~0H%toXvٵiv=Ճ/ßIo fa~TfE_ m`يH2~x{?kmjQ̰@š#a gYT"kn9E _ >tdk xH,Ok}'K 2 d]-SOlH낰G@8JªUEz]QEQEQEQEQEQ_u|s >x;^;Fx<+b? ճOxm1X ooSGW_i3@5n-xa-Ԇ-H}yZ0!~^n~BVJ)ih((((((#O/|gE-+? ?Oվ~mWfb]_XQR[x81^u$~zܪJ<š|vNmgBI/c=ǖB-NdVQ[|ފ`9!|a[pf|gZORmFwyqMrLqʞ|x}U 4O2[-岟ey.ShW釀?I?nr\(d_jɔ0 'hنFV8NCA; >(Gڤ+}B+wl&vX8WS"qOXzoM?hQտo|hvB>b[Re47Eh>"H\}W0Sǒ:u OþL%gnݦ6; ,o^f{WޢkU(>#2~5ݿ";{ǫ@$\'y ȉH&ng*qj_-.j8ko۱7Ne#w!q$sIhÿ_|dF3a[Ț(o<ψB|uZJ";!<7۹iBx԰liqyD:=[Y){F~4*,7 xVoP 5{r=̑@ՋqOtWZW]ּ/m'QXDk]>1Zo|Y^\&ylO|_Կxp^4|?Ĭ+Ts9qh*ΠeSE P=ϭF\?SQES׏_ET~=袊Z((((( ET=/?EEREQE'(KixcG/~0ū._ko:Qxʍ+Yχh heAb:5mq WCk66GơcGhHUUG@` VKEQEQEQEOP,4 WU42PԵ-B+ >x,-HY]]4y$u8՝*"(,*%3/O5si6~žM\X]^).,JW᎓@'IV x_ÚO$Vo]͠s^lY[&z7#qKvBqc˹2~Aԏ?H;=W^T袊(((=({EQEQEQEQEQEQE(QE< ϷQEEREQECM?@xQ*|'-ZL:G_iWhVj|+.0h[[xƹZ?XVGk?$:FF[۬bw3iZۀ>cxSzuWz(((((ωFW?3$?-x2l?IuFRY)R8L8Ե/O8/ KCќck:/u_h ҿ৿Mrt' ˆwౚBvV?*yÐT~8\ ;iQhXE?֊ž14[ox^os=š-XT.,gºN Fz;{{{Yṅ7ḞOZx #WGSREQEQEQEQEQ_GX_YvjߵÏYlOL/KMI]1X"o[BxA d +wuxQrq^^g3F9"^7WuEQEQEQEQEWa\ 7; ~_|)ifϹ4?|IU]⨑x&k; [~Wfiu+k?Fp=տ_{]((((<_{GеO~5/o[[Jc9Þ ӵoĞ1h!j^ 3COu6vp|%Xmt{$O VvD?E'?QEUudQEQEQEQEQEQ_]\xsTuо%xjK+J[-[ yxڗY\.g xbi?u{ Hǁum Ax$?Y]=:N^"x#zq~`ʊ+բ(((G'Ş׼+Z%]Tc ;'YNm$Rh\AW9G41C,xHdCѣJ:fV h# h> O?/_ 5YkV,[O"|;~Y?֝.SO;P}>\Ww6d`ﶙ|r+u̿b"j6((jٟV_?gvA|SBC+ŨAԎdH#E~ tm&QȗLP0u!ʩPAE{miӨ(((ͧ؇ O,X&?q|Qۢ6l%|F۲^5nb0tmTОpU *m(((mc<:(#?QNESA(((( O@hpC܁EXŸP .LV_fo\B\w⏇;>G1kU."wdfbͅee][Hr}F=3Zz[bw_FqVE}[QEQEQEW|zO|z.gI<{/oSFWU"aj:d ]A$ qr8GVS`A .^/Ox(K7|ESZdwڕΑIiY[4g_\Ok:続[yIavD>AW$#IzpGEs %QEQEQEQEQEFs[~þk+ 6N9?_|\nc qs l7%L?:{iţ.ʂԌ}@ó+ó+]3R~7_UQEQEQER`X@ 0AQE_ioş1(KZ扤\B;KI%H+ zfݣOu DX#Z5VSH=듙vM*vGbұ:(((+K 5Osm/V_Ꭸ?xV-h)<3P̊_~ ERcPD!~9WtuA$ +Kj袊(((/G_{W tx/> &:w; 2\ Z/m.Wwm=g&⑀ee=~`_⏮hڏ5cڽZjhڥmGKݲ < Ԗ'Y!m)a0"$~+.((((FF)v7)v7(aR> (Kx&?|# nbۚ['I]6Ii925+x+²$h:l,}Z;g'ܴD|Slw[(Weu=QEQEQEQEQEQEQEQEQElȚOf?Z?ڲſ4׳<h':a8izGXzv=} _m/.xZ|Iڎ/Z뚽w{zsKsus4#9in.%ii]YdbI#,K31%I&I,I$NI11><աXƗ[@\#TEDv] ?I5iϥiڔ~{zX#r݀I4GsFcʓM# mK+[~h :o>Y<'߈q?<:-. Ȏ'ǥ_~ {ZM2Iu[b zn7 @{2 v_n?xvU׺_׌ o~1ie6#tٺ邶xç\Sla4U'$4W''2iWtI~>/f~$&Ce7Z.uX[D޿ {bn=ugo;_CjJ%P36[WRFӴAn"Al'?k]R\w}R`OH?tRU7(P:~}袖((()@$QE*}(uQEQEQEQEQR*w?E%QEQE9TaQEJ?֢,OZ(Jj( J(EQEQEQEQESׁEo~S_'oOBgogڦ#fj:7tGLռ3xz}um+UK2i{kzxZ> IoGxB3$Sl92 Ȏn@9'<{he6k/g }{ž6s^Iu'3 ݕ}?`}Tm7Gs],7v[}%J+gٮ'e,mE>) ]cݦhC/A sao~ ݽw ? Ԃ1Ա?Ί$W~m'.64O|ME5 .p7iZڿ%%M;i.7]]K,* C<_ ?d7ooه{H |551cliׇ4ۆ#{N&dyci Fӊ6:e}NrO$ *+٥/tٷl~2^XlӼ5C6I1/m 7D>i7:tY(^ /#=[tkYAG ݮN..*{X8f9 +CQEQEQEQEQRETQEQEQEQEQE N>8mM/~EpKGFHѨBGu>dR+gӼxU+}AbY45cPzn :WFcOEe5Z(((_<7"?߃^FuK7c_jZ&0AaI[)Ti?Ql>D޷Aѹ"^>؀Y'7&(pR}?oz( J(EQEQEQEQEQET=/QEEREQEQEQEh_ٳ/}%S?W|&_~sXZ{_i:.f*%}9dY蚟gru;vߗAaN=d#89W5v((((3*O8~|ywö%u"}ῄ幵q-9<[j[/[2F)Ϗ>}:<ϲQMar^r,PGbE{EM|YQEP=(xCߏn*@(Z((((((߉)E((P 3ESz\*+x?D?jg@kcjx?S.f4%,7| %2ZǮj6: ^_Lt/[c}{="E{e, ]!3^{7Ǣt{+?m/5-_v/]c}5_>L^$6|E?şxIMR]* i%!:?', HchɖiI/eC?ǵssqyq=]]]M%̯=M|ekŐK :iܶU彦 Gsk6e%ݤK$mkZp.}JM%̰dYPhWFR 9Fe>ďt?CEeK/:Q;W ig]BkM'E<ť̮/P.23OMTMC[+O| Hta\qk±8Rl IPjT˥p=G!?.Ww^<[{FO|MXk/u;-kA״MV;3Wѵ}:k OL,k[yc ^7V?O470qo,s W|Gহi-~ =P_ҵw/僴\\'+o6R< 6cֻVY y (b_gQGWu^1T(( OAES~QN o*(C??Dk>ڇf|j𯆼exd$M'oL "[x7ŚG!gFȲ'_`>2dQjpArYޓevHvH7(9&.x۶ѾS+F*((((+ PY?n oTA6!Faɏo˖ c|mjozljQE}~՚mģշ@7*냪QESE! u"a/%<\ Q #:GF=~d_rq'+} LϬֱL~l/]%&4€PhJjZ(((+, x)9XY_xoV#i+{BI1[c.Gqڜx φtQsiBܷm]>kjҳ5D(|xUC?*(hpt)h(()=QN{?Z(wɢ) (((!UeOqv-t|M8H.SWυd76Cd[;wl}fN͵./[NpN J lcMh} MNm/hrC&k-WV{=~iC_2q/^G[-xk[8/)ۨGoV;syB/._80*QE`4QE8#E,?(o2 k lwj{֑E3{e8W Y^[T(((L~ݟ).>ecষ˿`ox|hjV1Rf$0z/f×[moLC"!8`ЗR} Mn'$B~L__QEQEQEQEQ_F^~Fm߇}H/%݂ xZ|/P!<;ijUUOvkz= ~e=k]r>K_yg+r?TRc?iXO(l_ؿ_1EW~TW~TQKKEQEQEQE?n1=~/,mѻw?6\96i 8*}9hWPoo'TT?t'u^?mҪQEQEQEQEQEQEQEg2`MR7xk^%6?n3'.]7Z $6|AǢV ]NYEUGO V"ΧmDOM#&Px#7ʣ[8QxW2i? ecU ƝkvϏU^0DS^$ϩ7:~wHO?1F~hZSG$Ϋw"[;m#qړ'G6)X"Z3A+ffffbij3YbrI$I9'^)׭gQIEQEQEQEQEQEQEQEQEQEQEQERE`E[QEloOQFGEڊ(aQEl> (QE_ע(OQG袊<EQz(,w'QKz(6SQFO(=OQE?Š(`?QEl (ERycEQz(/Ey~^(?QE_ע)6QQF?_(}GQE|QEEQ?Q4QE!VTQE>4QE>4QE%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQF3F3EҪ{ ?M?Ͼi|E'Ry~Rl> M~E[RmoOE##ARRQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE4*(H?QMb?EҬ;J((((((((((((=@)bGESJ4QE4:QEQEQEQEA(iAؑEŒ=QE7u(((iE=8?‡}ҤuSC)(((((((((iE=8)nOE1ERQEQEQEQEQEQEQEQEҊ{cqM(>QL({sΘP?S0GQf1EQEQEQEQEQEQEQEҠEQL({sΊ(`QEQEQEQEk׼Ui~𾉫ZykZw O:BVXm y!#RC I<ҰHIdv8T4 x xHOO~k+H_m7g.⥥Ʒr`ͥ63&Ӿ#xޡH.#e-s˸/ ؾ k2,zll:P*V 5"' b~͑iiڼˏ?7WSEd\F;;XJ]Dr]Mݮ Uu~, [d[?jvPGWoW#On >fOxgEکB.Dokڊ€=f` $PF8QUQ]X((((((|GB|/EOu)sþ#u YӮWeΟZ~epA*FÊhaH.!x%R4i,Rp$nHqG^WGMX|n|G q]ןdwY'o1>!bCf?Tӿk-bǿQ'Լ#5 Fҙ)nNN3."vlWG]Oqí~|M #~1_ &xWCo$_yLlĉ,rF5!$$WK3ڮӧxc^F%Jh9Z$B{r7DcE~|+gಟ>q/kI۷Wc?<'>h6 yJVQi>&_c-m-5 GNB2.=dGM u[MUįŢ67ͦ_ZC\?'oo)iO%mVPG+a2O}?W7¿2f>?m/?+F $x[BT;Gͅ'f- =ڞ'կ?,-,}:^ Zvc߲6Û|CGUj>5s.t:.ZFt?n7vϑ|jwxɡjvwkηՔom(ʻlHdg3ıۜ'<E6~=j(P=ϭQN+m]??M{?lms~i<|%Nec#oMxÚr,+Ov oFT4Kٶi>&h{b;}UI]:NRhc<Hm6mmE]}W袊((((o*_-(Ab> ωxT'~1I&<-֤$׉e_M" k 񟅵M @W~%tZCnr~8"OpOIXzkZ(((+/s+8VR+>:±S _񤟼 "t~ҺxoI e_ѵn2=vgG YF[ 즊2B_4U *P{ڊ(QEQEQEQEQEQEǷQRAEREQEQEQEQEsOk-/LRԮ4Xkɒy#GTPIo+q<ʈ2Bܱ ܐdu< +aLdٻj!AkSZl5?h9ׁ_^׮05)Y>R+,~拢Ffֶ% pL-,ĎɭP?@'<_S:(((__<9=/߇,<%k76v.u]DZ ?IRe,WxѳmNF5 ZZiw;xVT>ݑWFI*=~+bj/'kCa)^d޹mekũ\3<߽M z:gD~&kkvK/-.mOlY? èitȸ8.%S/mY{ҀC}Ye+tyф#-c.zSǰEohO>7zuۿź5 SR*UcӬ-N}: ]'D-,&M=KR/=J[Zk/#¢"Ɓc5XUEUY,NI?秠ʨh(('(?4QEM@o.7a:HZ<%j)֮<[$2u7/ [?= z^"_ >)O[t-jwWrIh$XP ;F"#s' I;u+-./m.mlomỳ;[Kk{kYx]%h7WFe`OꮌXVRYXd2AA [4UZ((((/? '?8|gmmĺ+]IoQqr|!Yh&jGSi_#žSL EW2<{Em!TSqy>PQyв/̞C#J+zcJ 9~xBz x@=O(NO?S$ƯπgOh>o*!8k{:.ݨeѶ-s<-o~?g&e-j؜#֊L*V((((Xk q7Im?CDq &OoP+fcC[ZX+_W8Rz ʭEN3_?jmGIIqkYb6ވUoE}%[4(((+?T=;8|-JIo3cu6m+vZsϏ?ew@|cr[Hd`};XeMG 8'f'E8:E4RMӣ r$<_h~[duAx/Qp6 r b==blZ2GH_xܶu COlj1MiϺG?F+jQEQEQEVi٦8-׾#|4风>&xR{_|3y0-S~̬4M]|g_Z@S-唟e݀6LPüٻ֡/:# Wj:u_:֛iwZv_[i}ae;^Y^ZΩ5խRAqo2$"wEd6dtpUԕee8* \ENIE()| (w?ES)h(((((| s| \/x>񏇯kխ5&meleo/' [;klֳs vX$YcoUb: >Q_-g7| Wn$ů> ,u3Vv:˃AK_C:'9)<|g޺`:2B2?5rEQEQEQE~Gg?'Gվ?zOǟW><[Y}UV]2]bEo#M-|3⛋{ᘬn8 =LzE*܅J%mHNC kqq^̄>ه=E~6O4}k^>.xcn{H{MCLlxw)hI$2G#yiuauqe{v)Ia6*y#5̲1V2=AEmQ~<:IE:((J(w AhJxRÿ~(x]]o[]j3.7"C d~?ǘmp?AτQ'Q+OGr0+߳SrZOh;ռ;O݇ or5۞N:q'VOF8Jɢ((?. *(帵Y-mx KܒG"YA)X22<A"pr:E_#Aw|;o$;|Mŷ=MY6H].j:f)_XY:sol?#oUaѕX~ Ez_QEQEQEQ_7|1{nïGok_ |NEMIzw}B!uZ3K'q |O>% Yת:-RɈzK7'Չ5j+֊kQEQEQEQEQEQEQEPiy៏|1goxO_| j[i6zީ (^6~ xz^uzc T~$jQU:[|,DF ;EOdߴśƯ7*c:_n#nsڽA"8ǓY˜Ǘ3g=DI"F'6- ZVVu}?QR:;#ӎheU,R9iRQEfZ֏ECvkcռ˩bL8ǒ8dtA?6"+e`~o?XC|cᯆR/Z5ŷ~̾kw]xWZ8d'kZ>#_L=DžG[+Xc6փ Z%dyZDm{nWA-` 2d Gkzω5mG_w>kZ֩j.dug,ҹ-#keIyfF/$I#9,1&wIw gF\C/w)K'(𬀠~x}R=H϶jun[88CQYP7J'|s]>:o7[=i,Ş&Agi^&mU&Mggڥߗumo%WQn I D `;0I#+:~3߭GPkQEQEQEQEQEQEQEQEQEQEQE4*(cESJ0QE((((iE=8)?CE¤u(((BpvZ)?CO;?Z)XvӟAhKEQEQEQEQEQEQEQEQE4QE‡?袊iu)(((((((0Q0Q(in?Z(a?NiXvӚ(h((?PO"Se/>;ƣ><ѭ 1ğ7-DyČ6=nO+u۷m,Ʒb:r32['܍=?6ؿiGp^ş£"+ͥxujχ |cK"C򒒸ۻѬg\(k#&;eسcК4V}$GEv^?Fox'^2+x)sijVZmKUBIt!S-ڝZWogm%԰V3ʖngr1YK& 6d26ݨ#,N|8 ӎW^YQzEƒQL*GoEWkrio(?%⟈go[`j:!ωDrI]%5Ոwo4 Ũh}M_|_ 2 $^Gw2N4^M{~0}Y?᭏ƚ"Lt \}9kIL4/G|W:7xş~ sV| -c^0i%hz΍\FrUWv6WWImwi46Ia1y HdV9I`b(H=8U^:((((((( ETe(eQEQEQEQEQEQH@=E!QQ==L({szʊ)QEQEQEQEQESJETeHQM(+&{ g)u4xN֕$?b +k·((((((((+j$hdO8QEn_[oMw&(j((((((( rJ?Gk/ߏj|f{x/*yVEQEQEQEҊ(BדQE(((((Ί(h()ʤ,װ:DXaE)Bh(^( $a=BY/> x[N~83si^2D6i$,ZC QE:((((( OOϵQRE(I , =.~Sˑ|<Θ֡ARA?P|)dxcY]ai `B1iCOmU_EZ(((+寋z7?w -úvV?x>-ƧRI}mUGO"'_ms\ {g5vۧoBE~ דUj((((() (EREQEQEQEQEOJP E O_O~t𞿗袿O੿+1غ -|=jcxl^Y]\:++3җXY FUUUux=Ch\6Ҋ`((((+bj O/|е[oJux#5 mLA]]1 Ɲ_[\1o"|oDf6n0zQऎppj^>ضr9?(X /=eQOQE-QEQEQEQEQEQO{QRA)h() ! u?z(F\Z(S(((߿6@?? 鋩xb5/7k9W,/z|M5m]BG,z_.}3>S5$v){,ܖr==#p(((($I 2I:{EW-sࠚ#=[PP7&W;mS6h`oSRxh#>Ήxi⟋-R^*͵to ?DĈWsyʟ*'y`v+*QE뢊)QEQEQEQE/g{Ծ,QԮ gM($W?˽?kc".k -G>K}Bbe4r4$ͧJN-ڶlf2!Z>SOB(2QEQEQEQEW)rc?b)g@FǺ[dtBi˗?el35/|key tj [;{qj~XI5w;>Vܐ>WeyV((QPWa/}쩨|y/V-~d|fbbw.Bke} \nUȜI_N ujn">E~WAEQEQEQEQEOGLJ~ӡY%u% 0|g~-{<:Ahc=N ¹+v EQEQEQEQEQEQE@O@_i7:Y b_<%KrK(zCG7}%۬d8= f߳m_Ɉ(j EQEQEQE y -?i^ٍb%oyoQd M.?7%^X[}\{{WK#_|XQKzhpCߏtQ_HC]d_PSl˅5zJX,ڎ—B6t+kI~^$픜2Corg;v#ܰMkRa:q~*+֯f((((6O9 ~ʿi@??k}];g]O~h ?丒65i6a iok 8V+!E-ub DEHt3ۘ|qI?}Ҋd^%YS((((((((((N6Cax~˾0?Mj+w_?"麔?jmKO>0,Z]>ᯋ~k|Icg-{+_r ϮhxjO0#qkF-F8å pdP6G: ,H!4pg>8Qh7 <:~:[M*Xx|Ԭ'zQ},MĻe]&G-XE"G_Y58T:Dz`]2{g%g^wg(4%V]> fp?G\~RcB̖# s_^$uy-Զ*/"_̌Q__Q[}d|Esn3'~8xICM3o4b74Oolv;clnxǧܿUWaq_ևS b-{4jUf4S:nqm?ܷZj wU<Z΃ p࿃:%QԤբ*Iq ai(mfZO2X;'LE 5oa$;2A$aT;O_{_((((((;K&O?l|Kk뽛^WTcOπq!M_l|f3c;mAskz⳵4nrE'0*RWyc?k,w'`QK}?.tQN)QEQEW ~'L>%kK|#c.[s o>"Moo 'ryv~ ͻC"-П>^91b>:y>[alٶXO\ _1+ʳEQEQEQE_xW'9ʶ:/r]FUOct rD![+~ж[5;N-)h>.x_YEdEQEQEQEQEQEQEQEQF 3ERn*(&Ɔ(ccK2@Qd *xwir}Ohسf=Yf?Ry?OROךLO/QE.O)v/Ɗ(ھ(QE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI?*(*((`?QE_ע)6QQI?Q4QE&*(((((((((((((((((((=@?&(b~b~)XS|_Bސ?nTݬ;(((((+p_O(<>%|,m}6?~ʦ`~B*jZ(+/ G[>gNeM¢񿅾'^D&+4o!G} OEԼEMwR$AmywDVV& MomqwQE0:(:QEQEQEQEhz׈}#>jmKѴSQ|fl65$QK3IoH;}c P O_|d<?awXmuG+ੋ>./8bU3v? #cl\8>~;ԫo;tT?CO)_8x+Mg^~+KoxAVqo7k^$?'7,v.񦇣]뺶;k[F& .#tC#U\)<:}hE!QE}5"?f^xzY^Ex x߅t/5yn,"S׵-/Jup:-\K1'dЩKV# f+k$D0D=`=I?C+m_i>B?hbo- ՀI-Qn?R#g[(um|Rhcx'dž17Z1k sy{i1V2nlmYg,Hϸ6`,GeN@21EDEG 0ƑC HQH44@@UP@ p*%-S$9xD)Q9^9#u**)  F<PGphg'obxeM9!w煞7oFҊry̭jƭA;r>u,9/sR.쿑"̦QEQEQ_ciyn}tI|H4&,CYZ//>o9983hF/vŷ[ewрEQEQEQEQEQEQEQEQEQEQEQEQEQEvsN)/½- V(-4eH_Kb (,@Uy[LVN}q<(О Hƶz~ml/ w8]f/#{I@eS?*+k>(iP}EB=ESh(((((B?QEFP?QL(((((){Q9FP?)((((((ϽQQ#zQ_l3#O=OW?v![tOQ__EQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQE)?SI?+ϋ3_w/fvJmQEQER}zE(t)h(((P ET@>QE:(zQE @:JQE>( 袊(({*:?hÍ{]lC  iFIL~Ү C.wVG>? |)1m{ m͂)ռd= jBsq|(ٚʒ(((7~[}U[|Gq⯅4\R&/u]`u3'Pfksh._;:F]J_?ҊW((((+)gG?(gYZ7lOxjMKΈo. u)Fu m|BF;Gš -NPܧ/m j/e;PwTUf {w,5:={_[Ꮞh3F OZBgx↭ev#eM׆ՅgM Aۨj:V1MHYOeyV74pV4n(4W_EօQEQEQE/?d&?wE$xQe?BZ3xWЦuvnuKO7xA7#w o~DD)=_O^QO(((((+_&퇮~߶oKh񵕧].>'Vĝ!)wsq=KSRxVz6ńzx_ xH#fn/Qs>ŷ1whY)܂C{NGWƗ#J=BV56X[ R;XtB2iyi<76F%Du%XH9u)Q$D!u 8*C)AJ+JEQEQEQET_l:Ï3Ҭ1}Ox}QoIu:hl]K_#F"w┅,+'_V@ i[Oܰ-mwi ݀znFsu T:+5+&((_?3OǏ;m"|Ci ,hӣČ6F3VLﲻLuo2L Seo?Z^civGyjzwWV7Z\Fxsqʰ5f"H2Hã+G]5~EQEQEQEZs_ ?#9vGO :呹Jo&&ݫyvg[[;\o!?f Q_UN((((P 3ES~]G|?(:@~&w%pgoJ[>&9𕥝'[Whq _w5Ѓ؃>WVO??uu׉~P3LӦ_<=/xGY˧JijK/VF֗LnE )!p.-! +w6la$qчa~##\UV((((((wǏ_ uŸ;'=KWHG|wq]"Y_y7ڎ`m5/BHӹѵ[=>U;1t`XCl;PTz쌨b1:9^,#?fS(Q)Q_Of=~ޚ]teL!sQ_X|m(#O6]f ,A[>i*HM![.]F|DqxGjf1 F뒿,=WKٕEQEQEQEQEQEQEQEQEQEQEQE8?R+*%yh㿂5ښEdu?" ŏXƭemf*2^76m&*EYJs7#%y5F{0BU<;)jQEQEQE8?am-o^n]OE]Oe8y bGӿ< [PtoPw2i︛Pjo,>hGk(((( > GwkB۞7 +\k'4H5c> Զ[Oo! E<6j}I<{WA6mrF4W^ZQEW//Zck^95'úbluwgjl6Psoje6O,pʿ! '4W_L??h_߳.E>&Ι 77vi,|?">䷼EPc7djmM4WQ?`o(/_^$O f:uEf[w^l4첕{rlV_/B 6,iX +#()p}h](aQE_ER_s}ERQ:(t~QE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI?!ERm_OERl)<ERl>)6)0GPGERQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEݪ{OMڧTQI?bQE4A?4A?SJ*ñʊ))Q_ٷ8i?m2dV>x. B~_7(0JCv٨xN'>,\H@ta қ=UIBW_TVQEQEQE_X3ϟKO Ox'\D].U Y KHt2/"B.S]wZ+YHxGX9HF*2:0*2 E~lA 8 AAFe%QEQEQERP(iA"(=?Q[>lj|ci>x_Kм7*]׵Jvvp]j̄$v\L,q T5̱o 87Y]#;OAJbI $94WXj F˿^ -=;߆i^2K\ۡ^/z]Sض,ڴyǕ $=+J 6GL|h'gO 4||5-yW?ZC8׼}&73 ohgEi4gm}3oPZ._3 XunRxmb4cu`{Q__sX_Hvi=DU,{w5`m><1;'h`x?lӯ4HY9x(cPj+AOƊ/(((((())n?_E„{4QE7u((()n?ϽQM({sΊ(GQ(((=Fh GCE0:)OQ^aB=)E6Z(((((((()+nGG6~+о8\_ĭoH+F|E z=f tO6Z'XU,KLs'9KAuԴ+c^8kx8X/Fa،l4r*2@$|{Q_ ?Jτfo~_ܶa~uzLo-\(@di8Ҭ~No Wݨ vAՕzD?fO_? 4W'j_|+xSNڜ"BڃVYY'gimi($HҥzZKE|CG k/fϋ~y-DŽ:=ϊt-PΘފΪƟXhqCn~條w*cG+s+c?>"??j.:.5['4'O{$1yw1,7Ckiuw46*Zԯ-t^xeg  f!Te*`2@_1`|._7]Iƿi^!+Amxm4 kzK%WQk"֥x$VPsjW+ڽut6 8,FBeM);,,yvxnORhz(((+ཟ R]m%mo fU.xWL3x)sncs#f? 5wˁ6G.5vn%72h:EQEQEuf?;{w;XIv%lx>7X~u }iٿR>(~ v>j\Z6;cɴputU*}A +|N((O_i_6p{__fͷd[=㫿 !c//Ozk v#NǨ m^頉q' pG-G{_3kO?쏥Z#Lg?ijww(Ĭ2\.kAȊoŝUF*Z h x9UwN;dqqEW~0ǟWݠOOyPYE[ú Oxfɉ yXn}&gil2^~w'5ῌ(U E|_)gS/sOۿ]ذKvQ9"N:},m'񷌮X+j!BgOS(/a]igqB|S4yYH*noz1OvB6oxуAv,dMCJ.'^#$+KB?}+MaOs9`S.ⅶ+z5-Y>u*[35{$i_قPcUݤi`3qkpw/A ߁QI'S|0  0~#/&qxΩ{IPz^OuB\Y_[Om:BN3_[5b dhr$F8 sۊr #QX\=E6(iPz}袊aB:s}?4QE2(((((( ()QEQEQEQEQEQE!zB?QQ#?xӟQN((+04&|8/~:wn7m.e9As[vpŝ7ji56_MUVW(}N\cg$ c#hQEQEQEWşR˜o㖍C#7>c.#0RSQ_G74okڿ74o ϟxIӜ|.yk]:]7XԮkO$pMlǍ0wSy΅i̳F~|[Idnb \((((ht/|9],t~iǔ>qEu_Zn\???5oYE\"RظHux"%$lH-=̮wJ*x!C}GCEU}T(((ET)h)@'E @:OF_%:?y$ZNf#ᗋ'ھ_<(؍f&@M;CFwGdoux߲on38mFԞq? ~Q__uEQEQEQE|{_?//YCn$|OX\?ٖVH{@s-! ŦXp..~H}'(F((((+9ijYOCKFxV$`-H n|Ys) V8$s/ĝj3[[i/m*msY/^EU((zQE O_O~tQE<:QEQEQE Cߏn?(AQ'zǵRh('^()QEQEQE_G Y{ټ{Sq e΃aqNs_~|?8Cw{!h@ Q[k?pXE~צU(((+4''G;i+UQXx{Z:hLj|IkNve0xOJS}G#Cggt̤zy@TCPlBOtUcQEQEQEQEQEQEQN Ƕ>S폯QO^< yTQ_~wz5Լ]>=kpd/$o[[C+2o4߽Yd, l~GqtkNH6V?Y%<feFϽy^Vh(((87_?ߵΛ;𷇾4hsǰO4/xoW ǕgAhxK;xu(2P\q3NOjv! O=sQESQO^Q_m Hw"~ q}7TwdĚVb\mc7^;mMO\QOMֺH[t17jOhE}]EIEQEQEQE .oFo<4RU]Ěܦ7D"H~Cl|hz3ړٞiV }`$E+΢(z E覗Q?O)vasۏTSOS(ȿΟ/e1 -¯xО pG+(;SG~w^M7? $(>.z қ2zH٨ﺾ(((+S Km4_!wI)klh݉Hͫ<x dŧz [f9jz&hZk)=?x_֢)Tv+:^/CFKnjZO܏/ ֛sKۉd}cڝ^oϋ+ Ļ?/-SqI6I,dwlyq, aԁ[wZ+]QEQEQEQEW~~ ~Կ |IWqᯊ_ Wǫ_fx%YMC>= Nt{.tBp$[HuZ+ r23H$S&Ih%du<]E(OPA#ڊ?jƿ ^[Ct Z,7w|a6X["x8~c/`w]JV][ֵ 8 h018?Z+[8~I/>?|oq,1 Kza$4Tͅd<}CJ\K:h}[MӦ[ẍ",9V#xDd?3'Wm2]{ǏEWQxퟆ< OĺmtSĚnUg-q s(X U{CoJ *1©c蠓 +Mr৿Ιk?xIq/2jZWm>[j&佤Zt].v 52h|o2?ޭOtW?o$7Ai6%jSO Z;DQ-J04pi#b!!xL8ԃO,35\|?1Esu~#/O=7No?f_ tQƸOT$Qm% J㮔/|oRʎV   &wտvŠ5Z((+oz;)C~/xvxmi$ njS$r^ ğ=+Q?@-W*_-ugw]>ohJLJ|{ x;aNx^zE׉kH A}Q_ ľ(.k('_xW5Noo+>ffnX/49igiW=wfcϽ@Y$RItVJ]϶(];ǟESA((((((((((((((((((((((((ERE[QI?1EER> )7Š6Qo___עx?Gx?Kz)~BMA (޿ (A (޿ )h}OEQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EQ3EnoSI?!E.QFoo_`zQFQF?*(޿ )6/Ɗ]~E?EϠƊ6/Ɗ7A?Š_3QFO3QHcy (qŠ<E.O/E&?_z(c{QFtRloOQo 4R`KE%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIz (j:(`)<O)?(kzʊ(((((((((((((((=Fh=Fh5`3to7'%m.Ed%>$j(>BZxu":zu{u5Mm },?hׯ롢((((ƿc [٭>~-Fb>|E q`mE[ p@"  ijpF:^L!`=-=Ru?LQ_'EEQEQEQEQEjz}gLmW> ﭴB[Y+VM?L,!+kKX%yYc6vR"C rM4Q#I$ ;1 *$($$@Z+u~?4O~ֺ z<1A|}Ƀ-4z_ñqK^4.Yj6gʻ6t'\ lv{TyѶ u,itd?Er?En_({1X~4}'X{<|`:25uloJ>𝷆&fQ4:2e>?#MN;e.1qyN7"7S |"!ݏ,~yA+(_ ?q8mW>/:%ľv $p$:2$|1Y xY<]%ٯ-^Ŵ[S_;Bųu̐:]eW=M⯉Q_\xR91/) ԾԴ-B)<!X%8K@=p;>a4Wk۵E|f ;/L7ڭ5ōS?uhVaxFAxW2p:N UѴQ't? kC,}TZ['s#0y6~ß?h^'þ9F=Nn&3!ּ%kHE`G<-\jv[m^Yg0Z%I& u%6!(R0b/0|Ɖ BXx8a' t_ ۠M.hŪJEҠE<9yS ӟ@Z(REQH@=Gފ(ӟx_'^x_ <_?x÷DO5k]6zlLK Nߚ77Zeޝ{ Aycs=/cцFAA*H=A("RQN O*@{_)QEQE O_~tT$)(C H|Ad~&~κO`tvzz>ipl&0C>4;ĚW+cEf8Y5S=:U엫+vP?E &(((u Jſi2~ r<϶3&9żI#~9_5xmRӴpOy=wZΤtګ6/F@h򩯁kP ~QEH/(EQEQEQEQEQEQROE--QEQEQEQEW_,gPw8WŸZڿ.=$9}C4Fɪg аg(((((f~زJGC=_[1 ~ Z3P6?:_mBex'V?|=d#wԿL>'Y]?Q=Kk 1aZk|z`>AŠ+Ӣ(((+}ſٛU4+qρ.Rsx0}6u+vɷ[% H~jQEQEQEt f2orGTɆ?>Oʤ|R2q0$gO.<;c?dnlz O?BtVv6r?B~UcQ?NS(ퟯQM$4QE%QES?ʊ(O?j(7 qko_ ~30vmIxe j `Soo/ >]FRc-ZT@v*:9(:__oWCEQEQEQEyeG-_>O|!σu Jo|MQ|IZjZV,=xske=YOWo-qo,O ,SD%T`$Ցрe`AWIVH A؃G%QEQEW/ &pԵ_wż _7V]A᛻]?>l@ Ie;MY7f-qa3/d4 qHXnص̯S{z+l~BWů;i~0 /wtYΗxs_Ru;)pbO.Tx\7ES=n&@8 j bxWi61ݞ8Q$z۞GJ_&oHdsmS/}}VHNOʕ%le4|t~/JAl/1@ Q_dxY>|>Gý'H/4 id! >Д 2kʲ|t"D^;qRUU =~B-QE'w45Y| _ [~i7gX-#YO5û@;/k|UP/_9r6:`bźxB/<_ ^5(֗WQAU9 h#Q$8ʲ8e`U`@Օe!A +4QEQEQEQEQEQEQEWw 32~⿋z^&R+Fx  hnGkx5YG Ŧk~񟎴_XBQ5Kwn2y%v cYf ׸r,Gʃ7Rzv/ۣB/^ҍͿ~6 *y6:MY}S\'ֵN$G5_jڴۤoǸ[Y[&;kh;c\IY K+4y٦yܻz:(IE|s\CE/IgS5~^-7eؾx\<3G"|1[Gľn܁\KIlpѵ ,rWmRRFQ(xO~ ~<p )7Š_/zG;4Q/`?QI{~j)v/ƊM~E.tRoo9A (޿ʊZ)2}Oh ''ERQEQEQEQEQEQEQEQEQEQEQEQEQEQE.QFQFQFQF?QK?Q4QEEQ?Q4QEEQ?Q4QEEQ?Q4QEEQ?Q4QEEQ?Q4QEERm>(?(?(?(?)(((((((((((((()r}OEQΊLA )w?ŠM{OE.?Q}?SEϠ`?QK{~j)<E.O{4R_q(Q}[QK?1E&RQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEҪ{Bފ(c?Ɗ(o8)0}ERQEQEQEQEQEQEQEQEQE# i x>k%šmk|F׭k6F-ѼW}-&B!O_ b䝫enx V>;'hna?Wc^z((((,O8yixZW%a;J6y-x ;Zw9cl F1>JIsP]Rz0VPhͬ;_^aomQEQEQEW*?WV/[hYƞ ѢyWOZ-[g;ދ> =͓F>tF:bn%R+[h(((wEӼIkI״CE-[ntRkv#l# x4cIGdu*TAE?? !ްj<B5 kd<}\NGjӽ{+˻9?Z\jW!Eç$J+*QUSJď֊(oc(n1EQEQEQEQEQEQEQEQEQESJZ(c?aR;ERQEQEQESJ폧j(k l g-~$~͇Ŗ._'ignto>"C [A 7~7G[7Ic{nw>]Z4IJ/+ ܢ(((7?ట p/?nqM>':,O0w\˪x>-G  GG*qżEZK`-/* 38Q~ „{?¿< CE6Z(((+8.[¾?YwFw%<k8܁J `s7xJf,5ОkkiG?a Ne_FVAW_JVQEQEQEP?__7 υ4].~#xŸ|9mgnO_|cW|c xqq7uLڊ^{iB.cL{/ 2~wo{ $M̲Svnda` sEXbطr4{Xo>|3<_qf#5__oǭxY畣:U\ ? xkF(k(@fKw$98V$ IƉz+J((((+y+o~ᆻv>oŗRٟ/9UI;BmO:0[RUv2y7'>ՙ/7e'_½|YTSJ폧Ҫ{cS ӟL(GNWޟKO_OYnæ{a쿗xĖ~ 񤥲 ?k$IcvTf#? ߖؐ6)3tos2ix=z*kvǯeQEQEQEQEQEQM*ZiP}EFTq?R=ǯ{E6EQECR;?{xҊ)iR'ڊ(B}Ҋ(QEQEQEQEQE"sQ_OLx kǹ9aw>A |_2vͽ HKRIP1j[Uu+ m q[MY8U#QEQEQEQEWyWmhύ|SړLJ~1Mp&+) \yG֜4ψ-.6uqRu& 8y'0 ^wQQEQEQEQEQ_Gϟx-/_> [O+o'l4:'mVծ~Dw $]mVn]%ƘqR2AIuy7N.z+cq袊((((?go/B>^O?hql-h|3🉮J@<e)H{_>hߍh}UXYjS/y<wr^qW1C}{/z+^^hS袊() ?_*(DXaE)@'ET?QEg5q?̛d>=5{YѱX_ZL sozN~4'ZW h z-:95 ;V6o>?? +QEQEQEXΗ#)O-IY#ƿ x;I@r;|bcgo6a||Kj>^$7}7?2iH[ Ql"/|W_ m%QEQEQEQEQEQNO^>/UѤ|nt8se(#`c;Gx# :3z=26ǔG0e(kh(((g1׀`,d^.|54IT^kTE2˶U< |IBZW8ba'7i(E~Fu!}Q_|Y4QES?S?QE< O;QE>EQEQEQEQEX~*J|hJş0@UſV2^837??pg4PY #J?ӏzO&G (((( A x =hOw>3J- Ş"E^Y"a_qn&d*Xaz1zmQEQEgg4%meπ*c_S` /t4/5[{ݽ-v=Zsf9kѢ(((9,O$Wn;"QovB>jwpv@N]KuI@}֛|#ZHGnbj OJ7К+((ߟTQE8G/QEtQE-QEW_J_.>cjvoxLw' ú̄AFeV$u.mToqpӟgϯJնB颃c+2((((+l? K¨gO_gyjˈdWz q/hA_-Oڶ֧cVo$4E{nd򯤎q+:(((+t?6_4؃XqK'4<yחMUmRK˛dGn5мC]_GσA<1lѮ'NM.fC+7 cs#.HKkiXH,/dC+a B{II%D7Y#U::8 +) H5 yt#ַ(QEQEQEQEQEQEQEQEQEQEQEQE9P͟Oi:?i_~=JҼ1m@x&ķǁf`׃u- c]Ȃ`]:abX]jש?Zfl6r *tRrW'&PN4>3E,w';_E;~|҅Q+ 9?^$_ CejooU_x^4wk:3Q6Z'jkF|J7:44$+3}ao98;lvCU=~_L?c(_'gIŰ=T_ş>;A'o=Oψ/mG~1wkQI%܎`#tUNҬ![[+x-P/[o.|4<**"#v,ǒOS{h(|]?ژZԮ.kl]_>U^FFo\~'[/y87 mRlmvdE`mc:PQE;_ERQ:(: QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE`(oHlIGsŠMϾ(rI(`?QF?B{$$4QE%QEQEQEQEQEQEQEREXΊ(cz~h]~EQ(?QEXE?Š(b(b~h6)p=(0=(0@EREQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE((=ERl_OQFOE(6SQIz(/EŠ(c{QEERma?EQ#ERQEQEQEQEQEQEQEQERI?*)w7j:)w|KXQK?=_E.~)67QKOqXv?QKzIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER`Š((>QE7 (c{(cQIEQEQEQEWE~ ogI>}"\=Sl$ܿ0uiey榷n Ky3:ȇeJ"kOxL/-O;FotOd7L״mVLw^r8[y."9VA>+[CWoV"3) 2D3MψM6,`2u5d,+%LYG,fvBD ͝qp.T $qE~'UiE>JiE>J(?ji֢iF9a?O(dj٫"|*,Ӗرx3Es擀ak}:T_(𳤀0:״]D`մO[kflCA9⤅Kt"Ɂ4W> uQEQEQEQEWe>¡~>dmyi m,X$)Yx"ncX@?>#g6WQmskaoQ_Uj((()(ES _EW|/E_w-c8o/xǞ*1T[M6Pe,V]NUqP$\ͷ 3NTw;QYAcǩO_&AݤKω~&eӾ"ZّJو v? ~ _ỸTkm,6VKˈe6oj7Hb!E~0I>-_$ \lkO,cӼ)\ !YIu,~x y{X!773Aha89ȝtx,Oh??g'msaѾ<7勵UpdΦ:Wae:.RDcM=b`\zR}DJwH5~.  |%K-$cPy0u#!~iM[R#+i0HO5:;]GQt|.w~3xK7g^4G'k+^okak>( IemJ+c &f)kx>F+%sZ[yWRO2;nW CN ] a8r{Q_;_;EQEQE!Pz(Pv8)XvӟQM+ -_ͷgᑵ|Jbvx/dn #71]m~O⤏ +R袊(((W^<Z]7+T8}3ĚE~}ַ .-e;&u&~;izA(5??>֡>sVo5=M ߺ9x̹{y淔bH%~ W"F $~GVC?ʊiAۏ?ΊpQUl9OmW|[ QW[,>6~=l(W<6 I-<5x5L#@@?|isd̈́[s{i+F'_2d? 4WHٵEQEQEQE!Tغq<Hdx56amx~_r ɢ׎45/^ǘ/-y+geߞxSWU yn݈Ksʊ+jQEQE=ll?]o?lSSIc1r~$I&M;^n|-L Eb+Ot}+T4o_͈G62fi#"0`W='>WyuT(([[;n.`v{kyh'T!Q$ԆWP(%YYIVF YH 9#Ezo_i>7O?ux\ 'FҬa- J="IlK{xjږjZw-YT( QX5XV8Q@wi$=DVYu))((((((zE5w\g\8 nng䄆Q呈*#19Q݂*f' ?4WY{ u`пg^xMC:G>,麗k"|;.cHƻzivi'd'>Yko<7ţjl54Ƃ;]Ayfa11Gpfwr{r-ZssysAS^ c1׈OHNqT_ >[\J͎V {W_`IlOߊ: 2(fkiPz}袊aB:s}?4QE2((zǽ81Ten}QE2EQE!QEFP?QL(((((){EB:s(EQEQEQEQEQESJji@}ER:uR:tQ_l4?#O=SW?v![tOQ__EQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQE*SI7'χ3_w/fzJmQEQEQE"sQRQEQET=/1'QEIQOZ(zsǷ:((((()IET@)hP!|S9jbn~ /ؑgٚBB[xTw"4i@ƽ^;mI]P>=[lg1j%8{Oi~=h׉'*Or9| ^sd_zIi,q/%X\Ƥ, <7Z+= ź jM \{Zem j66w0E=28'+$I4c`9C#V:+b((( w?e-ϊӴ=z[qs/uIZFX'6VzTm/rŞt ,z$SmЉlu-orJTU'k-u<_=wWScv?!+<M%xWVѵkxکsmI֏o{;Oo#E ˹IF+ *J~=ڐ:EJszTl=(QEQO {wQE t)hXo6/*o#쨷6f>$'ֲvlO&|W/@f< c5ݳ(|~ӿ|2^2j07hGe{$WzOEQEQEQE7{O(߅Vw^n_h7ֻ}a/jG /iCbQ ?z~4;p˟qyss4mn=tz*QyƮYJ&HN(((((+/-bO"ѤXO# zqI$ 6 6v(zaUr$L˜dIϼ v}k>շOGv袔z (;>S2IhJ)@'QO Ί(J((((((('^(}OE(֣Ⱦ" b r9ͤ5׼0ݗ_iɑI܅bLfD7BA>]χ~v2yZq|ҊDQEQEQEWg| L-Is+qN40$W^'Is?Nkxҵ+`2DX =ͱϪީ_3VW\!=xu`BzxP;~&߉u:((((((+}Jlg%c%W#'~[qn+?g-㛂:'پNOi6АQ_G_hVQEQEQEQE#(u?r owbqf?©ω4m+P]1e8y=Hľk$8봑E<(ފ(((pB}(?EV΁>t_hӛM_iWI-*t76H0AʎEI O$2$ #+~MrxczQW)|QX$886Ð9K]ռ71xTÚPáfj-QEQEQEXrVWfx-ͥHU;J]|H~OO2%(ŝᏌ?b0cK #)\栻nh#@?4W}yuR(z EESj("7S~>n]_[gb-4/_w> X^e+s^cҦ>O:^z^ᯠ>aDK}Kq&جu<4bp\X6PڨeGwXX$_A7r꣎@ 񷃾$O={x>,u xši$Դ}gLPcH؆]ەIṶe XfU # +l ph((((((((((g>Nm~?~x#o7W7v/+tT˫&>4 /}Pl4;lpga"ZI9 M6W*@W[^5YQEQEQEQEV|QokW-w^)o#4?gW4F>MWyOsgs ɓMKKKo%U{ۂ.n=ŷ xfvm)e#UoO5j+Үg0iXH;^3AqcjI\W[ֽ?~ZwfS0a9w/qDĝXt 0&\e~Кۃ/iv籺"#egڣmVO__?_+k2㦁KCYJxJU~0ףo=1 Dri0#茼nǺ.4H`nq0B;W}B8Aw0 wğ(>7=L ̢]\grk Y^oy}{N7wW/.%ޖgw?w;3݉'4WcUN{?ESܟ4QE.)QEQEQEQEQEQEQEQEQEQEQEQEQEQEQE'&(mc:)2RE. )7/?Ro)v/gE.{{)p@?QKE!$$hJ((((((?)v7?Ɗ(}ER~QK/(ؾQE.OEQE.1EQEQEQEQEQEQEQEQEQEQEQEQE`4QE.QFQF=)v7?Ɗ(cz~h67?Ɗ(}GQEŠ(aQEl> (~EQ(_/Ey~^(?QE_ע(OQG袊<EQz(aQEl> (~EQ(6QQF (cz~h67?Ɗ(cz~hM;0}h0}hJ(((((((((((((LQEm_AQE?ERl (( gERloc}ERmoOER`EQEQEQEQEQEQE>~TRo_E&tR>`?QK{~j)<Ҋ]E&?RS:)Xv?QN=h(((((((((((((((=FhiE=8)XQE|QE Q_Yx|_"i-Gt h ?~!Z?H4=>It xBMmCHߛ^&+YAGVWkoQ 4XUEU&pI2ɴ 0Q_+^Wwԍ5ķWw3?/-$HI#7rk 31,}KI>$9>M(((((((((fw.'_joS}χ/bI"F㸎HVc׿Zgqt=~kHe`}1Ђ+y5>)QEQEQEW .[)>5|?Tkd,a}nH~HgkK`jzNy4B]<-\ck~5?\eQE7UEwW?|8]L:tx?>.>6Fmm |C彔W2źUxw\ #O$֠egj.,z ȫ5:'ʼn?a_ıI C4o;,R+$xFсVV+H A=A}S)((nOV_U}0I񕯆aw@z?"N#72v,n#X?/\U=G*H@뮎(((|i]3~g54oxg^f.HMKWkpsn`KkYFcX$4mX  azΗ+.T/ +N{yF$Hd8HEVe=T~X %QEQEQEQEQEw0|?dO-sKO?j؍?|;s[Jm4U9ȞL0<o|OvO! Iy Ih&OvY4W-utQEQEQEQEWX~žܾKYAZضߊ/yxP>%ӣĨ_>?ӎ_ZF7~x::vWmm+RZL\HqI<}(48PI +op?\vbDSğo> l>,YH]|?I&4f$=;E1gcDk3\zV}Ap?h=3դ~Jp!r~z1iN#$D`?~?/LR3?}D$aORҿf_[3}d]r>}6#psitI 'A[?HIl$U?MCOJn4υ2-.osMhㇷaz36}25+H[4EOX[u꥿c(_KO&e&(X> x$/@(^XP`0v>f-FˌHm {"T+b{Oo[}^ 6/;~`l"00p08H-mmWm`8WTbTQEQEQEQEW7w-$Oķ4_mWt9Hͤp|⽏B&+rٷ0_L%H<Uu (HϪ袊(( ETe(eQEQE!tS ׏QEQH@=EQQ==ES((((((B?QEFP(eQEQEQEQEQEQ_k4?q*o.?Һ_>48@ZQ3~))@'E*?QN((((*EN(((+SC_ڿ<}[lC!ӼCeFN9i׏7̱Ӥ˃*2BsEFkM^iZޛcquV^Y\{E*՘IX4rIRZV>(((+Ie?`u:,޻Ï>xcgeǜ1ĄNXqQWլ&o_gT!ahNTPxQEH*J(((_ BE~ʺG#^_*_?g]f[hq$f']Q]kᾝÏgmx~_ MRꩳ.{G$oEKy,wзr'_{~]>QEQEQEQEQ_u; +B/߄|= ,?X8Kc?b|r>k[`*Y%Āg?+{ǯ?+8z(pR}QREREQEQE_PI?_ûJl?|=M8&QvY,Z^ݧO&mg NOO1c݉&mU_VQEQEQEW v/~-KZ?n~Z}&c7[yƥW,:ӗ *7ڱ8'kM!;<(((J=ڊ*@uz y?^)(((((('ETQEQEQEQE~__I>C?Pi~N B 0=KͶ;n7V) 7B +`+آ((((9gR|Zt=)E [Yo+ʥ~Ş#V-@Ⱦ7gY,iEYr^ 7730LK@"S|?EM|"wϹ?Ez(P (xAߟo֢*J(((((((?(~=袊Z(((K $:YsvVFxK7} G*NbK_MKXI fiS/R~ f̚VuLmP]F{T'Z{fvԟʊݪQEQEQEWspog[kD%um@=xᴮ[Bm"@,Xs^1ѿ 𶽣-pFG"_>nⅽF8棙<ȤNWbY`)!)9b6)$R^9#u(2*E~rA $F#<QQEQEQEQEQE'QO{E P:J(3ƩV~?VkO~s5R[@_W䊤lOfϯxPkAf[kĝF}Ɯ-9~yBG?-kQEQEQEQ^I  >|ks0eGAk>#bǦ<(\^ ?Kԯlt=0-L1ڬR!+P((O?j)nOQO AE0_mVWٶ{i4? 5GߴIZ΃lA Iwp*Ȯ[> }}c!lg%\A.'_I?+M袊(((_I״SCmKt'R5il-Oo4?,i"J$FGSёVSA FA_uG >&|EiyxRdo5 z`min\ Ծ{)>ū烾gEkVeҊj6pB}(?ESA((((k?\}ko-Km/FI$_x.ܻq-shI{6Iqkm3P~6Q_TQEQEQEW߿ Ήe̿!m"7~ U] "R=i4KiI-? exDhlN8i,o'`) XzXѕXG~.pUES(((Bv^?l&U~ ?%Ե5<] kJ/ ..`|ks_^w7Ab!hc>?͍6Oo7Ke)?yPg#[[!|aou-S91*}OsEwoymt_ Fd__Ƌ5?z~24Zw5+gⷲzxzܟg=x+^#XԤEw=Esp-'v;RN7M[~ O}(߫+=JQӮoho,o"fIaxfV²+(ee!UAR A#EY((((((?Nز=RO+yo c_Ë7im׆4Tᅬl:ZկS9o 7&qU庂>fqQ_n|aza_wa=ߌɥKB7 SQ Ծ(̅id|}.< 驧FrjA.o1B֐8㉞ fͪ1ȅ6(~%WOg k\Jd1NآTEfI$=^iQEQEQEQEQEQEQzhv~?(#?pE8)QEQEQEQEQEQEQEQEQEQEQEQEQEQF )[QI?:)|܏Ro_8/4Ro>\AQIRORO֊(((((]TQE.EQK((]ER_OERzʊ((((((((0O@MQKʊ(ޟ(c{QEl> (?QEXO(`?QE4QE?ER()h((((((((((((((((((((((((((((((((((((BE`zQEmS/ERl_OQHQ}9(=OQE'QEy~^(}GQE!F?(kz*(F(((((((((()6/Ɗ(=OQE'袊MQE&TQE&J(((((\SI}E.ҋ?0XQK?𢐡?2Ҭ;d)((((((((((((((BQM(EYEҬ;~_4QE6((((((((X{'E~ȷyt|1-?_|M4;v9>)dwܶ^'%1/,=WMbb>TXh+ѪQEQEQEX.?aۗG+~-,fO zָmovQ%!a]L/--u H o!Eh!I~vb06y}D3@<Xf6m[MkS1Iy7z4[{\Un81E|\CEQE}Q |N-i춿i/ԥ/F>"v[Žޑ#H23kP'j:eÞ\w4aR&$B~J++j((((+? )T+KMMk@ĸCF աXؒ['?5E]5^b"E:eGю+ʹ EQEQEQEQEQE>9)X7Y#6)$n2::2TARA9pA=i\?g'1dׂ4?,"ꡗ`q_=Դ/Q"Nt")#oDo*WV:(((0:++o-]O'‹]v2]}G&Fr~$eO͌ JM`{'=.ۦ?Dolh璼QE4>QL(GNϧf(QEu~ xž&ռ1YzsPY6X\d gs%ݭG\As eCRêGsE|O~7t?x{E>qi:m|wp_G5eo"1[i Ls` r(O堍N@r{H'(󌯍(((i@}ETef(EQEQEQEQESࠞ!> xŞKO֕<+’eu|mqte+~-ɶCdogGqB]ZqkOS徹_G81dEƸ2s1ReO ?g > hF"4} PD8&mm쪗ԼEjPrWh.m.M0' 9Ʈi*~g+קEQEQEQEQEQEQEQEQEQ^;D|3O4~Mg4R~ -$roE(TD֊(O'袊8QE-QEQEQEQJsET@4QE:(((( (< (WS$sC_~ k;)to d|Mktfu,N _hXCixtd9D>h+QEQEQEQ_o%-]Ss@KglZ׍<7,`ŝVo*~/ͥ,E֊20Ҿ*PEREQEQEQE+Sx8^đs>x>!x>EDS׫--]}*W|Quiz[I^@j,4%$3ctkO8n=hPi>Íz>x^$ӜiVއ[ {o?*З1MJYc{kjS-ŝ7vKoqpp@#8 Ej(ڭQEQEQEQE|k^eĨ<5{:Ս]SiHȲj~ ~&uKK[̏}j6hfbKkmpN ) :1<_/Ϗg_~SѤ>"$ )Pk4˹xU[R>ͪiw6z=.ߚzwjWMf:kK,4lT7|+*)Fe=T +דBE>((((am7c%kṞin!HY$e:>NtRZ]E;.;T*GB O7YOh,l=: ?Qe.-nBRX'D)xYIW²GPAVV)A5EZQEQEQEQEr9_$'?g?Y܂m xI.L}ui(s6* h/m,c]5Mdx)cogO AG<Ew1x2<~5[~ D<+kvx'õ6YlWbg"mCֿhw!6Xm[;-ͳ: KGC,@T#z ¨规?j(((((((QEH_hxtQE-QEQEQEQEQ_׏FCu[m{?ðM(wzǧYB+wyVxm|0|#ohSn`J%b1FIw5W |%wHd)&7m">x1޶ sF'wETz(((d:C /YIymowt^H#}F?xR0 O,-I$ [xFp\3%\גyv7ru;S + ?)֊((y|O1x-izγ.,GxV9TM볦wKmoLCcqsݶO zHnW%uTQEQEQEQEWh_U_۫?g,wU pZGk+$ [x'D Ѭj(6?;Mݡi]D&[Glc^.ۙoUj)h(((((L5s'J}Mq__~, kk}fCT<2JD`6ߥe꫘_sQ_m|XtQEQEQEQEQEQEQEW?od?ٳE_=|%o,C+qV!Č\=ԾkHpYC|8Th@[ D$+̓X[3Mw9_J+wqx* =?R%Wѣ??%vdԴ9dS7|Q;11H#OW?x*j^"qmŢ{]MRae ~a_~fF[y󲩸>8Ĉbs "OO:;^H-e' nnqȴr}Y]V/AVeh4;O {Hr7 MW J"AO\O~ agl~SqƧl{J>эSW|d l]vbdv_ ~Gh]W㭋"3c||bRpF{dɪ&u;aSU({|0/xpOMgè'?/< z5 ?bpyگmɆ;{X'?_床q^0ཝǘ"<][Ŷ Dm5 CYD25FU++_~?x2^)Qq:zmv p{UTOs#QE~'~U(g ~jx#z?  e[k7u8Q6_N<$'><~5=PX%v𵭚8b9RI$Ԓ_+(9=+QEQEQEQEQERO@ϽQN{~4QE8 I(vtQE-QEQEQEQEQEQEQEQEQEQEQEQEQKES7>٢GJ)7CE;b0 ) 1KE!$$hJ((((=?QK?QK(/)v/ QEW~TQE-QEQEQEQEQEQERE[QEڊ(sŠ(_ER_s}ER_OERzQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEu^/.OxƺÕ xKڿ5'.H@:5 #Hn˵C;xdz|7?Jr T ?$oJ[65|/jeltMo7㩲]Ciή}ֹ{ !~΅ݏzWO ?KCE~|3\<9W>|Id|buY-XʟtϊaA?$O&Xcp]m]cσLӳ횊HW4 MXM*?|φgī߳/vk7/xAox?>eԚAz/uC)esP%ՕћPԲ*+3Oxc_0_o^0_vR[^1]H%m_ A5 j2k[X[&l>J̪? Ǎ?/0]xU_zׁA8;[6C1fbT;{oLQ_ŗ{ƾq:) 7QEXvʊ(AQIEQEQEQEQEQEQF3ERS/ESv/>)<Ҋ(}ERma*(:QEQEQEQEQERΊM{_1E7b)a?IR_z)(nS/E&(((((((((((((b2܄R$hH(?,q;TVf!A =z OT~XQEҍQ_L%7_*o>&xOx OOU<]uxYŇէѤ]J=B}^];] xM.s0braN,Z`wt7o >נ1%%n|BێU<>;vm?/t+?cZ 1? % >h3:G)BoF~o ktג:/ nup("'EѪu-D~ ? ~~krma7J>2\%|E;IwY6dp$aPu_ |0xgO{6k?B1[;e!N? DJ3q S |a,G4bk s5 7JZy!G +mm-Em $`!A=ª¨P:(ެEQEQEQEQEQEQEQEQ_|1iy _];J6-> -3ĭb]\1؛/Z ;c}|u9}:AvIX~*A*QEfFWFdt`JUYHAhpG E1~4~1$p> ,f:64Sw&ѯ}'Q"Mϯڭb?mV?֊ҧQEQEQEQ_;C|1 ox3"1:,.,>eˏ5| 4M>niÌ +Sysڒ}Fmh|q֯ S ?_QE4:}袊J((((K5;C'y>g1V}¢񿊾3xSOlfkwQԟf'-rW>ݺ?AkmD|Q_5f(((bόO\*g|ag-BKe|yn`rS٪xkR>l/Y+W=~lt5 Gh8Gھr)((( QE0:(f2JMf9nqg̞CN^?S_Uz((((())=)QE5g 'Z+w_x~Ҽ7/ho3iv4B2Zb $mmogVCkm᷷!$(UDQU@ҊjjZ((((((((((((+d?࠿ ?۫Q٬Lm_,7"xlW pQ1_>/WV[c[ɼhJ0"ɗlү>8(((((( ()QEQES4QL({szʤ^>ꢊEQE!QEFPES((((((iP}ER:tQE%QEQ_l4#uxGO;ZT'(oҊܢ((((((((/i?QE5m4_t(((((((()' M 3_w/fT)S袊)@'QR**tQO (PO'ӷ^(EQEQEQEQE"sQRQEQEQEQEQEZpR}TҥQ_|Svs?F}ψ]*^~_x{&i`mۃڇ~i1۽SOsx0}6yеnsd~j(((+G K)F7֊(BEWQXoy2'3 n5z氏ڼͺixW]ӭɮe-I{k6J}o]:Y\ZA* 0U^*PWB=(TQEQEQEQEW+w;Ï(} n?h|64_ CY$#~n|>S.'M͗lߗ[Ƅi@g#yyϽ)H՟EQEQEQEQE~_,7qsm#m?Zl1w`fνICrT"ї~46e_ t,gu5϶$UEf0?R(r^(((|^>!%nu߁\zū8zվm>[L`v#N?Fj 4X n@Ts6ؤ>@+w+z规'OO^?Z*@TZZ((((('z*@}}J(EQEQEQEQEP=(''?:((^_"W#O$O CĚ7IDᎥyJ_>,`v UHE 5x×iD4ldi:-Ǻ̬ ہ_*+Rږ(((($'ELj|? ?Bi<i| !ӭ{AW"bTR6\|={߇֑v4̟hmOе[n7Tᯉz-SkĺM*^J7O i3]\BذKy/s,yR 3BhK5#ĺ.=Q4KWK SHm"uGqg}g<76JK " ~E,sGк"$r(tta+) pAWGץO(((x?&I7ᖁ&A-F]m4uygjgJVÖPGsy}xF/i >21S{eW|TE̗6lEv4@,ۈPfcU/ ʏXj7Lֲ:]޵6o5 `NqW أ\+8݈U&duEڊdٓeOß xJxRWmKQl5_{ ]՘KjWr~Mi=Gl഍Ɍ+<ɜ4stPtU =1ǭuN(((<Pb}R>!.)z߅Lg FihisDCOfz K;qт[YUٿJ+k)IxAߟ}(pt{;.fh-!r<4N2Ier++)*C+b4r(-7kgK:Gh[GMm#WNxj 6nmcuXteV^WQEQEQEWտ ?-4ϟ > Ip\^o#k,D$A%0 $d]:7 `jZFv[hgl#{\~ J(澼b袊(((((c^?QEvg7ߵx3qs'i6/|o_B8/ 3Q /}i?nt1\)B孭)YёAEuEQEQEQE~? a#~5q> NS|S ^wi 5(Oӯc'a5KP]ֲQ&__9EQEQEQEQE8#ӂ1폯S~OEtQE--QEQEQEQEQEQEQEQEQERO@ϽQN{~4QE8 Ί(@?EREQEQEQEQEQEQEQEQEQEQEQEX?F@qE8!YG_,w'AǏGois?E;tsQIEQEQEQE'')v7)YG (`4QE.tQE;tQEQEQEQEQEQE'QKc袊v4QE/QE?Š(ؾ)vAQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEHپ8j+|=(2]_|W{{vb>2*n}i.4WӴySy!O]V]~?ݴWezm^(((_ j$l}+: oOxUw=fg#嵹Ny;/x Q8_HGRƩߦIǢ ʎN(((0Q(j*(b?QI?)3؏Ǐ)67QE[TQE%QEQEQEQEQEQE&M(;QE4A?QIon1EQEQEQEQE𢝹ؿOsE/{Ɗi֢wڊiF?v=󢐂:E-QEQEQE{6d43{)-|@}m|+ዏx[qC~]/4;?2I{HNˆ8,xit?yfyGmmfG^]2>D>J-2ܷSzQZ/x 登C'ٍ>-z/Q;Ee ts쩏ԱTW53 ]Or|P|;M g#]\&E.o[ں2j]6zA E~1#(}[)=k33.yk ;75XT iWMG?]dsV:B!BE}1cN=2|#kO;x/x]}ú^SUTٴ`l:{躶cagfeiksk,vˆ?Tnї~#=heefVR+X`pAA_:'E%Q_m;(~l3J-O?x^18=x-*0oo {]1H[Z!+ \qOjz3SEu}[QEQEQEQEQEQEQEQEQEQEQEQEWޟ m/ٿ6Mٽ#q"YeWwHI9mj02K|@y^#ѯo4cn4W]JU=Uq,m*ŠJJ폧j{cZ覘M1Ί)H?#ʊ+`k#bzK>ÿ7hϺ[_TQS:74ˈ˥ųz* JNZ9,Xw_$p!5ٶXOm OWzY(((Ulvj^Ԁo64/ꮧAƲ(((>QE4?QE¤uQE%Q_N ߇7^>X]gr7sg Aoeas凥fꋘ )x`M*o}haCŠ(GQERQEjO\ySO"kh}OI‘'*d8Y`>}Aofj?$5>䏭tZsnQuw&*EQEQEQEq_|]^>Ax,/ W̋!K"RH"^ K;[[Opsay'h$f JXomN[KTu ؼw׳sws3ygY%v&2wGb#K3rI&=휞rrssׯ+<QL }QEQEQEQEQEQEv_x׏<᷆u_#<# hvVt+JVx+*Zkb9$K6vwZݵ\KIF=Y8rHURFK4W ?_ ,E; _ Z K<1 u/0WqjQ>F}2~? xOYHCwh_ `;h]ȾlPC ;27ʾ?2y=+:EQEQEQEQX^&O|~)/ xcEkg~&AlЅ{OWn-4 e,%,pH h{5$ȑEHU}؁A IƊW$.ID>e×JI|'gJ" IČ$>ka^3jN:'apbVl5O1|49q^n=jCYE~H^|#σ-nK[*9JH l.;VIJ53C:2[Oޛ @ډ`qAW Т[?U)w#p?i+j/^,G.CY5mC~17 qDjxQ뎍PZ< xWO{k׍~<|e;X^4'Ou_]M E>wy2]xtNQ&-]:jwWR{ۣn&fR4FjpbO#$(꾟:(((+?W3G=%6m ᇅ\}~4 3س3|?u ;:0E3{s|Ma_.ۇ=++zǽyMT({sQL((((()*2>ǯeQEQE!tS ׏QEQH@=Gފ(ӟ˯?E{ʢ}oh+E9Ta֊*PQ3=?֊)iSzE(t)h(((P ET{_)QEQEQEQEg@QEJ?ʥTyE}QEWf7\o =-KIc*?*M'FS|DXٚ|Kk[ྃQ2=^?#F?W}_Lժ(((+:7GՉ*|+fǒ־8ዅHt{O84>b6/;?z~ԭ$f\u,D"YFފWُoⶖtsxD]C@u=.ic4=nmRD-nZ i:M慪>yi:.TI nU,.$׆J3!꤃?CQ^9Y()IQRA+6>n-ؾhgt"АDw2Y|aG\Iy.dOkxT+c[؂G ڕbc\ +Hފ9h2kJ(((b?,lD|-5͒>$|)ko7.e1KmuP'Vl-{6;g>jby~YoEhP:~uP:~uE--QEQEQEQEROA*@u(EQEQEQEQEQES{w?QRAEREROJ( b67-P,>J|-a=Ż;s+x=OYgIy.쉧1h/𬌾ƙ@ͪv֫kǏy\isR:MŜM6ȢE_&XL?t_= \EAEQEQE(QE< ϷQE%QEQEQEQEQEQEQOO^?[OO^?[E P:J(REQE{՟fb[Ke}CY;{ԿC3kmI~Hh]޺˭[m|ZM*]ڏ< ~y4 tq372YMB<)_?Q_M{5\((((,$j'_ .ˢA ^nb/a)JeeVN B}̑űem5R:[SE]hQEQEQEQ\u/įk>?,mc@Cg˺+hY c\ĦyCG8Qz+j炁~?T4QKEQEf(=?֊(N|Ln>&z?2mC g!G Z&C>,O9#6ym=zb{6m ~@+(*jQEQEQE- ~k=|jc]Ǔxb7(t!?'e 0*_RQeoO)'\>ΧGj++((pV=ES?QE(Z(4w"Pߊ.<߳v>o> ӎpG` vBϺG/IOkui*}q \_5'ud*4W1uE|; }|agZ[?>$N=6r\p9 l)ǽEglmdbx@<cK}u_E; D,L:Po |373+C«|]xd/->P\8qҨ>_ZYTE ߪ?Z+wg ~ox2u?k"1?B r/}@J ew3hm- oL~1x/UFo|` (,#QKz(/E?Š(`?QEl (b~(b~h6/Ɗ(b~h6?QK?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!EQ?!ERmS*((ؾ((ؿOsERl (EQz(?QE_ע)6QEQ(BQFGEXv?QE`EQEQEQEQEQEQEQE'7s6>q\:cLIZ} -Tq]F1\\]Np>{wY'-g ;w"`dKWE`?.UhB浨(((~?/{j?|Ypwe񷀵 Ĉ0Oeԓ#Y6쿴m_Na}MͬLw"~7_HWA >:(((((((((((hQI}?SESLc??ERl>(ޟʊ(AQIEQEQEQEQEQI}ESv/>)<Ҋ(o8)0GPGERQEQEQEQE!pf>h_qhyh1ΊPE1?_׍ZuFĶ>&YJu'en}{o \ڿXdbZ80/^}ԯ멢((((b> ~ٟD-Ï7OtF4"i\ [iPY[ g쿳|Icj0<&Xh²\iW87~W˵QQ_A_$-A'Tcrb|3g[Z|).uk>^,גY0 k=Ё৵[mQV*JT~Q__xWKEQEQEQEQEQEQEQEQERu-;HԵk-/NuAeem%̑A c#/$6/J 񟄴Ě,,GQqWJ O,cغ?;[F|:7?a^xA\;}_ƺ<7yd֚0 :y ߌȏUuROn}1[BVRjj- EV?~Ww<^>п?d?x˭|Go>pW!YÓ|bkg!WFvݑX[P s*bv)Q_7 !+^}1&gƚX_hN=Lg,v>"OӦ}54ƻ0d,4Pё%9u1[1cc Aڊ_8tQEQEW6-s|D{sq75m>~cOLj<^w Kߴx>ћ/a]"7֗S5[cf܏![EQuEQEQEQE(wgHa/߆ƛ]J&ÿ~x+ xR՗sP࿴]*FZ[Hv;>h-.`F~ ?WW5EQEQEQEQEQE4=+g9~& nnwih'hvb@𯊮?̊ۼ}|Q.zymwm'liM?a(n(((+'(c ? WCooq;Jm_/x-]VVO_m{,cg+??J|e L_[_ W5EQEQEQE4>O QEM_ۃ;Gs{~h}~׮!L}Ȯ[nvM;_n>[E֝|`gpykkJoedlh:j(((+ۊkث,_w'Yh+S^!eˡ1"~"TE~m'EQERGC) QO?/S  )Sh(((4 z(ĝ ;𾥪|m%.U`%]'V}PiC h^?gG#^ Mѷݔ}gr-N8>3Eu5%jQEQEQEQEQ_R-j''?iK~pNum{:d}G;E!e^fOLϤ)Z9,NJ2&x5datH+5J qzq_O}}qvK,n ƹ^GnogKxpv.'&IXg tQQ?v(((O3v<~wH>|(v [P݃ +㡯g$?ھ'p0OVMs9_l[iiz_W𢿾Ƶ(((ľa_h>#zfTޣ\H$IqodHCjAp/tOyI'c : WyJ'?5~εEQE!QEFP?QL((((()*2>ǯeQEQE!#z9Hc_ڊ)()A*2t_(EQEQEQEQEQEWڿMD1lʼuu4xN֕$?b +((((((((+j$hdO8QEn_[oMw&(j(((((((_ o)%~|}_^<_5NE_0_Q3*(*2IERQR*w?E%QEQEQEQEQOO^ETcEQEQEQEQES=֜aQRJ:QE--QEQEWj|SjO\6f?A>Լվ|I֗k.~{Ҿ(Qd[[6@f+[ }%M>#jj~g_U8٨aQEQEQEQE-ROࠟ¸aڏ㎗ó_^VaE֗r2Ve??c<.Զ׵Tc7=P4mT8h4W5(:(ERER'ڂ@E(P=ϭDONEeQ 7^2s2MZhiђCOԮd _V4ȻE7R˷oئOc(|xl17QN?J+QEQEQEQE?Nj ट ,ZgF+H>jG6+9e]oShHmQb'^ %lO/KhFzEk)]b%gP?oOʊ@'EH'}QEQ_t|%s$~3\Z#dG #MwG,\Z]@`[ٻN<-epضSZ>FuṋZKٿE^]\((((((P QE Lu۷^(EQEQEQEQEQEQEHފ(((z_'EH*2IWMY?mӍ?IO' I"6.Hm|Amj!<(zxO HSq-kk :6Hg!fXߪRA'*?`pEφxmLڽm%#XxZK{_LWvxg4Yt" MߪnE$2 GseY*C,qM NXuS=GqpA_c~a/,h\xWi - \O;/rK*]@ #0G|m7(?+U=@#Wx> |G3ž_?5|Ci/gVP3*?("8eV%ŭ1[nh&A$R#wWF A ]]OKEQEQEQEgk>-#T47]u:GִMbS5'RQM6) ;PkK+fX'Ht,8H%ThEWHJr#+$P@ 2z+w>;3OuOą5摼ؾPӇSþ+kSJ?| wmW!rMM"X2@-.]>o&}]\Xd3{}{Q_ŏxSuᯎ~xGr _Yl7[r$Wmh]$o 7PҮ^SpIo(vJJ|29RG5v>کSh(g<_f~1KmއU~+~>kHbޞmo\CD,AX v%pLj5@XkVQRmi,~Dޱ:()@')s֜8hGl)v)((((((((((c_(#?QNڣytQE:(((((((((((DZxtPHHZ)rE4ފi~עŠiv=9nIsEQEQEQEIhv4QE/;4QE8"QEEQEQEQEQE'')B1폯QK?)QKGo袊v1EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQERʊ(kEh]~ER~^(rEl_z(b~h]?*(AQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&QHUOaQFOE?Š(cŠ( FhO|JKRŸᆙT~1bvgݚt֛kx=~r?ZџNEwW_SVQEQEQEQE6/RMmO/ ?|3:N,+ Ɵkmqlm{ybuXW珉,|CXche ёU؊nd'ecW5PEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIz (I$x=(wR" 7]GMOQ`wǹYIBiϏ|Qial8ʌcqH ycT~0-Ӭo{/ei*^<{y+¾t+d'Pk1h4xOp.H!8t37jmE~'u?? bfi>&jŏ<[-2>ĚG݆h)*c|"S?{yyp[ބL&fqvf᝿gOE ~dH*^=)Up:y߅n5kVrk@?ܺM~ cV~i*O Mm/;lQo'OSQxd]:FӢ%}fGE<( & ao-,\I8q.u}uhFhؖNeׂ<xn<1sM)#cZ7ނ#lZ+oyqH6kҬ\|7xmj^;[]]Xmb]q:/_6QҐJ+ǻW=R)`RɥڿF$~!q~k/TW ~^knG?Ebjm_z:ȖWhcWI {Q_͗^(ּ~%77{& xC5m Q-k6Zye/m{k ʬ Y'k[X\D$R*Ȍ=AYJ8*<\W(hc?n?(u~QE%QEWO~|qc'"C] GBCREQEQEQ_|1cuwuvv}?0Xw[./|@B#6wii z7~nm ^iTe%?Gx$QĔ  TnaqihקMDR1Oe>&$oV+c%D'I#H䍃2::2A yt#ֺ)QEQEpŏKQAz䌩ieek=ò1;*0זLPKq sJpNKPpXx 'ǽժZ((((+xࡲQ?lڛwo>=/3x+K.eL/hLڅoqZjT5°zuJ3uq4GTBJErҫ36FO:LQ_a湚mQEQEQEQEQEQ_;*> \n_-|y?j>=??F90c?Nc-65 ?VƔ̞Z+kb(((RCV~3)6|Qn\++fl%ơS"wo5ڌ,h}_ KG ؼMo~ g&`[֎n ~6!4WUEQEQEQE|p|1~?W?g^ Vïi<nmuYۈbl`OÚ{jV:2k92?Y Qʻ?Q_5_uEQEQEQEQ_O9;(7WUOُj7?~"J#O:Vh5_ xCOk>8[zG|lq[EvTԭMk=٣He9$Y{Ɍd#s唳,K1%I$IcIֱ#)((((ͿZ¯ۋ]ų/A=Jd;χQEFTqESh(((c )?e_^:xCƏҤl_?!EE~VQEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWM$P>WϏJ(?X~?4 5fݷG/[m$,hሶt "*[Zj6s$}\=ī3(ZѢ((((?mX~ci;{omWYo*O¾$w&xfB㥇~%kn=B61XA5p1)WbO!(EQET=/09?^*Jy4QE%R}QE?o/_'mT>A߅XmcK!HB,։jp TڵƟ'{Ewn/c7E*d$ i\uRh^jOc[p<x-9#κ]7 զR'ּgºD 5 "[bC#xo^>k6ڕNf^RB0 -/ʐN0uW^2?(IQUW枻^x{XtMA6]r̀B E')FdnqG#^Y4((+e?_-ů<}1EY5~((((( य़QA]tkWékgg/!H/M>|`_SUþ"կFz'tӧ|k+B2[A>Mo hfw)IkX}>1WL+<37įR6<x3Nk~-G7мG+ih~"M|M"Dp!miV q]/7 0MLʤ|X, 5EQE8!>_QE_X?:WEQEQEQEQEQEyo>;? >ai|;CI%LNY3*3E J6! )o7Ue|X."9E9⑕Xa0`o +ŗj:7G24~w:dIhUB\d 9ycxgޙ{.OyX:M[ƾAoIƒ 1 HUE pEt-QEQEQEQEWo :m;wz/k?5oKzZox'÷i*Vn|u+_GM>߇|O+Oie!h5t"Cy@S]9[XXpn_&<",5.;|7;Wg^3o|HM_>;׈uoZܗLj (?QE. (b~h\A (((((((((((((((((((((((((((>Ǐ!x+v^MH;S:5_15bKk?睼2LjSUf> hύ-'gohOi_< NMwIӼUW<7qjVIg%ŬG3T./SnMyuy/mqQx+sb~Iz(O/E(MLC((((((((((((֏&kp4(|Ԟoae4yoI-+N[~[Y|_KH}ZX[uѰ'M[)H l<(#w"`!#Z",# ;Ğ&" #xA'>ǝ XT2_ź⧜UxSៅ(54*M:-kE \K6*l:/q&AQEQEQEQEQEQEQEW࢞ ß?K+XKg~KO\3t?%TSJ_qvPr(_]la앧T+oA+S<I0N۱;EaܮW$tqïѽ:r=i&P4mKu.>xoJ纗Ζ¿45&Nu"ηc!ޱીfGB1X.}h$)f`+c줵9?" WmuHT)AA+QEQEQEW Fp~ l%~v&^o-}pό;"o6~F-s_*>Es+_ݜ}_:bħ6q`{-;+1۽vQ6t(UQ[<>'~_qqgsҼQ&"ɝ[hp6N`O5ږE5l9+NjBf{*UyK!qQX)> ?[ {ܲ/ko׵/䗊;0,2JnWlxDԙ]`WOPʬ=A94NOݑ 8~E((((c X[[_5/۰\qڮp9$%;%؇fUgؾ kW5|cwlmf8g3ֹu/mo?hZZE!(?_E҇ QL QEQEQ__;o*]>|ZvKO |X \AgQ(oH$PBI >.85-"/fhlBkCLl\C%4WVuQEQEQEQ_2ڟ tǟO%Lg_&~IpOm\E*+Ė_^t7#RQvRLw"y5#_C_5QL(=1M(=1E҇?nOE4:SH#RRQEQEQE~~'¢~-7eMCLJ~K9m|dԾN9 ,RC㗎fbbw.Bki} gh}R+"zq$q؋f.>(((B+HF Ax"(l_O8`6? ~AS75 ,x=tG޹ekv6Tǧn+vK"u&"b:(((+W \y:<[:EGy 3᷌|r3ڶwg繵H }%> u\Osbo\xzrEŔW:ƺJ(((*ey^—WWv =O.;HúeWVF)VV qE&?|}G:qx+V%]}ºw&E WY^Yw]\[>zW5Ⱥv^̿#Q\=UEQE4qES ӟES(()A#_x~/xBmaZX9W9nUHV\C\I"RՀԎ(m$($qC4PhM=(((+?_T۫RhߴO+$^-?n+oʨAyd͖F?5 u?V,b.#A!ӡv]y&-q)=(TWMqQE€QEFTQIEQEW߲9i杩~9#opŹ- A{n&tφ6u;k}CLT &< A*{# $euEDTqzԀ袛KEQE0=8>( ERQEQEOR5~ʿ|]GtӵIؿBf(((((((((i?/N:QG#WE]I+Z(((((((WI|Ww^!ӽeIOB4W*(@`QEQEQEQEQE8)>֊(@EQEQEQEQE(Rz~}BE(P>LsEZ((((zQE(@:J(wS%z?d%j!exv?Gm|^x~MJV{WKxcP-m5*iNqV:4&E'К|gl}gҊj;Z((((+򯅿؟';o&߳Y6u|&$ޗIqodHIL.- }ӯeBj1Q t>d>_M|U(a֊*P}{aQKMxQEHES袊(п(+8t|M| |eS?KIi '<j1CixK(mVy>I'I'AU~CW5N(((Ƨ {gt;u xR_vHSCїjJ*G[~' &m{{c~"&m{o }TWTS?j(EREQEQEQEQEI( )QEQE~jBuEHޢ,Oj(EQRxt)hg:*~¯oޢ,kpꫧ\K4zG?s)O$/Ρ.mv-ieu5 Vnlfl$!`R{Yq q2~Ogব/FK*h\_lmx"~M@>}[k\z6]~o:t[oL}A2Aug5qX2:;t1Ȳ=WuO((((( D>xwĺ>ZVk}ke/o{]7Z式՝[B1SEeRԓx_Ǻ#;GlF] W%<n ϒt zN ߆_>krg7$5pd]'6uf7!\=(k`^ewc{`g0m(s"8pj+)+)`AĀOAU'O; Aߟo֢EO7Ǐq^2,Z>2+z敢h#}`$kkN߈5rK5]@7G!,q}YTw5"+ݾHE~~?ko\|1cɎi,NּLx3jKMʰ{`Qo~956:$ Z%i?j`NԭYK mr%H_/ 0>K5i:O eĥ&5}Kǚ0TWm_BI?Rmn_pLW2YoDf\/V]@Ho@!=xo|XT@?(Z(IrF]Hete!*ErZ(i~oҾ.Xŧ[A!Ӿ+[F#Ѽ3Zcl<9BU 7Z_Y(UȏQ@iabp9 x00]k^oR?f?.7+$kF((((((((((((u6|73o TY474|ffYXGMͷSZеQCx2,LZO+z'ԝcPtV[_18SyqgB98,:`_ڇ>:|wγ⇏G|GmjT2H -7M!t84@ҭ4KӴKkKx_5m[Q5 SU4dDPEjEj"+G˻fO +:EQEQEQEQEQEQE{Sџy_~2xGĚj}Y8ڕtԭjZmOe5r@'X[IuYѵ6k~4dxw7̣z+X DI$u#9EE75'ڷ}~$YV`ydOk2HF>Pp)/uoR/u ~ycۥ ,vy3Ex`E8uQEQEQEQEQEQEQEQJ)=S~3ES~QN~QE.)h((((((((((((((]*(c}?QNsŠ(=MQK}?SERzQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE@M7c>Hs/ᮽ/f=?P񿊾 ii4I5oZhFص 5mgx鷖s\)Xw]S\Z:ee4{{y n$cL\QH6t1DTbF0ņA>n 2~h>F|0ow_9TK/Ͳn,g-1-B m1'nI (VRm6یzSDJWE?Q5vGloOEloOEloOEڗc{QE~El> 6QQ(}GQF?_aQE~El> 6QQ|QE&GloOQ?Q4loOQ?Q4loOQ?Q4loOQ?Q4loOQo÷TQI#I#E`у#E`у#EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_t1&ž~?%L| wl|5?i>DúΩb+:^gwdX=d>s+ՋGsg1 Bh (((((;t mo|KP~"yư_s [[IĀ>Yy>'aotd>֗w!}|\v =kދFW^YQEQEQEQEQEQERm_AQEhiv'(O,#QI?QER`EQEQEQEWC7R|+Z~ں>5KRE^#? &O6rZxǶo->! \X5G$:9-KG61xl6N8JI.4t.=[C-ׁJ@CžƃkAo- İXz6Amoiio }Woo[ZCP *GDETA]@U0@(((((((((( ny@q@oKcZ]R +?PP{]KM--b}ciZ\X_wguEqo2X۳Ђ#)讬O ~9s Ux#%Pּa%S/Gj>Z9 x(%.e ^֞;{xz}FV|K?H{s@Mm\h77nn{y9savÏ9R\ĥ ##/.Z?+wS{|O3SJ0ퟧQMF(((M_6o'IkKkoR|W ^F$(ZU[ߵ>ܠq0: 4hnMEBuEQEQEQEx7//T/įWJVv6?QInNܘ$-+Ú_/,cmTu5.b#/(ʾW~((B;|M(;qΊp~_עP??ߏקEg7W6|a7j~DrK?n|ӒDqJa]$Հo=QݸZ}l-si͟|y ]|m89܊ܠj}QEQEQEy?w7Gn/NJ?!x;x–Khq ^O40*D9 \v =kT\Mz<~*0Zzˢ((((QOl}?(itQE~>&_U/_G}/#+6LH^"d!gU̞}={ ]}Vlm'`E}]=QEQEQE A =A+_j_G5D0QůnW`?x_HY+&RT95/oXӱf>Anʻ%?ExEeTtQEQESJ)폧4QE0:aC۟tQM 1E|wsM"^|:<$>%םJ)n?_E„{?Š(E?Q5|c7eO?>|FŎ|=+!$)u|Β~3^uxO`pڄFA!m6ȇ`MC]eQEQEQEQEE?Y੿WXh_xfĊ,[/ۛdP`1ehm^F0_ac]˙e?E~ekS QE6((zEž?뢊)QEt^gHyMo`/[_`g<Զf\zr+JU8`}?۞h-/-ẵE=k,FÆX]uVNU(e G 2>r+(((!o,W;m-ڟ!UR2jw h7hr\1_,$ӼwyYPF?u?$bBLW=rn%Wq5QEQEQEҀ}?Š("]~=߇Ww]J}í Qd{^#ZCx7Y^~"Z>>_xc2_k[8m{ ȠX_ma3J"a}QQ#zTE6(a@zqQEFAEQ_k4#_uxGO;ZT'(hҊܢ((((((((/i?QE5m4_t(((((((()?~^|}ֿ0|u#j+*O#VEQEQEQEQEH_((((()޿޿袥h((((O(:QKETO5K$<")I#uWGRX (%He$2Ar=&A$;|!_l|MUY6HjF. :u#"+qI8k󢽂ih((([1[(~=®涷Ē qbYʰ#?4 arl,QiϸqUnȧѿ?EE|r_Y?QRTd֊(֊(QKEQEQEWsO~|F'ů |4|w0[muRpd5 +yZU9!ѭ_]i7v'ފ{yXv;]A AU%H`pAqE/W;+Sx3vR1A ZfoO|0aIkz-qxjDV%mٿI|k_oL׭v ~SL2@K ܍Ĉ;G?E}]E>(((o3/ڏGş⮘5_ kMnH-*YRE|?Mw@toMai6zhڄ~ei5끹VU*$B RTGe O!!~_ٓ❩nR -5>~-ҢCn/)dѵ% #2?w= quIn킫2 ʹLr89"ݐSE|=ڱ'{S(`>Km/ߴ_ 12y!~/\Z`5OsN+ou2 NXwuMI5uԌv7'ĎR{˻i&FI4;#,ŏ$fgfw%س19,I$I>֊(E:((((((ן<͢mcğG-SN15߄5Diö-I*xR#Α;'|Eک?)u+e5"j6=\,|ۍchܘ ta;p(2W'LG<[5=:k曪i\Z[JKG*G*:/ݶvSuiuOoq "2HYH#ӡV AGB(REQEQEQEQEQEQEQX$eˢxzYgؐ]w+/;Vҵ UM^[ WF/tNu=i{i2arp&4dJIn1VS}sD`{~TV}2(((s??j>:RDk)4) oie6q.5DQ񮃧ɥj"Ѽ%>},GbPSjVdG]$ȎIc0enx~ߥ~?OᾕssuU_fēIxIm x$C}iV`YVO~i:zmkwݵ hY`A#3GI20e=>Gz+ܫREQEQEQEQEQEQEQEQEx7Q~__/>(~68U αuoM/B_v}jNm%_\4 Fu ]:s.d d`2ReI%=DKH;R}$Q_GF_FZX-,֯meocsVT\wZofӼ}Mf@O l%2]`Ȗk"R-G ~逦>ukXx:kykZ޳ujƫIwjz},}u,7sMssq,O+ei$iYevYevI$rYGbYݘfbY$MeI$IrI$iQEQEQEQEQES폯QE< ESA((((((((z P (8?֞8?֊)@pP;~&)((((((((('(xA'?QNQE-QEQEQEQEQEQEQEQEQJ=>QE8!:)wpA&i~tS{\QKE6(()@'?ފ(=?S(w?ES)h(((o袊_,#QNؾb(@?EREQEQEQEQEQEQEQEQEQEQEQEQEQEX?EER~QK}QNڣΊ(((((((((((((((((((((()p}K*(k:6]ޟ(}KŠ(}E_/~^(rc?h`?Qz(b.?(b~hؾ(jQ~<:(~B(~B)ih(O ~ gxٲ'ğT|;8Mus@~ {sV'-g+F;2f߇E>`;F?Uj+sj(((+~a^|#WA74|1_[λ^Fli sWrG-%fxnX{X@Y T22(󚯑k(((((((((((((((((((((((~B~B(~B)6ھΊ(ؾ6/Ɗ)6/>ؾ(=Ol (JO/<G袓aRl> (c{67>Mޟ(}Iʊ)##Au}hJ(-V4 _Jt4]JVnjmWw 7"#$rvN#J GsE_i6+ 𯍴͍?UXk{k 9grv?ܞ%) ãGЌ+4QEQEQEW33|dNWdxWþ)p>o/^%>_vP2LAYo|9׶LS>zeMck '4W_.QEQEQEQEQEQEQEQEQEQEQEQE`4QE7jQE6Foo5g.?e_"K WT"ĭ&HnBUmm64g=ZK?FomSi- :CTb`~+n7( yH?tSF8W4[[[kik VֶGAooJC 1*Q*(P*P(((+˾)p/7E_|kω<𷀴L@-C:i+ܑ (ۖPi_jZv_i[ۨ-c8뇝IG5ePz"_O +4_[yEWz_/q2 =sMMq]]z׆d4kͿ×4[ѹuJݤk{H" :o*ebrW5v[ {uꂊ(iU=TQE!Aؑz(O3_?Cԗ'|Sc6՛exK^(Oͳ>&voF_3zq?}ez?o, @.z1̟uqQ_} [4QEQEQEW;|2 3?Ko|S36|,@-?m?wk6_kӯ7\ #藬ODhm?++Ҫ{iv'(iF?(GPG֊((U ZHT<)O2"-?ZH񇃴{yN7gJ\P>^^ {'_^\[F q0u{ﳄ$)OኁE~עU(((+h~2oߊ?~ݪw, Z}ͳF%>^dߦxoQ ׶LxE':W);/2?EbQEQEQEQEQEQEQ]_1VS%7m}z|>=r1Vn31}*()][AWSiiޕpzfjug1Xj]F{G"8%D6 "02 +##QZ((((1? ?V6 Bm|Qy1p7Ln9ao+Y}" ,0^}B>K"5_.۩}ʷ4WyT(((((PozbPozb+?fM٧xM%ɜY_==6{5?JgѴͦXJO''-]lg(`Q^Zt(((+o?E~D~,~̞ ٷ&_|}}F=É "N%T*!o?W0lq{kg!=+T\N~?(宼2h(( (?]Q_|N#S|P xbxuA&$.!9#V÷~ۍ]N8ep}1 A؛|q[Ph+fEQEQEQEMO*W?^u\-΋Mhm#%$>;Xr\cSty>lTzS\\++() ~?EC۟}(au((((:o|d`_W}w?ULj'Fީ'Zf{MlxB/~@{ S4DkZW/!;5haK~1Q#vnY[}b-,qhoE{PyR#up&AQQрGlzQ_U|YQEQEQEW۟|[Q8x[Y"j] R玼V-ӐCvf' ZkUH5 aZ42@ccWYS"@ʹ1H,03mAcTzI(+f7~ 2?g=/µ>!F=0|WԬ!/}[˪'HޏI7px{I24:^>O4hvΞB&ouF.R1XcYyvRǫS=arI_5TQEQEQEQEQEWmvcqE|^΅O-~9֛—QG}4,7;WtxM ,F1۰L%}gWTTRQH@=ES z~GEuGZ((((()*2>ǯeQEQEQEQEQEQM**2{_8)QEQE€j?#?*(#{TҊ)(zEU1HxJ<#?h*H]BW2WEnQEQEQEQEQEQEQEQEWKI~ȟqը?/N:MQ_QEQEQEQEQEQEQERG|0|u#j+*O VEQEQE(*UP=ϯzQE((((N( (U@?RҊ)(((((U;}?QE((((׳O3m & /#IaC 0{y6?_ /xN}یZo9+q>}08"!98Wz5IEQEQEQE>sY?GoWZ?DE'#Ys^L\[A:Ko!a߆āw>qߠO} =6u+jL3E=| XROJ(U/QN(((() QEZj7d~_|G~_3Czivy/ ُ7.uhX7~ikٶ `[ mE / sԽ6qn˵lxnWٽ=G@􀯴N(((($o'J? =ǁF;Fam];TH{z)%6ߘ?hok?E-Zn~EeQزP9^z>WI_'Vm|0?6iҾYY.YYx~CB{Z>𷂼Akj%?d݃5߇^$6.ӣ {Y}-GAr` E ~}V5QEQEQEQEQE O_~QEH8QEQE~=$QR?_e?:(TtQES׏_ET@)h(((('QR?]_M_|+/f:-\ற\|oQ.t{x&2wԗ^炧]3R|5q.NdlՈb7FėYe붷fѓƏ?7O |c%|Ke2-_1_ZX; Xu;{=cD-^Q7S,-2Asnu<ّсI#pDᣑՔm++e!:hOԴQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW^ ‚ #ohv"?.;/ U⯅ \koxKَKbŏM7'' ssc`"7(\U>rGѾa+ʂ((pB}E! u?z*@{Š>W?SEȾ>5bB!S~%io!-/^[xD1/:Ə$KuV6zo]FN YT,b9#'ibmѻ)`x#؃EY_[^?g/v,_Og ARKgrKK=Ɓih81?hkDpxH[V4\8-%ydn xӇT#diT z +O?໿J^ -Zx 爯5?঳gw(4?Gx;WrU<3vf"fo״ 0Kivo  LVYwwN~X--&Hw!NF I u=gKJ_ۿrʮ誥i$iD2"u?/%g(o|ߴw-XF+Vm3+ sx+x³;mi?EguZiXA^i!Mϲ@T́ ~Z&l}IN_(ésOOُ+53 |cG6'62ay_Ki7M,A~ xt >Dj7C,qHZ8S꒷"=[oȀ?Z+o{߉+oG/!xV> NӤ.#tfvZ6a!Xljjz5w?{!k8ƃP8mğzauL((((z (tQE<(QKEQEQEQEQEQEQEP=)@'S~=E;g<*EuQEQEQEQEQEQEQEQz E袊p@=(EQEQEQEQEQEQEQEQEQE}R#E43QO @(cnIsEQEQE()rOES)h((f(c)?SZ(Q?_(: QEQEQEQEQEQEQEQEQEQEQEQEQE'')v7(w{QE.)TvEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE''Rc/KcRoORoOQE.?_}GQKz_/E.O=OQK}?SK}?SEmQ~<:];ǟE`zQE--QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWLc|kmȭK}U4|-qtKй+PO=mh͇?#gW_OQEQEQE?g _ =kxum?v!!wI*xolhXxBfem^xn_B&;z8|=0܎|'_!Z+䨢(((((((((((((((((((((((((((((((((((((Z?#wk qx}K?^qp_{w I/8TpKBc_x|=|3qt{B}Zugu95پXO>C_՚(((+>(>!xm/&E}{>( Y~LDjy7ƫP2t:t?I[;gk?T]֎Wm>vCW/E%%QEQEQEQEQEQEQEQEQEQEQEQEW?۳E1?2Y|C'IWOV"h_\O=jiz7j ~eZ_MrZ7ܰb(*$@qS$K=Nz+q|o7|u'/o xSF#-/o5t}^ 7ᗇ}݆H>Ū%/hOXxK:} ,a᭟1Uز[|#nĨ<($n~SA׊u/S$X˪Ǿ&|]]JB寵~R!| Y^w{yNWW72qu<9?4䞧d3z%rh#=_URmoOEW j%f13Q~O/.'$I|ZK?7:Enڦi|}?̇Nylw6v5NX$em#kfB@dLoy=1(}p?=8 G_%«<'#qX[|\' k|<կVE)?x+X XZ[[1-ac-H%W F Ē ]#~noWUEQEQEQ_կ?7ۛۋ&W_ w_">-Mҿ%#u{U-њUmDWSZ;bygV_ƊBκ(((+*/[Mim٧ⶻ> Gst\ͯxsN&#+ r9wm@ͣ_9}L栺]ӯs H@Z:((()T)?CE_S7'WmkijZA?eώ=cN]oˑm !o^'d͖֧*3`2ƺM!l%a2hvƵ((((}b> &#x[__ Mj{0aQGlӻ5vI~:m|=F}T5!Glgc#j+ ~|U\qߏTSJsE8zM(((((`&G\_N؟,k׿f_k;&<xo/$=TXLlrYI?> ppz|i+jj(((+oOŻKO'L8h}ooK_x7}{lfm"|~7PUj?ZەO xnS+;x)Ǘ T;߷|=udd%uضX*,T~+"EQEQEQ_‡79>3ڧDÖ0~ d@N߱ܒៗ?h>ԔR<-g.t>ΧGj+((((aAۏ?Ί(ʑ)(F4x[5$~˟/t-:I ~1]^/'FfH~$~aJc{U-.9 $'j,1'm 83K?/Z+v*((((+w|'jצ|YI/>Xg}_%tKw^GWkrTI|[cž&[Q&KqZO#g2\iR&rIgki-F%wbMTI` l{0O? hgy*ď>$~$84o.Ym(ȉ;ʠ^7}<oj@w-.^:r˅OWѡ/m[|-t#l'bᖟ׋aO@@b ;;xGW+ែ|;U<#OѢUEት ZYu=gQ{WTu]\viem N79T|dI#|ĚtWUuQE[ {|[(~ |PFk~ DrcM5_z ͸*rp]zF1oNT5Ugtgp˟}AjQEQEQE^sU?Vߋ"zw_1i*l̞O\| u%^]\ >ve(ݧ5~n ~_)h纼QEQEQH@=h QL)Σ)Ί*2L QE%QEQEQEQERQETeE((((((TczER:tQE%QEEFS׏֢au_k5#?GO;ZT'(aҊܢ((((((((/i?QE5m4_t(((((((() gW~`G;VT$}#E|A\2(r=x4QEJ(Z((((O=NU'8(p(((()Bh(?>QE-QEQEQEQJ< (/   {o[Bxap{ľ*2~/KFl@ wGM= c#W9^V((((_ u:mQ}PG= f)Ҽk;0Ky~%4pH|sa؅"s:Y-:F}xd9Q)S?~h(QEQEQEQEQEhTsQE:( ^[W-i~#潥\eh}jm,Z_麅LAq r,Mm47<3)q$r#UYXr)A 8 B(JGE[a|qxk7l_nqo|u==W<;O߇-ƾӵ(/6}U0U]$ Nm 5~a=J+((((,k_?߉( <clYfѦjz%ʹN5M6XӯĶz1 x6(H;dPp7G"A`# 4W~??bڇo"7>(;SR3[->Fi"ҼiZZHX5{x 2H] :^ϦI-QO";w$A"ݐ "#\h[|=;.VZ? f:?}yx4I;5ت;jHΪ6((() QEH(Z(P ET1ןnza|t߷^)$)('zE P=ϩ?z(EQEQEQEQEPxQEHQOQE-QEQ_M+] 'D6_~xǎE ᶊOxGq:w;jqZS7]ǂ k2 &p׺Mf(.aÌ*ʳB Mb ?)ʞzq} M-?a,/ϋk,>?>axkx&nܤrڥwxZkK׍DZ\ͣ^%ڐ2l }"H24X%ls8n7Nq=^SEQEQEQEQEQEQEQEQEQEQEQEQEQEQX>(W[ž5& 6rj牼Qia<[Yծ-4:,2S#syආK%/,ȑC$DQݙ Ԟh5~7e|%uEOg_ n/_|YgO\E/ ^k \coKqas_ |d=_ƒ2ql/QcQk@DwJ0W>`( G#pzf)S׏*^? W桄$fygsJ$Ջ{G-nn-Bteo֔3/*O$*+H;_ ~ݿ.ic~W@O=8PaŒH|ep%5H'>O*Qqp:O(c^RF ("emKbfS]anF IV$Txx:~e.{h QOKh~# Crn"^+_ɯxea ek"YծuZD>cK+}$o4WI$'>j:(((((() (QN((((((() xB})ӂן9}>((((((()@'QN{Ί(Q)QEQEQEQEQEQEQEQEQE(QE8!@hQ?O){h=?Z)4QE%QEQES1폯QNʊ(Q~<:((((=hpF>Z(#?QN QN((((((((((()pO@OERo)?SZ(ؾQE8:EREQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEOvCQE.E.ERg)|܏QK/;4QK}.?QKGaTv?Ί)p@.Z(((((((((((((((((((((((((ٟY>hqko 2|3f}&e5_|P!Yv蠻(U3y_ŝPl8z^sZ:[Qt?悊M:.z(((+~>9_#I`?Ùo$^7v#w˱Se}.sjf5 3Q8"6Bs"GO/W I H I"7HJ0 "; A=A}+%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWK_?9[xE<> |;vl|;f"NV %_28uU%/~''N/*[;]6q3gҢ(((> n5m'J xvoi XE8 3#$r9Kmt{ّ}e qU}PX~Q_i_WEQE&0=EWm_OE)6QE'<E“aQE&T[QE&0}EQEQEQEQEQ_[=/~5[ [^/~ghګx&@٠'pЉ8KnMD? Bqiϲ/F܇WQEQEQEQX%ka:?tMW'uNF%9|܂8'X$7EH~*H AAxŋ^ԼoZMǂU jP]OÚ|nI%qIunW6q%[:aᑣn;|ku(̧SPoAMc?QM*÷QM(+<=>&On{2՟O!+\@ >zYWEϗo h}'11|.^~_h>-`\ ~}^#'sX\6L{]u?u@Omֱ]&$~Q_v(((F;gefn.|m<y<&^Hqxwṉ[bFR< *m;S:b&9)Mfj9UWQ6ES LE(((X]wzm]_jVVVnnH-I#Ezr+; ,ʪYrH sΊk?<X 4> g' F1EGFˎJ&ZZڌb:b1o6@(άREQEQEQ_r[ 'W횯)|t8>_ؼLA:dWƍ7CM:Qc$yw)m+MS?wZn ER;~"*GoW9E6EQEQEQEhI` .|ַZC&_~OfIUZ+Bپ v,r:ܮZ {ϵoim{*~JҢ(((?;s%N߅m&ٻ}IwF<2HC`X_ e>W/aoskw s}VvVȂ+((((((ToQ_F s|7ի\޷ ~=ii5ė? |Y{ocw h8ӭ'2pǻsw,)UE-cpɺP%ThV6esp;_O't-մ{Þ#t{@t5 'Z5{8u +V^[k;QI )wՏ1KG<2$KxEJ:He A@ #AA RQEQEQEQEQEQEQEQEQEQE~ yo~woY\KII[K ß]y^_%ť_FcEihZO_03Fk[9QCDl.* -a¼pmup L X;zl__]+cmWUkvᆷwu-ڽ_t\N-!񞝨yGb_p4?|K| #2#6|F鸛:ߎMh.W>umMeKO3EueEQEQEQEQH@=h QL)Σ)Ί*2L QE%QEQEQEQERQ*2tQE2((((((x*2(J((b:~] _VJ<Qu!kJ,]E ~QEQEQEQEQEQEQEQE4q_DMZ( miE-QEQEQEQEQEQEQEWM$Po=ڿWϏ_;ƯY'+ iT?QEIEQEQEQEQET?*sT(((((;h(((((*ׁET+/>)l> ])x~~6}o}Ϸx-(ݽ6]1[u]&Mg۞rQ_}eW((((ZeiNm曪Y]iڅt7VWImwm* x%'MtYu +#) h>)|*/oPlng?]O?Mza0:W嶥fvi7Voi䁲=r5k2u(9T((()޿袊 p((((?(1 ^C_\zg6M< ~Wv}qEm}ZQEQEQEQEW|~Q~Di?=2hznqx V.7MLl|j>]|$;V|ҵrNu`yrm$f* {@u+}CӱQR~~(M^a*xZ'?h@um'rVm[|GDoO";"#Q'_}CW袊(((/A]~~KQGg|as#}+u"\ٿui G["k3ɩ]Lؘ{me}q_ǝ|Th( OOE(P=ϭQN((^=?TҢ,O_˵QIE(*@uQO((((()3׏nj((((((+CIu] Tӵ R4mkHԴ_Iӵ=/Q.lBHnm.#{[i Ib$Ua$O,R$,l#w+  A($AƊt2xa {j|x42_x[]IS:l:ҭOt.Zk)x/4բp~Vy#smr趷$ ъxW)3 _]2 2e#  A" JE-QEQEQEQEQEQEQEQEQUl-n/omhmmFk"cVYeu4Vw`FeUff 31U@f'$94Q__/ %eړ~:񅀕?^ dcß3KMxW;k ;UVxո w⏁>nk /s<^F`E$ p~Q_s~H׆ؓo|&|[ֆ\wO_WH[V>dOcFBj..66C <˫T sFMD??L(#OҊ[jOӮ'ď[.O浭;Zno |9ZG7!G1l%IzGi|sX0%izg $u&4rGFE|ۿ램 ӟ뢤=E-(('^(ES()=ڊ(ESA(((((((z (_z(QKEQEQEQEQEQEQER'8)=?w9?Ҟw9?Ҋ)b((((((((=hxCߏtQE8 _ES袊((((((((pV=>($S~O*)@E4>)'QEQER')s֊(Q)QEQEQES폯z(#?pUES(((((((((((pV=?(=ES/>آ)EQEQEQEQEQEQEQEQEQEQEQEQEQEQE'&E;kz*]aR> (s?Ɨ(ؾ~1E?*]?*(((((((((((((((((((((((((0OA(F(kEEQ?QER> (~ERgEW_K???7%J&ҵ|];%@+IIfO/_Ợvk61!-?AQYmP75@~v__{_EQEQEQEQEG~ Է6~4xInm#@خ6^1Ygx_ mF(O-ܾIѢ(؊We,}7?LQ_&l_O`Q}?S4QE?EQ}?S4QE?EQ}?S4QE?EQ}?S4QE?EQ}?S4QE?EQ}?S4QE?EQ}?S4QE& (EQz(6SQIQG袊<ERb??Ɗ(aQEl> (cz~h67?Ɗ(އ(?)((((((((((?ωiro7> L gKׅIqٿs7} $ӉW>{篟?<ohΞ?AEW5EQEQEQE`xzg/OkQy? cz85:L 2TyTS—o s$2T 8U AAx^x+ZO+Y5 e?wZMmov]ZJ[WUmq=[,G6ҚXfSI 4QEQEQEQEQEQEQEQzрzE4*B{bv/Ry~ExGZYxZMW2_puVFaF$:WM ~HoLp \ɂ]'~h&(((+ehu_~nš=D$$T[@ [ XҖcۆWg$|E|vduf[HrxrFquL:1Ѳ}Z{UE4*((?bl_W\}cƗ؇K?jz36@=Ιowmr I7{ ;E\w  e>x_O0++6*((((+ QO?nO-- x&ķ(jGv )-3lGF |MmW* |mvcޮ˩4f>EQEQF3ESJ)QEg¦O?1|6m[43JaI:/%_ `}{|s tB4PzbO^٭-)nd4W[UQEQEQEQX>) xZ_hѼSՠfiaSZJ0#E<)q j>?E1omw7h.86J!'4c7z&̓[(fei^B1HA?6TƊ#j(()QM(;qΊ(a?O(T ~Ɵ ɵ gׁC[1Oí@|G0A$_YT< c> $mf}mC^{u*Ūy/Q___QEQEQEQEQ_-~?~ƟOh~{;| kuv<6:i >oT8&|;iw5[F1k*ye(E"yGԂEe~uW'E!Pzǽ!PzǽS zSTQL AERRQEg_g_n7Y7 F||M FOcp>oن?"Ci?g"}y}OUFAЅWEQEQEQE~<}F~ٚ,V}< ᯉ2*og?xT5Y-C;c$.Z Xo_]"X[k0PB(BGu]s4S ?TQE2((((((( h10Ic%g?%i.|'v;Nʖ  }Zr?l) hir7 jOgbُ!6Z(Jp#sރx ]]C+) 22 A9W]zVQEQEQEQEQEQEQEQE~\;z?udum)~ zOd|ft $^Ic{Xt4źGA&KX-G2GF[r)q:d\܂1lոW! F{p1ϩ+?h/a>=Sjz(DX4Eӡ esB /Atm'L#gRujOw}w&e~$X*b;]X?zQ\o ~*he -Ʃi#H9Fzl;_NW$oϛcymy8>e2`;R#luaYX~E_i_Ѽew>=3Ě^'<iqk0jZ}mcL`ur68;HgִXc8e&K{Uh@De k.dFrHzE|? G7{[x1|0\=kIe[n2H8/(?y(d+,LږO:|7@8HMsneO :>'ٟLkv ;} W\k߈~9k x5y0$n_}ۅ:֢0YCDחV>>P.?"(ίy$aXd׾'oir9 xS;{3~6l<_~Ǖ|-ڦ~^.ԇ@?10To>E_x$j~񝯊 ׬|=O Ě|U_uyieiV70i- co)w6Piڕkimx(.Vq*C4< Nc38ʊ=ΡYPw :{J+h:ZEFAh(((((BAaOOʣ)QEGQEQEQEQEQEQE4=>QEFTqzE(((((()Ί(( _VJ#g?iRW0 ttQEQEQEQEQEQEQEQE54_'uj(7CF-ӎEWEQEQEQEQEQEQEQ_4I?|0|u#j+*O% \2uQEQEQEQJ=)@'T@50P>Sh(((zQRE((((3*PuQE>(( !7?S<;-4?|ohτXޯொ6do| m{zl{%6څH%Vaz+7Oj+r~?ʊMh((((|-=l"-ʚǭ{dPؾWƭ7I̞QEJsES((((i5Օͽwvukuk,][\"ż2ʋ$R$r"2He!H<9QE/ !m>|J/k̺ x_N5{pQŧįMxϊuh6&C\l]f6b.Fynm;Ц|y[;#`kjj(((+ڻr7w6j>#¯gCmLV 6ADiH}Vʡ#_ѭ|Ez%Ͷg50 8e9HԞPz0 uW5aj4sI>(Ho>.O$q5&e;2[Vvۢd(]h^׬fi:ͅHʓ28]Yx90ZHHHˊ+en4QEQEQEW@ƿo`?jӣ|8weυZod/f(Ȯ}GG6UEdzt\o,Yk^kN 3E~OJگEJ/QO(('w(?>b}E(< ( ֊(((((((xBz?_QRA)h((((P )@'xAߟo֩T(((fo*=K /X-8mlmk>ހG$gQL=fxt"m cm.evڮG@K03<g?}A>G⏄4p5M2 Ca#fbʻ=KK|Ql5]+Iq""=Ͱ'EqVQ}GR!E~|3d^+\g  wݸb>"վ K=%dlF{/+5F?{rߪOb=ڬ./$~$|`xe dO|[Vcrɜ7,9ou <"Kbqi#К_[F^_F^?2-> ~z7CTdKbOKq-Wc!ؿjs2$`3f= -O.0qJo_"쳑'W-Jǽ4i?+ڿL x[G{ -_@iL3x⇇ h8GMHO\B{QB;}E_/WI\.7ۖɴB;!<Iylq!yv?GE~*|~lOڞY~5]ap(((((((4f)~?=?֊)@RSh(((((((ox)E(((((((((l}h,SE8 sϥ(cN?RM((pF=9)1TQE<()h(()=QN{?Z(G֊(`QEQEQEQEQEQEQEQEQEQEQE((4QE;_ESES(((((((((((((v=mc:(}vj(rӼܟ4QNؾؾ\ARzʊ)ih(((((((((((((((((((F(ޟʊ(f(=ER~^(=OQEOb(ؾ(hQFZ((((((((( oQλGմoK\tog x x#I MĐȒx:4:sE'i'>ߌ4HmZ! 9K[k |5ye!Xt`Eu=-QEQEQE^qW?VVVh-ͥE]3J]|H~xR^? ĒP9bYپ*e?k x7_6)>s\o$*?4WyP(((((((((((((((((((((((((((((~B(j*(b~hMEQ?)<ERl> (c}Q_{(O #]o٣Vvľ Q(`ὯUF8[*6!?h=3ZCt?YOEm}k]QEQEQEQEGV?FGnjb[h#h8H]v0,d'q3Ƕ_`mk\"cF(_`+MSO38Ш 䪵QEQEQEQEQEQEQEQEQEQEQE'O*쑡_ً3~3+F?gǾ9ܯ}K@6`T5z4j~9ceĚ/ 8®];).mJம(((!Rjex3xy1]^\h=FU{~!B.8;aB3/fbbb;m v38p?şHG:+na?Mñʊ))(((((]з?J֗ͧi>M"C\[BI~(%9H̛Dx#Wmźp0Eps.d]@[pXi_D4oqHx&^GL_Ɗ%* ((=Fh@!`CRAb zQӥW3?Əٯ{'_|)yh>%y gظ< E~跿Z>w޿il҃hr:}QEQEQEi?tg/@)PSG|и[4+SC$:XR~'__eQ4xƒi@=Smo7אmQEQEQEQE= { ɮ>O|}t_b[uV>Fx]=< q.A}{o gh:7`'%g5jɶ]@颯WWQEQEQEQEQ_i|XlMZ[h5KCŴZ?R׮m#O,kkmG.0;t`o8F6]ν?x??F8QEQM*>i֢)H?)((4l~ ߕ|{?K6}Ɵ :Sl'hbՄk(op O]MWI#\u͜\|[ ߠ5>ۇNFqG;F:((()@ # #+?ൿ>>(Ld33Qsnuu?m$PbKԼ5ohQk-/*UDSMw4ٚO@so*N-"y zm'9E~IU((((( *5mwo:4xWK#qeM)VBz~gy'$vn>fIouD>$cLqH7rnQFuN睇lC~A++f(((((w(?+,_|DG4/k^mt(P@?g 6=wM۵l}B0+VF_HRt?'(((PoSJ ( q|cGǓƟ:ڷM->/EdIR<`tT]vl{m OLԬ}3$@?G 5܁u)Zծ(((ڏ3~ Xg f3j?;IB9Yz.rn%H}?.H  WrTRQE֊(?֊(ʑ~=J((((($975Gd#>p 4xvG f+WN_X:9X&q^ɪa!Y# 'x:-KxK[M*q kmAK#j=?0~R/د-u٣ׂm?7ף?=uφ TB՞} M/Y-\7񗆼SɢRlM8o6]  ua[ۣqz+*Z((((+ u zuw٧ᦑccRb῅WV\^HRu]WNtd}ڵM<|F|jWUA0p8ܯs:QEFTESh((((B(O F`"9K??9G}N,kE~GEQEQEQEQEQEQEQEQ_/_#W'E"V(t?jhk84QEKTQEQEQEQEQEQEQE,SP =ڿWϏk_;ƯY'+iQEQEQES3~LxTcRQEQEQEQES ?QRJ(((((*=֊(@QKEQN Oӹ$MT@51=8W)+sT9 䐶d٢k.rYNj</7<'qfR)t-'@E~QEQEQEQEcvAખ5df;Sj~82B6 ʖq +*b` zEH_ETQEQEQEQEQE(Rz~}BE(P=ϭJsEuW9B/&<9j2/ωW{;x>(ԦFT<,Z~3OŐu/VnlG }w1HBksp%VZɂ~W^3hUkZ((((/4 xOA|QMr-?Etk\;`6 Bf+kKyMI 3\JA+QG=#@{*OaJbI $94WJh4ƞ}VK- =gxQ@M;ƶ^ YJn]ޣ[htKfߪHR}P \qC]KDAfE~I?d Cc{C?1kr~Ӽ1pd⫫TF6>(nf* mǪi: /'*:eg^>hGB$ϢW oTP 9'j|QU:7iVg'_K<Z{noܭ3,jյN)|DWaB g)n t?&_n0ҽay\Vyē یA`qy>B5Fՠk]WYu;gO- `t I m*F8Ld_DOPmE)#(($-W ~6B Oq$pH—^穸. eĚƼ+?tխmRϿcg6}&_4Z+7Pa߈څ;9UΟ__ZbsjpJ$$|{)/ AGidZ }&P?qP_c.=N94vɍ#?+?ޯ({mxM %L㯀S6i]x͍4&$/4}'!I/ֹU6ݖ#~CgE<3؏Ǐ&) 7QE!VTQE&1EQEQEQEQEQEQEQEQEWC-sۘh.xF&/_ QH.@;u'{{Q/5;2-tIQOd GcZ:yо(((:;\Կट v7d_VrI}CVq8̔^r[D]|VY?,:/{HO(sW9ABɟQ_=xeQEQ]ׁ|L}׎!^b-_#&c `mc{|,8mo-glH?9Q*? o>>;%"o=n')/>-apC,"C(AǍxgSM4BM=VR@C+E~|3X>8;?N#yt<ȉ¯ EFBG uV|isq]_Xz,`R}3X&t{ˏ$ぇ(пgljg5?ۃB7z'?oKox>B/.wc&;[Q4i謴֓>g,}MgUя>RABN }?iP^7<9>dEGV Ywlh;_<oocruoo %L3 a4eW=GhBO$g߱ýz!xO4du7#xqVR:@,4W}wn(((}eiY^iڅ7WZ]D\OC<2~? ]yiC_ OxZbQEQEQEQEQ]W<]|?ǃ|y1Mc>+ P^Y` BVQ=][]Gxn#<2,oG4m:+(޿ú4iΏMK\iŌ%AG#T(hX"CPA>+j(((/?~mfSI>x+_e?.u/͖bil|)xܒEBƥ@Oè*=[Kqfg"X#$8գpH?)MWc?ū.iV.hmQEQEQE!tQE4q?EsOC?_3CO+3ÿݟ|H!|GDl\,-]uSAՙEi[g;}]fzzk'q ,v:MV 9pE~WaE-QEQEQEQ_U&gO)}ķ6~鯼S'✖q7k-C=n<-ti0ævњ.+~ ܼ]RMP ߙw1T xsn<0j+iًşh?j ޝFd6I%M;Ğ4}{K{ؖHđAso:։{QJdl28H &P XV G7$OJ=:((+3 Yd<5[-Y_0iZ'$:\sxgᅵD9Z JwBџO5E/ÍgƗQȱc z~x,U.nHCN˔I.[YpY=O w}]1_ xGxs, 乾5KUTR\sc[o+kV:&ii-+ N,yyer#|Jrƺ$EaT`ܞIyiQEQEQEQEQEWxU[>9ZJ?_lGF]#`ymMy+?%|GOIQ#;fmgbH\nuGhZEQEQEQE~#~' >6{Z#Z}k|I!o\LݭY}-2L =bٳv,'^bѶ颯i u]EQEQEQEQE3R7YmolCo/&hWM`{ybpa_~'jk:ˆdZ0W)2T1+*è(((QEFP?ESh(((ꚞk.jmWv\i$Hmnap)9cpH;"0d6(2 ҂A$Ўhտ]*kg/m#4]+uZ?CZDip.+⏏4uXEyP@⬥}%,='4WO?)'G+NJ|CR}/CfKΉnc@1@QKo2X]/b0)ϴ_V8xЕeXn0q-ſ˨wcmi!GA#í\?/oR5ȼSSeqEx*gX~̿ X]/ ?eAd{?&`ʻ㛀D)Xz50MRG6pz褟y1:bয়}݇?O\6k<5[L=߄ZmRȫm6' ̬S/}MHUӡu?k5]di>?4\5\\K$4,M+%id,K#<;3f$k$,Ė$I$NI$IdIjʷ &-qyi^%0Iic969jznj)֗n#q=vXpk MNR"--אַm]—7E42$u`{B:Ȫ]rXpA{VjEQEQEQE z?nҾ9|-6ɻwm*#gبo1|LXb_ ꊿy5[ <\G^3x"?6|YS((((SƤT/񢊒(((V7 3 cJƻB~̣G;\=9/|~gԼoOݔ -}wxN4?/MԷ6d?o9'P!I^Zض͌doSE~׫Պ(((((((+(P?z+>>1j?,ΟD6Mldi"/j!I m%Ka1vs9HcvV?8hJ¢('?Zap:rOT$4QE%_*@}}J(EQEQEQEQEROA*@u(EQEQEQEQEQES{w?Hۿ袤 tZ(((((zǵQR?x)QEQEQEQEQEQE(j($T(~g?E0z()@'*@>ESA((zQEETQEQEQEQEQEQEQE(j(wxt)h(((((P 3J=h_i=OƊ)@?tz(((((((PQE/:XKetoI$' !Y~ ^A;S,TH߁&O>EwO?EEUuEQEQEQE w3%|  W&$x C\ٓ/D?S&b!_sQ_|\`E`Emc/E&@@hޟ(񢌏Q(ޟ(񢌏Q(ޟ(&'J~vBj婭\jJ?4#:$е+cƾ4E,7Z)*v=_u:hCtLoc3EZ ſZ=.ri9UEwYͼg@bKrY5+X,uKǃ6R~\LȾSQǗ/iOc^Q_cj~_ Q-Fx*oH./|+9< Ñ\!WF:D.mZ.jc$ί]E^'-闵 fFxܤ,14q*9r aʸSz@4WuQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWm¯ >#^&i29.I=;Xu :Go]E1?T,N?DoW-++(e!ee )rE~iE-QEQEQEQ_bόq[wJ'SqdR~oݕkg_[o9>4 dF-e~h]O((((=@?QI}?QI{Š(ERloj(kQEb(( "ˬk#EE;G!c7Nk >Kz1ʶa\cWM_MVQEQEQEi ~R?kG~5]~xcwN[GO1tIm Z|r$>0c+F_g6ц3,e)sFL1M퟿מem23_hizVXz6ai]`GoiiVI;cW=DH$h*"UT0pӨ(((((((((_ k_VcAaP* u;េ$K-=.&v#9$koViD^Z1Zv'=mՕV?4W}pN((D4g%_O?<_Nj-n?ixNm<76`K3=Flp݆tfcq}qi f^+~ET4W^ZQEQEQEWh3A&;]Lxr ߀wj/d=;m8Vݒەxǫ/?š}ZZ1݆7fKqYZf[J+x=sSJqESL~){(n1EQEW(>*Ɵ&G܋ۻ᷆uψV U O>f+yl!k kmV,mECz twV[DRxr@.96F*)ae"B=Gy+}zuwGJW #/Ï |a{%v,mt[xRPt* C5~zD3i!,'";;}Gn{]8: 14JWQ?F4W/3wI~!C5g}#FS~0܌GeU$RwVW'u#lwnҚ4)E~_mq4 UHxLmW,+ТBB~kIýVb;/xcĢ(«M,~D7}i,g'Bd1ȤYlam!;х_6wItZnhVn6fiq,vnev6V"Cmkk PA,qFQ8"4(R8UHETDPU@U@ `QEQ^iKWu߂$xc^%ru+^W|=J-oxF1$