JFIF,,AdobedExifMM*;JiP  >User0404 2014:05:13 14:55:352014:05:13 14:55:35UserICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ 2014-05-13T14:55:35.044User C   %# , #&')*)-0-(0%()( WvCMYK }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzCMYK?^Yz{hׄ|ToS/.UWX X<ާ^\xy^K /x_6O_Nnrwu[j_ѠK'?_Ə;4tK=Nnwu[iDG(Owu[hӿۯKK=4l:??_ƔM'҉d?_Ə;4tK=Nnwu[iDG/'Nnwu[h}}:??_Ɯ%z?i|?ߝwu[hӿۯK=4Y?ߝwu[hӿۯJ%z?i|?ߝwu[hӿۯG'}:??_Ɲ=4 d~tioNnY?f$G?ӄG?_Ə;4yGc}:??_Ɯ%z?GoΏ;4iod҉?_Ə;4 d~tG~tioNn8K'?Nnwu[iD}:_1ߝwu[hӿۯK?Nnwu[hG~tioNn8K'G???_Ə;4c}:<~tioNn(ߝ(ߝwu[hӿۯN?yӿۯG<~t ?_Ə;4c}:_1ߝwu[hӿۯJ$J$G?c}:??_ƔHo΁#}:??_Ɯ$K?Nnwu[h?Nnwu[iDCNnwu[i|~tӿۯGQ#}:Nnwu[i|~t?_Ə;4G~t?_Ə;4c}:PӿۯGQ#}:]ӿۯG_1ߝ?_Ə;4o7G?ѽߝ.~tioNn;{y:PӿۯG?wu[hӿۯNoΗ{xtioNnoΏ;4iooo7J:??_ƕ]{xtioNn.~tNnwu[iC?wu[hӿۯKߝ.ӿۯG]҇oΏ;4io?(vӿۯGPoΏ;4io{xtNnwu[i3xtioNn?wu[hӿۯN?.ӿۯG7J:??_Ɲ:]?_Ə;4oΔ3zΏ;4io?.?wu[hӿۯJ:P:??_ƗsxttioNn(fC7ӿۯGpf?tioNntNnwu[itNnwu[iw7}Mwu[hӿۯ@f?;q4ioNn.?Nnwu[iCSN }Mwu[hӿۯK2}Mwu[hӿۯJ2}Mwu[hӿۯKp'?_Ə;44ioNn.O??_Ɣh4ioNn.O4ioNn.O??_ƀO}Mwu[hӿۯN2}Mwu[hӿۯJ 4d??_Ɨ'?_Ə;4>G?҂}iZ??_ƔFOwu[hӿۯKKG?҂}hӿۯGPO(4ioNn(&4ioNn.h;4io.hӿۯG;4io-wu[hӿۯJ (Nnwu[iԴioNnQ?_Ə;4ioNn8t;4iohӿۯGJJ??_ƐQ?_Ə;4RQ?_Ə;4HhӿۯGLf;4ioL?_Ə;4??_ƚM&hӿۯGLG?Iwu[hӿۯIIG?dINnwu[i >Owu[hӿۯHI'֏;4io?_Ə;4>Z??_Ɠ'I4ioNn!'I>;4io}M>;4io'r}Mwu[hӿۯIh$??_ƐiSG?}M>;4io4>;4io}M>;4io,}M!'?_Ə;4>;4io}MNnwu[i7SI??_Ɛ?!chӿۯG77黏Nnwu[i77,}Mwu[hӿۯM,ާާNnwu[i77ާNnwu[i 7IOG?ѹ:n?wu[hӿۯM,?tioNn&77ӿۯGBoΏ;4iosxtNnwu[i?wu[hӿۯI: 7G?oΓsxtioNn?wu[hӿۯI:B?_Ə;4.?wu[hӿۯH]:M?_Ə;4?wu[hӿۯI:B?_Ə;4폼:7G?w.?wu[hӿۯH]ߝ&ӿۯG7?wu[hӿۯIߝ!vӿۯGB Nnwu[ioo7G?ѽߝ&~tioNn&~to7G?7Iߝwu[hӿۯHd7Iߝwu[hӿۯI?.oΏ;4ioo7G?]ߝwu[hӿۯGoΛߝwu[hӿۯM7G?y7Nnwu[h2?oΏ;4ioyӿۯGO1ߝ'oΏ;4io2?2?Nnwu[i<~tyӿۯGC#}:C#}:??_Ə1ߝ!ߝwu[hӿۯM2?2?Nnwu[i<~tc}:??_ƐoΏ1ߝwu[hӿۯGoΛ?Nnwu[ic}:O1ߝwu[hӿۯI?2?Nnwu[i }:<~tioNnloΓG?y}:C#}:??_Ɛ'2?Nnwu[i }:O1ߝwu[hӿۯM2?_Ə;4yG<~tioNn7͓z?HdG?ez?M2?Nnwu[iY?ty}:??_Ə6O''Nnwu[i+Ro?{כk?#T땮VQEQJ)EQKEJ()E-Q@pZQE(ZQEQE8REQNQE-(QJ(R(QKJ(R(QKKEQEQE8SEQ@QKNQ@pZ(R(QE(QE--RZ(QJ)hQE((u(8QE8QERE:QE*ZQE(ZQE(QEQKJ(RE(ZQEQE(QE:)EQJ)ERZ(QJ(((QE( ()EQKNQJ)hQE()iQK@QNQJ(p)hQE(QNQE-R(SSQE(ZZ()ihR(QJ()åQAE%%RJ(EAJJ(4QE!iJ RJ()(4)(mQIHhMR()) RiCERRQE%QHi RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii(E%) %RJ(4QIIEE(4QIIEE))(i RRQEE%)h(4QE%%RRQE6E))(EhQE4ERQE6EE4QEQM4QA4QM4QE)QA4QIIE)QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKEQEQN)ihRE ( Z(QJ)hZ(QJ)ES-QKEERҊ()E(QKE)E(QKEQKEP)ES:)hQKKE QE( ( Z()E(ZuRRE(ZQE)iER(Z(R(SSQE-SERZZ(QJ(ZZ(QJ)Š)EQKKE)E-RZ(QKERQES(QKKEQE(ZZ()hQNZRpZ(QEE)iER(E (E( Z()iERQEKERE-)E8QE8QER(QJ()E(ZZ()ih:QE RRQE!)QM4(CIER(J(E!)(HhHhi(J(E) 4E!))(E!(4QE%%RQEE!E%))((E(J() %RShh) !JCE)) R(E(MSMQIMJ R7JJ((4QE(E!((mRPhQE!JCEQHh4QIMJCEQHh4QHi()E%%Pi RPhi))(ERRQE%%Si Pi()(4QHi) %SMQE%Si Pi SM%QIECECEIEPhIECEQIHhIEkucuK,똯G|%^)k_7 ׊Z_ cB׿#_ |W +Ro?{כk?#T땮VQEQJ)EQKEJ()E-Q@pZQE(ZQEQE8REQNQE-(QJ(R(QKJ(R(QKKEQEQE8SEQ@QKNQ@pZ(R(QE(QE--RZ(QJ)hQE((u(8QE8QERE:QE*ZQE(ZQE(QEQKJ(RE(ZQEQE(QE:)EQJ)ERZ(QJ(((QE( ()EQKNQJ)hQE()iQK@QNQJ(p)hQE(QNQE-R(SSQE(ZZ()ihR(QJ()åQAE%%RJ(EAJJ(4QE!iJ RJ()(4)(mQIHhMR()) RiCERRQE%QHi RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii(E%) %RJ(4QIIEE(4QIIEE))(i RRQEE%)h(4QE%%RRQE6E))(EhQE4ERQE6EE4QEQM4QA4QM4QE)QA4QIIE)QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKEQEQN)ihRE ( Z(QJ)hZ(QJ)ES-QKEERҊ()E(QKE)E(QKEQKEP)ES:)hQKKE QE( ( Z()E(ZuRRE(ZQE)iER(Z(R(SSQE-SERZZ(QJ(ZZ(QJ)Š)EQKKE)E-RZ(QKERQES(QKKEQE(ZZ()hQNZRpZ(QEE)iER(E (E( Z()iERQEKERE-)E8QE8QER(QJ()E(ZZ()ih:QE RRQE!)QM4(CIER(J(E!)(HhHhi(J(E) 4E!))(E!(4QE%%RQEE!E%))((E(J() %RShh) !JCE)) R(E(MSMQIMJ R7JJ((4QE(E!((mRPhQE!JCEQHh4QIMJCEQHh4QHi()E%%Pi RPhi))(ERRQE%%Si Pi()(4QHi) %SMQE%Si Pi SM%QIECECEIEPhIECEQIHhIEkucuK,똯G|%^)k_7 ׊Z_ cB׿#_ |W +Ro?{כk?#T땮VQEQJ)EQKEJ()E-Q@pZQE(ZQEQE8REQNQE-(QJ(R(QKJ(R(QKKEQEQE8SEQ@QKNQ@pZ(R(QE(QE--RZ(QJ)hQE((u(8QE8QERE:QE*ZQE(ZQE(QEQKJ(RE(ZQEQE(QE:)EQJ)ERZ(QJ(((QE( ()EQKNQJ)hX85X|2eoyem^{[XKf*! ^7,,-kql]d0>ԫd!SxkZMuj_&O7K? ʥu7*>ְO+Q)(QEKERE-9UIvAu B9o u %r;κOx#7jf[xK`+~tFa Z}BZ}BNG*oУ+Q (_ lo+9$R) H)WRUGjJ6J)Š)Š(QE--RP V?4o`=%2"7 . S}+c7Qֿc7QֿOd GZVQ (_ ¦ :5R5)4j{/U}Ac]ѵ-RO֬N]AJJϬCIEShh4QI@? |eI4/n.$QGB#^-DBED~) i=z^,@Fkg(D4?KQZo?;~_i% rQd|E1>YG[Ų/eKF?N-KZhãi&0\Ϩf^L\([GV}G7e@&2\SYv쮥YN#Yԫ)`Mi(4)(mxF7iX]_]7Hmi F7iX]_]7Hmi N$.{c^5dWKӣnC^ܪWsWh?MYې׷*UZ_7u߲YGڵ6悺oG,ZzGAN+xPm [C#zI'U?f״YO5覃jݘSAS]"iHk"MʱrJFxt]IlU௵*6vj&N ז:6MgObo^[ڞxm5>u#BTޘjP()(CHhhEQHi QMJ SM%RQE))QHh4QIIEE%!CIE) QIMJ Pi)(E%)%Si R(mRPhMSMQE6)(4QHi(QE%!JJ(4(E%!JJ(4(4QIIEHh(4)(4QM4EQA))()(4QIIE(4E)()(4)(m! !i(4QM !JJ(4QM 5E1ץ{@Wo#/H?zc\y!k+Ro?{_x7=͵ ğu+T(ZZ((pQKKE(QE8RE-(QKERE-(QJ()hZ( (QE(QJ)ERZ(QJ)ERZ(Z(J()QK@ZZ(R(QE(QE8RE-QJ)ERӨP()E-RҊ(QKJ(QERE:QE(()hJ(zE-(QERE-(QNQJ(ZZ(QJ)hRE-(Z(R(E@ZZ()E-RE(QKERuR(SRE( (|6̾1΍m¬V!H߂56̾1΍m¬V!H߂5$IHkLp+8bP0@һh" tXB"(UµG*J(:lE~z;➭k {,oָ$$~z;➭k {,oָ$$g&Ɉy^k^kLQE8REQKS7%g)GٵkɈ"<\rO|QmsZb;ȅ'1>WܩS_Ƨ뺱EQUs_wClqel{? 3je8.Kc>UiFMUTNQNQE)ihT03-$ʛ.<q=1!kُ?|"LSΡ7?O֦AVV(O=Qb}z|X<^QOxz.B4y8"Sk* )V?g7?g7uZQEPkKn\-R_[襠W׏M%QIZ>u6Vk%$OrIxYҴkY.dQ'R}OO zӂC?0 ZU4<?@}! g^bҮ >` )h(((*~|#[\$/EPmml d+&*oko`c$PM:񚊐EE4SGTE,p }9uDR@'QRyʾ=5O`=.3Wտ>oRc> ـx\VJ*h/T7<=kO[MGA]ՏV>&燴 ici}# F)kR)h(()C 0Vo4'Z{u;À}FzqfA|EZ78g2`[c*wPϫ|=in"P^M*V ɏ-Г|h{(gվ(/&+ndǖtIOi/ʪX)9QD%YX`AR󟠯b o|Ys#B>`ϻWԿO>,}ԑG !Agݪ}?AVQEQET7K WϟGg+hs˶R& }@Z|<#{?[G]90H@?e.b( Z()iѝ t  'PxRh#IZ<*^'#!?&Yh̫xb"y{{t{*:Nk| ^:i5r3-Eq޽<5FZW.2۰)4_!=xYsNuQEVp.G|P|Z|_`/_up?;Vuku2_[ƿ}G_p3V uJ9jQHi RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii(E%) %RJ(4QIIEE(4QIIEE))(i RRQEE%)h(4QE%%RRQE6E))(EhQE4ERQE6EE4QEQM4QA4QM4QE)QA4QIIE)QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKEQEQN)ihRE ( Z(QJ)hZ(QJ)ES-QKEERҊ()E(QKE)E(QKEQKEP)ES:)hQKKE QE( ( Z()E(ZuRRE(ZQE)iER(Z(R(SSQE-SERZZ(QJ(ZZ(QJ)Š)EQKKE)E-RZ(QKERQES(QKKEQE(ZZ()hQNZRpZ(QE֝4*F d{ thHv *I)GZԉ6F/ &'wgHW/ &'wgHV)īuW[]m>=\+$̞ ,}'p㘓2x,|3=O껪}dzV_KQ) Jt;*7^YH86j6sZ=ՍۿǨ5mþ!Դ{~8%N2=Qk5zIYJ)hZ(QJ*-1~~>(&ɾNOs?J>i-,t1(S\F=שWSeH[⏆Njk&[7үk4V紫FZG+U`U`_#)’()ER澉3mO&a\+b hxSɘt*"G##*H$ԕ]}RQQ]Eik5ˈI*O*+-fqI#EP2IΦ3+f.>)GZZZuQE E-|Xm녿Z %xx4RN(QN?i4@XbP=JC3L+u/QZE# _ŷhd ֭p-D8eig8 c^+Yx? LծH m,>~ip|+_ t))(4^6du9VS4^6du9VS4uq=̷sI=Ĭ^IebzO$'i',YRI)**HhNw?=z$8MBMKXed ;jٳI㟈p>ҰA#?7$w SsUTQE_b?>(5xs뷡ݺ u\;R<}v2Y[A?+sDsH#_sҪ1$kwX5ZSn弾mM+d|\jzܷ IlLKL5YERP85kz5w9l=kz5w9l=+ v D_yo'Í y=%AO~)I}Gd@IPtvS[#eMZ6&G8| 54c )kԌx$O=F(mުO'X~"?#}z >,vLaF8_WZ(^3qtDI^3qtDIJ:-~Ө(5_c%W)kKn\-Ri+馒UՇPsNF*è9_ͬ3sO#"SmgKXg9P:PFE:Exsk4MIRF$T=^!\Z? "aynEԑ0*l>dZ:CEIE(4QE%Si Pj# ZG ԤMzrԔA_t~]\ZYXZ>3 ϭ>GXўF f'ZIcFy*(%=hr6'j9ySo0١v,}/ψy@ycƨܞݩ3M4QHhJJ(D$zL֣f2?v- bwL֣f2?v- bw|OzЯeIIauxC+)`yW2Фn0<+J}>7BOuW #Mz4t|vH>!⿵]U>nѦ[ s哲A ܪ{5Bk4(4(E%%RCEShEIEQE!JmR RRQE!4QIHhQE%!CERShEii))QIAFIECE(E(4EEQMJ RJ(4QIHh) ))QIHh) ) %RRQE4( !J SM4E%%PhJJ(m! %RRQE%) 4E!i(m! !i)(HhHhi( Si(Hh)) Si(MnQLn~%s/H?~;/O^1^Zk/Tca*^1zmoC7'jr1J()E()h)ERE((QNQKJ(REQKJ(R( Z()Š(QJ)ERQE)iERQE)ih(R( uR(()iQJ(QNQKERQE( (QKE)E-RҊ(QEQNQ@ ( (Z(R(^QKJ(QEQKJ(SR()iERZ(QKJ(((QE8P()E(QKEQJ)EREE (EQE()kB6Ÿjs>'ùSyHAUw"%mn=zb9GAժ{{YdL{yE>k7I~o2 7¼O" wz`tpQ\X< ϯjlۢZW$ MךC ryڠaQS_{^*=IHca.O;Tl*>kFB=G-zzKLwFG~߄3_Ge'͏'ݗr~=G?{OZ2|p=w/ :oER"(ZQEi<_hKܤG?2++ \{5_r?z[;;o- q$"FR2 ~yiճ Hz2Gj-KEG0ϟh^&>{ic吟`C|lxg4/@=cpsO!p F+zQE2q[^ Ц?4"K?I?mx3B,4K|/cp'od2@+8-mGQ誣~BM,pA0*z*jkulixOt}崸bF1O?>am?D }c@|IKEkf.>+f.>)GZZZuQE E-|Xm녿Z %xx4QEȯЯqxN(5Bsxk~5;/|)ѥX].yoƜ9WWQEQHT߉_b]t=YLhN;(4E(JCE۶Wۊ xzy_t)3yLQЯ]m燧Om=G Ѷm/%zUzUKHr1Y~*\ƯH[ImBֲU_J֒#1YUARA0*H 8 14E(CHhmRPhi((4QIMCAJJ(4)) RJ(4QHhJmRPhM4QM4QE%6)(4QH)(HhEShEhh)QIACIE)) RRQE!E%6)) RRQE!E!JJ(CEQA4QIAi( QIIEQM4QAJJ(E!(4QM4QEQM4QA4QM4QE%Si Pi SM%QAm%Pi RRQE%!m%Pi֊)ֽ/bExG|%^)k|5 + ^wЍ|%_J3y޾%K?^mf$ЍSVZ)ERE(QE-S(ZZ(QE)–)iERZ()iERQEKERE8QE)E(QJ(RE-(QJ(RE--RE QENZREQE-:)E)–)hQJ(EEQJ)hQE(ZQE()Ԣ(EEQKEQE֖)iER()iERpQERE-(QKE)iEREQE( RE(QJ)h)E(Z(SE((Rw8 hw>&>넁N3'>daZ|M}/E gnO,}>uQԜVA_Z>mi6Zmyv'*eFeاii Az"P?![*⊷V誗 |yi)|5o&bӡ73嬟tp|yi)|5o&bӡ73嬟tpR|AۓUUFą{_.49mUA?Gߊ:1챹o0< 8ۗTf])UTZ(QJ)ESYH[6dpc?MG޿NJ?#Kao3I6Vl=ׯׯeHKφ(M[3@?|+:tl<GR*_$H#u6H F WRRQRD9}gKɘ4m:M.TOW}LH#G8$K5%}_hԔT7Pwt;x#idsUFIC{u wN#6G=TdQL<_5ټO_[ȒIW~e],/^}TTykZ(^3qtDI^3qtDIJ:-~Ө(5_c%W)kKn\-Ri+馒(_&4!K^gb8޽ $7p\w8KLQї'R;xoohj`8xۺVW ^--WױZ wW^*x9+r((FPk~$|VYn"B1oW_ϸ1O9Ygid%Ž]~#>PW_xԭ5BG-=FN`_xԭ5BG-=FN`.~jjm%ShGִ7n+-Q/ .E۰ugp)GQU_Un(V>?ANCjQnu}U7?mCtwj)) 4E!))(E!vGd{MKWbHTf_`G_h~7m/Í^Չ" Q}E?]?aj} _BU(qa_^/,aa0>0qinF#X;sM5YMJ RRQE!4QE6)(4QM4QIERJ(E!E%%RCE) %RR(4QE%6)(4QA((E(nQM4QHh)QIACM4QM4QE(E!CIE))(hE))(hQE%%SM!JJ((E4MRRQE(JJ((QE%%RPhMRJ((J(((J()(4)(E6(4))(E6(4E^Y1_KSo# sF%K?_ |W 63_F+\S)ihR()”QE--RZ(EKE)E-QKE)E(p)h(ZQEQE(QJ)hQE(QJ)h)h(pQE-)ihJ(EEKEQE(QKNQ@ZZ(QKJ(RE-(QEQKEQE pp(u(UKE)EQKKE)E8QE()ihQE(QKE)hQJ(uS)ihR(QKKEQE-QJ)QK@QNQKER`r<%j^'0i}ܑi$}#+_oV{frG2?bi˞WZx5V\ȱ 4;tU$TWwZZss"(HT A85ٽM~gx2Zƻ>/*ꉜ" ~k_\&p(QVTٽM6kk:sk~bn3Ұ#>V[ ]kuep✤:kENk@mOl[u qe~k@mOl[u qe~kMHet_c[hqN@!'P.P7V:KE)E(p`8lz? Sɋ}bE_tW? Sɋ}bE_tT#֧+JEQPE>,kQYe~l`ŗ_3ōz4kG;mP#S0u# ڣ%ζd?M+?j;'w:Gɐ6+sWUUF)ERE(ZٟK"JٟK"JQ֖AkEQAk-pK_?[uoI^?^?M4QE6)ox;źue|9er0aH?xaEox;źue|9er0aH?xaE88_S|9tEbţiw|ylKv>ydLJ:FZxѴS%RS Fn;O5E>-Wӵ{k9> dwuU((-`継JI]OPA Ym!{iJ6:Wğ%G>cDIcg!.{{gOKu#ɱ$=zt=ң Gֵ|)(:XTS/T7_֫W}T4QHi) QIIE) [VZ+%Z|U Ѕ}-vr>WĄBݱU}Vh+.O58 r0ej܂oxE9Wn~2dMk 3MJ RRQE!4QE6)(4QM4QIERJ(E!E%%RCE) %RR(4QE%6)(4QA((E(nQM4QHh)QIACM4QM4QE(E!CIE))(hE))(hQE%%SM!JJ((E4MRRQE(JJ((QE%%RPhMRJ((J(((J()(4)(E6(4))(E6(4E^Y1_KSo# sF%K?_ |W 63_F+\S)ihR()”QE--RZ(EKE)E-QKE)E(p)h(ZQEQE(QJ)hQE(QJ)h)h(pQE-)ihJ(EEKEQE(QKNQ@ZZ(QKJ(RE-(QEQKEQE pp(u(UKE)EQKKE)E8QE()ihQE(QKE)hQJ(uS)ihR(QKKEQE-QJ)QK@QNQKERԷO. /C~h|콝>vd _ ~|! }>X^Οl``}vQߩ+ЫЪZIr3ްuWϧL p7 du\ Z (|yʡ#pGUޛ"BxW d?ۯ_.~Jm%GG2VCm/G2VCm/GKQQ uK uK|U4k8ue7?>ڔvSI3ی &uRRиi"FbqГcҧ6 \kP ޳Gx@tk}2=r=gxGd{{nRCT"@׵ &vYN۔q_!.t {PomՔo IF YR()•Nqi͙w3XcO k7&ٟp8ݵ=?U8`}*W鶕ovzp?0?m_]de)ZοN> ¾b?OhֹcS-'m> ?OAK H?~ipi}XbA(? *bQLs+/~>a|[@ k/~>a|[@ j98kAJ()E*ק\|/]&W\|/]&R _( |Xm녿Z/۫ Ji)QM4(CH u jú֟qL/qxaAouK>㌘_ є؂(ڂ OjpRRS$}Gsڂ OjpRRS$}Gsn Xnm&{yIeu# :+K/-a9A$rԌRԴPFAjҩKvK(POX^;,v*hԷ>2 0"\Ѽ2RY2JȌUuNF!i#vАAv49]5]O"Ǘwo0uߦX\z:ή vLf3yGEcZ1l;1ה~Z;k5ɣQGp3{sU+* R(4E(JCEZ!G)R-;3mS)k[Fm#Δ)YoU5h`Ե5{U}F; >smi\*O*wsy964}A'IY$..{%9W.ܜI\rrkNi EQSM6)(4QIIEE(E4QE%QHi(EEQHi RR(4QIHhE(EhhJmRPhRQE6E!(E%) 4E4EShE) %RR(CAJmRR(CACIEQM4))(HhEM4QIIE())(HhIEQIACM4QHi(h)(HhHhi(J(((J(EJ((JCEJ([Sz_ g\~;/O_KSתk@6?WK/fG|%_J3y޼[|I\rLR(QJ(Z( QEQJ)hS-RҊ(QE-RҊ()–(p)iERQEQE(ZQEQE(ZZ(()E ((ZuRS-REQE-:)E)ihRE-(QKE)EQE-SEP)Š)Š()Ԣ)W-RҊ(QE--RҊ(E(ZQE)E-RҊ()E()QN (QJ(RE--RQEQE(QE-)E8QE-Kld;Mz_ eGG}˰FG َW|&_t}>X@ldyQ}_Mi2ÓZu%_UEQEQEQEQEQEQEQEQUW־1#K/[Gm^/.bx?T||cexG/Ɩ^$ڼ^\2~jtpýE_<5 (QJ()h }+' #Ӧ}z4jA<`WO?GLiԂy13*?ܫP=)FR+ymKq|eMq<4<]_7-In1Ϝ:~l} a"|cjMV3j)#|_*^>*f"դRGId2¢eRuMEA^A\ݸ&W=TO A^A\ݸ&W=TO s~d\ľ)u2\'bB+'%N]gͿ?t3PZȬQJ()E*ק\|/]&W\|/]&R _( |Xm녿Z/۫ Ji)QM4(CIER(#q7nixc: 6ξuOu#H4$0_u,G+׾WS袊*}ψG]"%a_a[>'1TEJª?Zizi|D =8k7v(Ms)_~>"_|՜5ƛOgϹ0=׫WS# Uuk }WK}/ꌥHiUFR~DFARa=;:߅Qzsc;BN1ن5(=AH'a{u*XՍM4E(JURw~)F77Ӭ*q>2O~)F77Ӭ*q>2OU.GSZ `: 1}#Ile o"(P?!_:>oi6Zml-_DE +Q@qE[tTWMۋ|#8e0F?8}4FqQ]Y_Ui RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii(E%) %RJ(4QIIEE(4QIIEE))(i RRQEE%)h(4QE%%RRQE6E))(EhQE4ERQE6EE4QEQM4QA4QM4QE)QA4QIIE)QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKEQEQN)ihRE ( Z(QJ)hZ(QJ)ES-QKEERҊ()E(QKE)E(QKEQKEP)ES:)hQKKE QE( ( Z()E(ZuRRE(ZQE)iER(Z(R(SSQE-SERZZ(QJ(ZZ(QJ)Š)EQKKE)E-RZ(QKERQES(QKKEQE(ZZ()hQNZRpZ`B% ^'jrܑG?% ^'jrܑG?tsոj#0U$}jÞԵkwp =V[X۽ÀpX(=#U,z__(z5 7?EUh~?:?᭬Q(Fc_"kk/n=_ΗC_"kk/n=>?:>?:?᭬Q(FXt`w<_x?LὋyU`F}xƞ~ fUöMj=6*;R8?jox|Qs&e˛xsyuT7nj F Ffi)) QIIKKIV77SҾ~'_Z[--kxO%vv㎠}Heʿ ͓V-Z- 5';;qP> |Ǡ"QEU78Q|Y`x5[n]Z0>yS\K k2݄`|򧆹o?#ؖBM֫T4) 6)(4QIIEE(E4QE%QHi(EEQHi RR(4QIHhE(EhhJmRPhRQE6E!(E%) 4E4EShE) %RR(CAJmRR(CACIEQM4))(HhEM4QIIE())(HhIEQIACM4QHi(h)(HhHhi(J(((J(EJ((JCEJ([Sz_ g\~;/O_KSתk@6?WK/fG|%_J3y޼[|I\rLR(QJ(Z( QEQJ)hS-RҊ(QE-RҊ()–(p)iERQEQE(ZQEQE(ZZ(()E ((ZuRS-REQE-:)E)ihRE-(QKE)EQE-SEP)Š)Š()Ԣ)W-RҊ(QE--RҊ(E(ZQE)E-RҊ()E()QN (QJ(RE--RQEQE(QE-)E=fuL%xg^d?qcn)7`rܜkj5j֥ :_gl<9o&.5iɀ?"&yh 8hջ&_Quf(J\?O4c3IS5?O4c3IS5Je!h>>QEKERjW6c6۫9#*\h͎dnK# Z#5mZ^tZ;謠}ojjG6GEe[ +B(((<)+i7V0JZ@OS}XS%mj|_jCEC֤Y 9vX::`r=IA4s@tu8*{oz_q־)|DCy*'P-<4t(=Ќ?SᔆTOؠ[xh&Q{u׫WS袊*9!Wpk+Ͼڞ!5 i%0ޯ=Nk+Ͼڞ!5 i%0ޯ=Nj)`Wpj|^ ~=izy^pqׂjle^~Wa#8\~]Ɓn7I|y2i|y@'eʷi痞>P-=p?(Ok޾~]:/޳ XaoT'k޾~]:/޳ XaoT'jxO-{]{]MEQQ\J#N>^U⥷ï 4Vr$#Bp|8-xi$历fO73zVq_\M-Oq#K4]YOrM| q4=č,1ww9fbrI=5y94Tu!4QHiQIAJJ(4(E%))(CIE(4(CHhE!JCE(E%(4EERShEҒ)) QE6)(4QHi)(E(4QHi(E%%R RShE%%R RJ(i4QIIECE(iJJ(EQIIECEJ(J RiCIEEQIECECEIERQE6EE4QE(QEE%%RR(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQERE8R(QKEP()hQE()hQE(QNQE-SQKJ(R()E-RҊ()E-RE-Q@QN(QE--P)ERӨP()h()iQJ(QKKE)iERZ(QJ()hJ(NQNQEQNQJihQE()ihQE( (QE--RҊ(QJ)hQE-QJ)EQNpQE--RQE)ihR()E:)hQJ*Ղn?"KGERGwʠ^Ko${4X|$pg|oooOtŏEhWuiQEVu~|+⾭42o?`!.\ϟ;|WզMV9c$1˟t>QטטT)EQKNZR&cM࿈&X3x_=tMh[xg s\)${RB$z_Je# E~++d!AE-- CzWw|'<ϥ\:!|lhOO=yKȸ uB'3P.T7@+zޫ QEKERE-O Ҿ˛}:YOb'F`c_|B\kZܡ%F:"AĒO& =W~&ֵCM'K tE?$MWf,riW5L4QA4QM4)*r:֟KZն]inۣAA޻xkZմK-/tr=<JV#7_j|x4l tM}{`C$:>@]6.lzϡ5b)px5%{m{mKEQEQEQEQEQPpʼK ϧzHuv۠>0GG>W|ax6ItFHԊ{UbĖ9&+&xZյ.t_]ԼK\ܗw I\@سM̦QEE!E%))((E(J() %RShh) !JCE)) R(E(MSMQIMJ R7JJ((4QE(E!((mRPhQE!JCEQHh4QIMJCEQHh4QHi()E%%Pi RPhi))(ERRQE%%Si Pi()(4QHi) %SMQE%Si Pi SM%QIECECEIEPhIECEQIHhIEkucuK,똯G|%^)k_7 ׊Z_ cB׿#_ |W +Ro?{כk?#T땮VQEQJ)EQKEJ()E-Q@pZQE(ZQEQE8REQNQE-(QJ(R(QKJ(R(QKKEQEQE8SEQ@QKNQ@pZ(R(QE(QE--RZ(QJ)hQE((u(8QE8QERE:QE*ZQE(ZQE(QEQKJ(RE(ZQEQE(QE:)EQJ)ERZ(QJ(((QE(ᝢR/\^FCKtXI-20cOa_qϥ:n,sn$ZFbVEp1Ոn^*R}OD7q@ <zu?#Ajoo,KzTIۓ#pj;ڛ3[Go6Fe## 蟕@:ׂ1,ŘI'x#Y${q֖QE()iQK@QNQJ*a;ihv\VZVp%Kq#b%+,hƳ-aGP}@~>,hƳ-aGP}@f4^#^#Q QEKERE-98w}kᶯwg3CK3FFCaYNF9k]Zm1PvёVS{z1RqOL7j+?(~8W=G5_?R(H/++ơַRk \@-!Bk_W3+Aj?[k}gFQRaj7?;c Wt(7ܿoKHd4ON+O2Lz |h GVk[؏&2=HƏ9 uf~ c#aĊY~  88MQIIEQE!4QHiQIAJJ(4(E%))(CIE(4(CHhE!JCE(E%(4EERShEҒ)) QE6)(4QHi)(E(4QHi(E%%R RShE%%R RJ(i4QIIECE(iJJ(EQIIECEJ(J RiCIEEQIECECEIERQE6EE4QE(QEE%%RR(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQERE8R(QKEP()hQE()hQE(QNQE-SQKJ(R()E-RҊ()E-RE-Q@QN(QE--P)ERӨP()h()iQJ(QKKE)iERZ(QJ()hJ(NQNQEQNQJihQE()ihQE( (QE--RҊ(QJ)hQE-QJ)EQNpQE--RQE)ihR()E:)hQJ)Š)hQERӅRZ(QJ(ZuR(SR()hZ(QJ)ES-QKE (EEQJ()E(ZZ()ihR(pEPh4QIIE(E4h) %QHhi(E(m! !i)(ERR(4E(JCEhEQIERCEE(CHhmRPhi((4QIMCAJJ(4)) RJ(4QHhJmRPhM4QM4QE%6)(4QH)(HhEShEhh)QIACIE)) RRQE!E%6)) RRQE!E!JJ(CEQA4QIAi( QIIEQM4QAJJ(E!(4QM4QEQM4QA4QM4QE%Si Pi SM%QAm%Pi RRQE%!m%Pi֊)ֽ/bExG|%^)k|5 + ^wЍ|%_J3y޾%K?^mf$ЍSVZ)ERE(QE-S(ZZ(QE)–)iERZ()iERQEKERE8QE)E(QJ(RE-(QJ(RE--RE QENZREQE-:)E)–)hQJ(EEQJ)hQE(ZQE()Ԣ(EEQKEQE֖)iER()iERpQERE-(QKE)iEREQE( RE(QJ)h)E(Z(SE((QE-8QE(ZQE(QE-)E8QE()–(ZQEQE8REQK@QNQNQE)ihR(QJ()E(ZZ(QEEQHi(mSM))(QE))(4QHi(J(((J()QE%!CM4QHhJJ(4QHi) QIIEQE!4QHiQIAJJ(4(E%))(CIE(4(CHhE!JCE(E%(4EERShEҒ)) QE6)(4QHi)(E(4QHi(E%%R RShE%%R RJ(i4QIIECE(iJJ(EQIIECEJ(J RiCIEEQIECECEIERQE6EE4QE(QEE%%RR(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQERE8R(QKEP()hQE()hQE(QNQE-SQKJ(R()E-RҊ()E-RE-Q@QN(QE--P)ERӨP()h()iQJ(QKKE)iERZ(QJ()hJ(NQNQEQNQJihQE()ihQE( (QE--RҊ(QJ)hQE-QJ)EQNpQE--RQE)ihR()E:)hQJ)Š)hQERӅRZ(QJ(ZuR(SR()hZ(QJ)ES-QKE (EEQJ()E(ZZ()ihR(pEPh4QIIE(E4h) %QHhi(E(m! !i)(ERR(4E(JCEhEQIERCEE(CHhmRPhi((4QIMCAJJ(4)) RJ(4QHhJmRPhM4QM4QE%6)(4QH)(HhEShEhh)QIACIE)) RRQE!E%6)) RRQE!E!JJ(CEQA4QIAi( QIIEQM4QAJJ(E!(4QM4QEQM4QA4QM4QE%Si Pi SM%QAm%Pi RRQE%!m%Pi֊)ֽ/bExG|%^)k|5 + ^wЍ|%_J3y޾%K?^mf$ЍSVZ)ERE(QE-S(ZZ(QE)–)iERZ()iERQEKERE8QE)E(QJ(RE-(QJ(RE--RE QENZREQE-:)E)–)hQJ(EEQJ)hQE(ZQE()Ԣ(EEQKEQE֖)iER()iERpQERE-(QKE)iEREQE( RE(QJ)h)E(Z(SE((QE-8QE(ZQE(QE-)E8QE()–(ZQEQE8REQK@QNQNQE)ihR(QJ()E(ZZ(QEEQHi(mSM))(QE))(4QHi(J(((J()QE%!CM4QHhJJ(4QHi) QIIEQE!4QHiQIAJJ(4(E%))(CIE(4(CHhE!JCE(E%(4EERShEҒ)) QE6)(4QHi)(E(4QHi(E%%R RShE%%R RJ(i4QIIECE(iJJ(EQIIECEJ(J RiCIEEQIECECEIERQE6EE4QE(QEE%%RR(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQERE8R(QKEP()hQE()hQE(QNQE-SQKJ(R()E-RҊ()E-RE-Q@QN(QE--P)ERӨP()h()iQJ(QKKE)iERZ(QJ()hJ(NQNQEQNQJihQE()ihQE( (QE--RҊ(QJ)hQE-QJ)EQNpQE--RQE)ihR()E:)hQJ)Š)hQERӅRZ(QJ(ZuR(SR()hZ(QJ)ES-QKE (EEQJ()E(ZZ()ihR(pEPh4QIIE(E4h) %QHhi(E(m! !i)(ERR(4E(JCEhEQIERCEE(CHhmRPhi((4QIMCAJJ(4)) RJ(4QHhJmRPhM4QM4QE%6)(4QH)(HhEShEhh*Kkyn\+ں/x/_Ʃ&3,:,/x/_Ʃ&3,:,極@ qVy<+?İ ?İ X k;xn!s#A*kk\$n0;k9ԫ`A{SjE%%R RShE%%R RJ(i4QIIECE(iJJ(EQIIECEJ(J RiCIEEQIECECEIERQE6EE4QE(QEE%%RR(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQERE8R(QKEP()hQE()hQE(QNQE-SQKJ(R()E-RҊ()E-RE-Q@QN(QE--P)ERӨP()h()iQJ(QKKE)iERZ(QJ()hJ(NQNQEQNQJihQE()ihQE( (QE--RҊ(QJ)hQE-QJ)EQNpQE--RQE)ihR()E:)hQJ)Š)hQERӅRZ(QJ(ZuR(SR()hZ(QJ)ES-QKE (EEQJ()E(ZZ()ihR(pEPh4QIIE(E4h) %QHhi(E(m! !i)(ERR(4E(JCEhEQIERCEE(CHhmRPhi((4QIMCAJJ(4)) RJ(4QHhJmRPhM4QM4QE%6)(4QH)(HhEShEhicF 1wF5VMA1 kZ۽Ԃ(bA1={SFpu6go#wWjA ;ᇂI uFzhg'd ?i <-ZHM5+;C8< g&>,mn{S-5n%O o:񎭠Xble^ƣe9 u+b_~׌um4/c,53(A^{gCus$ItK\71^]Z*RO|!u{p5ߵ¯5$΁΀ RQN{TEI2OO)'c7F* R'2jQ q&!g'MoZ?2-nCN޵"y,e#ZA1E!k#/VQYӯ,@0+?Q=3BZuo?5/bU JQE)E-RҊ()E()QN (QJ(RE--RQEQE(QE-)E8QE-QJ(ZpQKE)EQKNZRpQES-QKE)E(p)hE(()ERE(QKKEQE--RQEQN( ))(QE( RRQE!) SM%RPhQEQM<1jD.hm$p+^4MRFGi=#4 x2lMg"N,#/}j:r ҤujƤmQIHhMR()) RiCERRQE%QHi RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii67BF'B=ᾫsêR' ?{h y=3sB=ᾫsêR' ?{h y=3sz}ٻI N1S^\냜UWw᳢[hn3u8\}x_h-o~:%i+f9Q3'׎PAj~sY!"{JnJPg{{iXeCAVwV;H*`rvАro+O?7Z1jlnK͛ .F(pi,yg(b tt絺.,->i,yg(b te*j):e%R RShE%%R RJ(i4QIIECE(rC,1ZoQFx?@kSM }7H/y IH3R8eIkiet5b>$B^!Qe*jׄ|Ih=BUҽJyWVF*U`udbXFiQM4QAJJ(E!(4QM4QEQM4QA4QM4QE%Si Pi W'RnyvG@;IԵ2F]-i?4SRjCetM{kF_ma(ї~(=o[DXJ綤6j2ֳc5)RCI Z9x^ :#5<2+G¾W5k!Kɢ-7R/ xñk' /Zre5Ku6jTv'ZF (Wsiih(UG+Ҵ4 iai*ă (P)$)$w&!MCLCgGSP,nY$1$QiAN)#*3^k㿂_5 &M->Xay|=v?t|y |<44at0mڤvh:dFUIgoҸ!_b(^*tLP@yW|[I@(b}FxE=߳ޣ x5I6\\ `]/Ug-A]UkhO_W?߄ .J><ɏF~~@Q d#e\Wae(2ߙWW]][(we>t+7\O~x;P5,8Q ^OѲ=xZv!]6GQҬAMa:u[emW5/Ưz}SMO.%A(cz~5| վ+lxwv q-z @3 ރ6b&[ocd)EmMMBQ"(0q^ZĭV-F%$pIJ(>t#8#'xt-KViow8IY:דI5)D|aYzXj>X`HϚIp+q_~i>.ai6cϳ38R@09T}.+#$IG̅TGjH F)!9Q0R8 Z)!9Q0R8 Z*H#pALi 6l ]H!X.bhd^92BZ A ş ssC%jȡzzCj\d~ _{:OxE| R!Tl1޾G7ƺzume%7$_#zu] =:62 [űwT(sX|XU^(bC_Z~Z>xO/wnd*<$W֟j^ :uۥiY ,p xJ(䵜1>m+E|=@' _I8·gx|CO4= CO4= >ֳoo ujEυ43ݴw_v\SA=O?cYZ޶WHYl>q\wgz6#褔kYFۢ134d}VE}PYW¾$~Zދڵ@Xȡ.T/`^#bX%}ժE rǿ GPki!7XثVR8 s%CF=MmYi#?֜qco7r[:U"MRI5o7r[:U"MRI5Q1*aNj֧ye&HaA,i4mȲF 2Un,a.Zeѵ&֞1>_>x+$6 jL [=c?G[߀}Οv7d\=Aá>)|6~k"YIk.M@SúG?|Rm8E\k؁чum7w[<W֟ m%)i 'UҨ%@+ڳk* )j}}:;kNܫmi vPK2;Ut+t*ז_ʪD6P88l7ĺ-ko1Xva|`/ i%l-Mg[xO ꦡ@WEQQE-8QE( Tϭv`ⷅ!%MFxPpWgf~+xRXdaWE 7=EK3&}kGjt~U_{:O?*6GG"q{:Ol_ʡA W~>o揧Zͥ܏;{ ssɯ | `NKwXC&h P^F<U|o_1NQJ(pV6d?[\4[uK!D+&أʂ72g+ֹiַR$CVMGneUT2GZh{:O{:O6G_I8E|=@' 6AUy>=[iZ%8*ؽW_-a jTl^p*\ p4ڱφn.:y) I-37rHɯgh|3qwiHZIm|FMZ,p)_I8½_I8Ÿ(_I8E|=@' 0=+?QFҏE|=@' ?t([p|FTPzڢ P&`~t|J8>#x(Qc=VQ`(0¡?xiWƓxQL$o+# U#ƓxQL$o+# U#~ko_I8¿Ft*lQQ^x7WvOif)p-P`GZ}K1Lj#2:M<RЮ4pyXF>K>񾥡]nh}[ rp}'E-SJ+cῆ)ZY]2I_Jgw&$M~|7օ7ÿ K6I+V¤qɢ\Yi.Ҭ-p$6ny5~՚a{*qwCn3A8!X.bhd^92BZk|Y1G42_ƯXg'zZW?_E|=@' Z(W?_I8Š(W?_I8ŒQ?t(W?bE|=@' ?t(+?QFC'5okogĶpEoI@7[{8"$lq E_FxA'4^m^mL4Bܞ{g_"V֤J}r?<hol+UQjԒi^coG3='R+o|1h\(͜]>ھg:(Ɖ%<#0=eE^*h)|e^1^&|ƞ\ j|e^1^&|ƞ\ jk"P*y_ƿ:X|n_ڏW_Z/_KMx~YuM>i7/G/@ wWTU!CM4QHhJJ(4QHjJR|_? <7|/dIڳĹ$ɯ>Ji]2YmYcfbb\H֔*$ʎ?bt~U+?WUOؿS_>a=h=?-&Tg/Yw ~n|#d6Yw ~n|#d6HaE7eOyfjѻi+{m2ǟt'գvVE?te>&N= q7ʟj=UwO>'~y*.U8D^G|SJN#:בTx~זWUzJ(5%Am Aw s$4r(eaAm Aw s$4r(ea7123ZZq*_I8¾W?o-?Zq*?t(W?O/G_ʏE|=@' ?t(Q_I8E|=@' hzS1m#$ںD='OJw_ʮ+?UE|=@' _*?某ʏQG"qT?!G_I8E|=@' <~B*?/G"q{:Oy14E'_I8E|=@' <"uU-l2MNW%1:s_(e .ekhk)aKcu汵U-UZi(?/qUcM:RgmwgdUoNԼgG]ƺxeYY>b e ZT?!_[+?W{:O<yQ4E{:O+?Q<b=cOS%R{Gu=CYDGLJ e !(T2XI%׾ |=e𽍻d؃ solc}v@ed£xUT ,=E|xƹK-^x%n aw8z>o<]F\ږ/<g^0;=!^1+4QHi)(k D5tRdw5 kᾕ߆-XϩpG^Mjxmx#=t^D??Wٟ{:Og"qtgx|cū"+R9Gt?LԶFVeA t<5V]xڎz6xH̼$>ƫj:|W6FT50*X`+kKchrF #k{)s+RU{ROۂE?Z~C CqK :VE $+>45[etu A*Ƙj6 ȹ]Q"Ct+;_I8»A1\Tz## CqmDFpAb@27@3?g_WOLHE38r 1Q6DD #1PݿN^\?wK-;6.e$oӠh׿7q{l͋@#'wm⍘* ƭ-&"=+tIapi Wio 1x3^-KIᕖ0A8 9Ȇ Dm\~oWyw}- dTz e mLY4Fw{X10$95-Z ',.$i6baBI$rkhM- DPz h?__I8º_E|=@' [(4/QG"qdA<"{:O+?QK(4/QG"qdxGm__I8E|=@' >m>EiiƉ1_4~zNYxHI.xV=c8=M|i:ve#ZZ$mX`E 5xK?*4L=+*ޙOͲyEÍw.lHB[Ńsy.DP)=죓]dh\S{G'.i:eƧ> >]ehhzAt|_K%\Q霟z?JMoRP \ߠu1N퍚^A(@v,PFƣ =W(b45TEl( POvH7mMj08>h!6eBF6²cH q r(5jB&Jck-hn:\nG*}}E|cd}K7 .y7#F>H>}gh鄫|<FG(U0Aomn,n浼H.asHYAE|{kqcw52As E*B+7dJF4ʂR(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQEW_-B-1)?턓wiv.Dj?}턓wiv.Dj?}x3DQI<§WU_QWUn,^nѯ_Ҽ |;_#R5f]akrxA_<1|Jgՙw%Lן@k/X4V/1_ҹWt0BXJZ|O3Q3CX]?2]$m~~+wx9#hfh/q5OKh$7l5 #WMgΆI& $q]OxP5yۈ|d`8IW*c7fk5|\h 2CM^.|1ƾ$Z֠hZSݸOP1:^.|1ƾ$Z֠hZSݸOP1:[Eўuͼ']}0@+ :]gk:Zlc#|S?4oJgFF/u&[tW?<yƟzW=251{ܩ6J?¹Iw#/\!d>Xjgu ;@־K߈Ⱥ'+KH,k|}]<>rYDd& S>;,`?>_y\^g¿7;{M5{P~{{ؔΠ0?ƬWvwjo{##@7I0BB]A=>ywbC8t=TնPU*F=뱺[{kyP$r(eu#z+[{kyP$r(eu#z*몺pHk/L/'_~_]١VĿŏ;F~hT_~_]١VĿŏ;F~hT^7:I'+8Wח`F_b)_O[kW&'BZ*JJ( "A<(O^Eȸ~^t;teqo|PWs'v8(;2]cs}5^^XUwG⻯X<#aw_xG:Z kjFkg}\|qm4ׯ?m?`%|_9VtYʾPE"?XqU_H5W7>sĨ#Q{|k763@kx6FH|QMxF^æh[YoxfU8\+cU9ix[cFFI?y.2=`dURU׆-&洸hgOϑ[+ZPѸ5 >-x[yz5C{ `;2Cu'^ׅ!]:簺&$0Rqv6$uWk'\ӄ4&Q^M|!Fs}Sq'H?"Q#=Hx5-ω eOYd#_G  c1q\BFH?ƹ_ӨWc>_?xG*$?Wo6F ;/6oI7K6\~qWqT)Et:%1q(̍ʃ"i0}b<(\"8|}95W H-YE"9`GAQ˙eA5_EWUTumNӗ^[So>JSZ s}9>د-{)-d Ԍ9>lUN 3u{}k2Mjr~HQ^ ~,fk83d rvWYxKJ֮l!b 'Oqc2heƯk®Dd#W??+??5|5?/WǴZ'F+򾸺QE{@'q77Fƺ?D=<}%|0MѣmFOz8QO0w[%Hăo=kNkV u'9P:m}E\Kٿ~g>AC Cqq.ZfwN@5!I+<\ɔWw#^\Md5Us'o#$,(¨Lrfa⦷ԥFo#]c=QxfczP}s+{LxG/@wwU*o}EXfFo'Vn t9SؾtvrVI9v yWؾtvrVI9v yVR,C= $,єq*<%x&{yݑOb<T|y-35ο$|>{>Am+T]vR؎:fk>T]vR؎:fk6V6ZG{7 S)]f_}.տ3/_z$}HjA{3z v YS_?"،\%q,@O? >"،\%q,@OƥTu'BbL-.Dl4ie[Ŀ쪀?+BMKMP%KʨBQ QtZΙomyc!p1NRV#M1,}$.&6WPTO <-h/G =AGME[Hᇸ8#RHє#z+;WtVNwi3*uԐG+;WtVNwi3*uԐG+A)*T(TOvCPB?W|!a(!ROh~֥ ?9ai֍3ː:c Ұ\kF{hm1 HC AVmghKVufb}.n%XbAՙ~f8(ڠzW鯄48<5m+E85k  x[Jmpb}o9?h(ڠgǶjgsNbH*>aY18\ӯqؒ3_ʌ{f*j;hO,+kʳ6qGI_?o tn/kN'W>mcU5K968 Q O+^'V(Y,lX1D,>MGJWZgN WZgN >yYk_,G5BΝyҏ3ڏk-k;(ֿYӿ!—M|=QꚴR_KtѩBX}kꏮxTեb[NBr3LI4VÏ(~Zq%N_>-~WKEN@ 8A?I@&hI<~ï o-f *'NxZÞ aIX9E- jOx7[֡'Ocs (<L_.Yk_,_.Yk_,L==ֿYӿ!k-k;)b9:SdE$PVzdFI20!AUgMߴ4Ifn@ ߋ#|K|3Ox.h:- }=;U;6G5M4E!))(E!'W?%>=Z'C$+ZpOEHهP)CwO޹GvPyY  {/Si%ݔlk:BwLTcuk?j~E2C_-AVxHb)/dOKkq]k IgHMm'{Ę0u-%"7%gcq4Քuuʜ^)|]&BF27YO*}7SHMOú7֍d8doT*:ȹBcIxExeaw,i4O2YygrWXGx~BY;G #zWXGx~BY;G #zVe|55PԶֽwOo߳ 趩?ju~VV0ƒZ^XV9]2Tqƾ?|_a{Ac[_v3H˳aQ?ު&ܮ6}j1דYk_,^M eгCV濝 1PiWuYD* T퐲1ZKwZ؏G8իz|KƭʾeEBA~>uo6Z,Vs !9YǷJOx#N&EBQa;G9+ XY5ƋQ֢M^P~xЏlڻ\4?2>=3ҹ}#4W*uG̶db#FG9m:\D$Bc_P; AKHxd0k~4Ҽ{5rc) F l%"Ht ]]C+ FAҺ+ea"^! ܨ:_<9'F]\$E+'"֫ Dr:" c_GUqUcM4QM5kLϼE#*>f o_S쥏}Afڿ*o_S쥏}Afڿ*5#*3}u_#i֩麕&U[dCSTJR[e*-{iq2!)i S}>e^}FGz0Ǿ}уG z^}FGz0Ǿ}уG zTH˧οZZϊ) RRQE!O3{g%jSȫ?c?+W_ FEZ3t}]MA@ AAW7+O.ap䓆jX|YC U]Gr_UzX|YC U]Gr_UzMeN.P|7aB/ZFvx?ֿ5jΗ!+_λJ$JW??ξBfy /+|[aWEs@!w;h -5, bFc\`g1Q$k V5Ϧ~kͺæ,;?Ͻi;Ff8P2M{ 66WwridsUFI{ 66WwridsUFIjFv8U'ڹKvW"Q?Z'kQ? L&F;bE:d ~-ֵˢiA$j. \cOZCu4-.c5U5k9 ~,7|FI\$rɔ,7|FI\$rɔΠro-x ƛueM.́KRaXyVmzQkM&i{թ0ȬT̼s鶯YK^*޾w~)w@/$+?R$+?R{#W/?ʻȑ\覮_$x)y\6Uu_u8B(\ZOo>([kriOxD23oo[>_TY̑,~Y`9VzzkW5{9m[PKpk~::&ܬr2X.GC­iVQ$p;kUU ¿K--5XF*=Yim 6Vj0T`ZDXQUQaT5C;OyWVPZ9|< ֧ambXE\?ڜ-Qk7:f. vFW,1gcORkQԯ/u 乻s$HۙI5]jW\9Ymy$9$ydi%b%JU ( Z(QJ+t;ai0w7_<2Yi\In.x d/E~| xOf q%,{g鐿E-߅\(G8Tjizex-m!yob koBZBER@XyK+/IxW՞M5FHu㝹 m$ExY^$a4[؎9۝OV?Eƒ >O\PknCB2#}Oտ'G])7q?]_iWUU-*Ic#F~/^}wYkΡJ}6PO&%/(1Pן|8l5xwRMɉda {5CG??@x?oH_5'68fQsaRQ>#mI<h7T\ǘe#>Tq8ϨSj6{g$C{卢at˽VuZIZ?pk{Y.mZMaho-%hf );7gACzR]o,_κ߁X<#a\?-i]w55_U5x>־8z?kZOzc?kro Ǭ_a_(xE"C,WW|*ܯk+ˏο3~#B?.kWoo(^'jE\sFBU gM/tmI6F5gM/tmI6F5$nѸtb iWlq/޿AA_Pغ}=~OH5 7ٯx`сڻmab=jz%z%^?V[ʊ0_ߏ?u>1 eG ݴ{),h#W[I P0r G'YڌN^{^{Tv:_73IѿH<#`迕vOmj_pӾ7"fix4n5W~qWVt>{g'+/UG7ZW镕6VpZƱ[kUF@+P@Qt_pgqt\xJRlu5i :.H֦pVS Zׯ+ڬf<2H;K|0:+Xܐ:џE|la!tV ue?R G(ί˭}#=}.տ3/jDA[z/z q ½od6Aw`/-,$|TWL.奔p7/rHB@$~dĮZO|[=/]#ȾeۜnX~k>"ov"ns2u`AR %u5_P͇r9+jxkwj(ihZ'? u/>]Vլ!ݫ衧Mhpt֫jpyQ?QY_3%^oJ3%^oJ?ִ"k>dz9;ao$oX|[a +>zJR(ty>Og//_<1yP: ##蛿_D~nc;#2>{Lt>_euT7kQ[ڧT?uf:DG?/"aM?uI'VcDs&:jS[vPM߶> îGZ{8Džl>|M`G :{m5G`^)c6wS&]"6|71&]sVƮTQ9,~ 1[Kd9Ld{Vox'?YBAc}ɧېr6$,*63N*ZK;hO,+j^y^yL1}_?o t6qGIVVOҺoMY`|Mm藥o~ Ъ(QE--RU+q%]Ï(~ZrkʿLZ;ןIqm}֔V<}']Gх?޼O'hִiR^Y$hrIOTf )fbpiYs_esjZÿ#coeqێO'~nWώukwDc HEn9>UsM5W!M4)k]W]xnhͲDl'C=u_ |au_i6d qt cV+XnmIȲFє?_^ZslH&E7^dLwF}80'I5Մל~O$? sCD l}Sxi菨橚zi) QIIE) h>I)w?J?%>=ZӇJ)?Y_קεA_zIuʢ) : OӸG/+twb?-YP{l(vB^Z帋<c_ǭjt5/ڶgJ%'AH#_Nmivz[KRxdČ52:i)+?a uRnb-co|a}gBTvX`2 "e=c挈"u%YOPGjё9$R)X蟳 趯DS[EKgQkVC:+?T |q__BI//qGYޏj|_0}QHi(EEQHi RR(4QIZ?{Ҿ?*:3&{PgDg _DW\_~1\cWn?OǬza(b?A`VwZ?_lW5m=O%4UO%4Uk_Bדד sob'' 7}Ҿ'' 7}ҷ<9.cqZ}9[P?Jo"6XIXP7A~~ӷ^o@C,m $,( ¹mejSc*,,&hk{@d 1 +2w5\ljY| !HW_!x.n5 X ؘ=| }[+IsqL|df~hqkFI.|+b ȯH`+r-JH| ~rmWĽgJ=fOZqǒ2+S_|"|/Yңeq̠T[Xr U5 U)(֧b3u`dUM"o EbJrܮXO'Bx> |N5Yo?iM | '&.7gO&~_SӮ<<,~xd+ڦnm'ï5-QEwU18{~3 *c&'pҦ[i!~:Ƹheha߈t{NfUhdz߈t{NfUhdz :#?MWo;jƯ3E!(53]}g ;K_YuRYowTW5 u线.:%gэ_??15 fuL\uR4)_[$,>ؿ'W7R}G^5mlmiƾ2:lclHH~F5x4L>uU}k]r12\1loJE=҃q#k'_6eteAuǻ|o~]8c6kƹsIERAЊ|R8?{uaeM:BJG5_֞M4} )EHc,fUzq8hs¡W?$'ޑPYS#BM|nI m2>/bn` 3\|_4*)hS-RԶOy_,ƣM8O @Y7K?&ԶE/k@U @U ztbѮ1հ.5G m\Ay0wW~Ӛ|@6.DV<;'Rt+:#?k_BQE8REQNZLm2$3W'QK&WkĩOڣ? |-}+M>%2?S^fҭd<8̵FB?J֬en#ό,WT`+ue4֧Ki#,q{־7joKs&"<*IcZM)nd٤_5'W ?,s\z^g2>uUH AAH AAW7,28?,^WɿG&l?mt|b9 /|d|?nmj!GG#@O- 288Y>+G__B/^//K!}B֟Ws_U5^\Nj?koGF|qm4׮O?s+*ʰ+zUE"?Xb/ 硯gi?ʽ=p*= r5__w_!|kdqk {lC`,V^#Xn'ehhA?t}]%ekĞ5ê:xSIF܏=ԋO<ê:xSIF܏=ԋO<aNĒk$W}c pQERԶxхt_G|{J6*mx?ET}Ǿԣb wMl]MºJ2**'Ѓ^/]Xd[ΧЖ_[7sɳO-) R6LAZN*?ٿ?WڟO[2+OاIvaDǫ ׶s^-"0 j7IlCvQzYT&&=yZs6ٯˈK]iIcz˟wF\ErZO,zH#P7[ֳ4y<Vb{W# Zƽɜ|ȯ#_.#fȁ‚~h$Wֿ??h|@-6" _ZÿȜ|ȩw/Ww7jOiWEj5|~s|vI_V}IG\%pQKZp(y5=KzE쾻_]0| u]_+-&eH_ mY[=O&YnO! 5R96]M6OHdߍ)?ᆻG&˳ L[<:첺 Y wHYNA+ q,nURC:׍+!~|IJ||0#?Gm%*?/¶pt>\O'K~jk{|I@wn=q\O'K~jk{|I@wn=qQ@ޣY_NQJ*X?'ֻ?W|!a(!]+?mקִkvGkRHuEҾ$xKQ}Vxb1_"_<%>˫[Q8*ڝ3Q].cq^;`x_gz)EJH2a~{Mxퟆq) sɄq?E5 =֪ b[.>m쯇zɉ,bʯ ֵ|E{<\,On9Q `sLk`^/P/a[_|8 /ZLʥnWox1_[,D _+طZ i"FG}GȤn?x?L׬LRс}6~4~X#3ǜ:?ZQȢ3'[8:nn>g |F|?ggMՖ?ZJ+FZJ+_ "D~|1k?Z蔢^y] 3y_v馒(E4ԃoF'^K~|7?_jE(= ]$ mW~2&[Pt*ܯʆE4SKNE.2p%Xԝ.46v*WNf~ie;xRT#!3ƨ?\4Q>;F?D;ꏫĬY6>;F?Dn^yoݤӍLPFA{iFǨ#5A-ms4r+9Ci*i))(E!'W?%>=Z'C$+ZpOE6C++1ֲh?#+Oi._YTQE!4QHkBɷACF֤~śMo +ZU?oo3m6[0O],c;nVD8hŋ~'x18;L_,WMH6E2Eb܍?4O[_ 趭KO?[S?ju~VAsn'+#~|On, H"_~򧜟k˾2u{XEO9?{apW,WzCW&h4_2y2fCE'٫==Lhd?4/?ƏUK19G[_^ Ӵ=FkAycT+>?~2Y3_կ By\qwC5ZƼƪ RRQE!4QIHhQE%kJ3&{P؛IaC=*}_DVsS~aFsэ_~1\cW+???Θk醚hkKC_'־wZ;#5kS@_cWշYW|ܼSiS_.|l |Kյ"IK+n'uqC{˟>mHRB#[\l#]< qTQy&C wL0G̪&> 52?7!2\-R߽kZG}E/>ݾK竹N ^| }AgsWsܜ8m[B#aGME{vH.~=⎏A[Yen}>=⎏A[Yen}>WDI Gʾ;vf9brM~{w:w})ViVv$_Ω]JfC՝$d(]٘iVh */cWM2Zltwy:[ľu{D.ufLMwKK4/,]l1HעW闅[oxsLѬF-m0[hO'闅[oxsLѬF-m0[hO'gk )P]d?"gO?ë} 63`>LxfǼ&gO?ë} 63`>LxfǼ&|E?f"V%gN_()Cx7n"{'x[$8~ C7 -?V f^]o^N"0daA#ֿIDWF 29zf9VG N;O־m|#i*3i},\WͿ~3Vm>Oܐ?募`J5G(vs>CZgJёW~V71!g+rd+l@o7X)8L-̙(}U\F/;ZL?e"[jeO,,/G% >_8Cn <9D0s/e&?k m)220ksX& >9\nz0<-ɧxON|W="˛ym1#ơɨi(]oЍ~~˟B3o?U-~~˟B3o?U-w B5r='m!uj|u"GqǕso^w_^gACM4QHkgZw뭯򖾳k>kk+u ]VuJό?-s7>2YcWk_ꙮ:i SMv@:7WbQy{<}H"?d+7o2cA(w &?ٿܯ6%3j2⑱7T}k'um~;/!G >ĺ?PPyn)S#c*fi( Sk4q+_V~ڣ^|`} ެD{Tr+] Q;Տ蟕v?8>W?ҺF[UoҾ VN* x'8 VN* x'8Ƒ#[S^;^;X4QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKE?0a?b~&jD~E5S"^3Hhƺ ^q%޾ѯk3Fn-?_~Vn=oH>\g%r`m7O7.m3S?0W ԭm+JҹKEP()hXHʰxAXkk23e~;w?A")Eze~WzcIѤ#)?xo^Cuny~ ߺnݾ6'Cu'p+(p)h+Tj3Hcis?B+K| xQ$19gfR-?sW85jR,:uԯ¤NRaӮ~"v?@ _퍉5梿,μV?#/r?W_O[k/اJ~`y?|5x+B-u}]p+ֿ+ּ{ 9{!}c_R?k_˻WB$?S'}K+._E ?47Ox^v)e>JӸ'e`׫D' T̲w{+MYxGY^;{B=s \A$2{]rd _C_ xw= Sգv0$Rr=H?|)O x;-LbV=Iʸe 5۽!OQg_WW1Z@iѯ_~=h ?5~\Jʾr )?}ȡ?O+?؋E]_rk?.?:% ѭ_x—_5o75s"EZRu!?ʽ:y/|i_½:y/|i_¶<.y„*+*N{n;J#NHAв#NHAвZ}l;'V-|_1VK}F U73IImKAw$^/l ;/6oUm *kGa_M(׼Umv="{Q0l1[?ޯk諜ԋylk7;.dS.Alk7;.dS.AcjWP 5^^YTQNQ@ ( (OA9O} b}AWC^s{={KUzk+닫)S^ ʱc[3pAcY,gE hGMoEtukۊ]ks|AVB!_$~P:^彽 '_1WU)Š)EQKOfE=ֽ [P=K*{{M$1ƠzS@HQk)?^KUH7_V#*~@גR*| պʿ_F5SU?2~V%| _k+OاIvaDS$V̿" ?Utֿ ^&Z5{qϣ`pAȯ=Rѵk=KNyi* YNA+FԮmZRӥ0ZJC SJ摊8e8 V WJ#qO3L׬?|G0{ÏZxfe1 sJ8t?Q޺+yDЬr= Gy Es?uimm^7V-ܸa{W7+VцubˁF]G}Vi؜ H R'<4#bTZ??_dWX_'K!%~s|vIXw'pTB̙WS] i7F}Io?!_&)o? ¦A&F>o?!Ycjkڤ+CO|!ȯb}.$̺|j)>uY⯶cVęOVe'8t2܊_I0 0=&\˕Q_?$|#Y ,udߪ#௉ΎVe} / @vTM~\̽h&``\Z]ЅvCPB^ZѯJ{_۟9w |wn5Jҥlǎ7G˭wq|r ^[և;@O>LeDŽ11_PүWu?u*k.\ *w[^۽R`H= PwmW}΃}d~g7xOjIxl|P1vo|(ڠU=xgKѭ1[Gnݵ@-''ү xs:^i&;u8o9?hڠ p߶ω3B;_(<\`\|l4/ @=õƒF%T7m¯EVsB~/6OBӫT}gV*;hO,+kʳ6qGI_?o tn/kNDnooeXmmi"(%k/-Vidn b~wJM\._5Mp~a4FOï?&]?k]HXySŏ Z=l=;`tO H)_b09i";%(מ_Fo?B=ݿA:i)QM5 +[ ג3_Oz CW~2&[UߌIa`7?J7+r4QM4TaG R"C1 %O_C(*Ad_C(*AdVi}^aM@PHH[ט~P=$`6?4~_UVEE4QEjB x>@A$},@| #\H3ɏ嚵oi%Qn.umkP9Wб˝rEZ%NU$a,k9a5FhJJ(4QHkFIOIOiVI)w?J֜?SMPJx?uHNJgZKfm~vUQHi R`?r}ھm/ڔ0&դ+Q `U[l|.Ԧq6!_p"g8~Y~~UsğZ*̇ j2U@eON+>֮Z|)_-ڮZ|)_-ږ>֭~WulS$#>xW3D%3+o<5 m.ofK gS%80\30A\._5Ms~a4ϵ==~a4uC]?}CQ$J0 a ž.Ѯ9C[bb8W4/Fo G8V;Yڜ,c`N:: RRQE!4QIHhQE%kJ3&{P؛IaC=*}_DVsS~aFsэ_~1\cW+???Θk醚hkKC_'־wZ;#5kS@_cWշH]Ae5F}cL66q\fUy)93eٵQc03I4e4xAE^0ANʞb˞pEfxH:q`-Ռ)c>fxH:q`-Ռ)c>2d#+=oax.$%PǸ~CK׮eȚ; &6dsoš|uiz̷Gy!$vLNx pA[$t=C֫\mVE! 2Gkc l@׮#kÔ$pg_wc; z=ֺ,9BGyUy;kSeJGɭ^׮jo6?,(gSH,^C&=!xꁯ]F?b>ClW%_ Mp:}O9 PϮklW%_ Mp:}O9 PϮkg9dY!4/ta_[xz?q}n$p+~m %N3ppGW,ItpEqav\|]ݤV Wv\|]ݤV W"4r28) eStZgJёW~V71!g+r䵿 W3%~}~?\|Q]!Z?ϵ.>}#&]ڦ5y/}#&]ڦ5y/nrKE{V4n20E{6-&ua=p{m{It[+SMey C*z54k4O(W' ZDVU~߂h}A2d$T r;W~߂h}A2d$T r;W ZkVU]_U]s*__91_!~3xcr/O*h|w}?\yю׼|, h] 3%sÏf^/:mwKL*ϋ=l h|]mv Ԟ"2l?u:O#޾?t-V?eq~IXVynUoW* Xn1ιqoǞ sɦxgbq, n="x+C·&5" Qİ7 }g &90{j6et8[z|?~h[7p;t _|}7y2}zֲ~*xyU,kkGYWOyV~*xyU,kkGYWOyVצ\YyBAfRUV ~k2b 8 kAJ)))–(!#ArsW4}:Wլ̗ws$ @5sGӮu}ZMww2A?3RM2E˻ף_~N|=Ţh:nm6!UE ?~{KDt*ۘ,mC* xDu(*0L:4ki^'4yi0kFU}A+ )!I N- @?_|!!bG_A~?Soᮃ_ k*+-sCi_}Ci_} Stex󳣏QT~xoxOT'Ƚ#wᇺsxǺ~>Ekp1G =St{a}=TtC)H#~ZCwk ʹ, 9:A"F-n!E IrH ^C)H#ejWj9YUO޼c㏄=}KX-kczuď8Ǐ~x-i3Tg@#ZG=$R_]5}_tWUYzFL}~uY#%Ό.G&{W'e!g;:30Uw[1Y#2۬2W=_RE:QE((+?kH?O$r_= {={KU?/Vk.yw1~|WZ]/em5ٜJ/bV]}cU2O*=3ϊkVEk[CJ_Ï6ՠBA8A/8k]Z-.t3ZbhuCXb%kSR(i1+ӿf _l-ma'*łק~Ŀ4ZO 8Us}zd^m~w·ANʾy+b}B+Js:W?~tlO_y}cNJ֟ٳ ɯkŭ}#=}.տ3/jDA[z/z qO׺k_y?W7ҹ_o\_&'nZB.?Wm܁?`m?d/ax_ jvoߨZg'~Zԯ+ ת1u?k/8%Mj6z~KwNENx'i^?/Oin` hjGt㑚^^V>dz9;ao$oX|[a +>zJVWoW71mBO[?b:-;G?m?CҼWme?哜>?Tcʫ+* JWoGJ?%*[Ԫ}~#0~{T)ͶP;+|Qś+imc&O1 5ʾ(w͕϶WF'zmNJ_yWU~k{+ؐ_Ml51_/?_8k{+ؐ_Ml51_/?_8jꞾ*SJ*2*_֕WM7I?w^oMY`OҠ_\QER(QJEt_?_¶9kq%N_>-~WKHݫۗ>P]8iڒ` IZeD8(rWw3Y]ui+CqHNAAN7zvQtWɼ{0ѿ6ӵʋMk,\nمxA*3XO'G?q[F~TPkݿ\?u$f* %|'_ M%QMiA_O$oԋPzI7?sڮeM\趡T5_ !iJNT,[/xsTF1y*q0a_ uïjۚ/0E]? *œ4dZ2S~ti[pK)h? k:4i-c%REƯi絺9)E~d[Mgw=mȍYN?B*5 !4QM4-\Em$ҸDE, n"6i\""bpqҿL| x+D XG ќ(kZǂM`plƮڠz R}>Þ u`cUphhN;;GԶCO&2k&4E!))(E!'W?%>=Z'C$+ZpOE6C++1ֲh?#+Oi._YTQE!x KI`2Yw5$q֭~WulV~'|q__Bua(QE%6) ))((4QHi(}=?(TugM$\QΉz+F?ƿ0c#v_Ư?ݮ1tL5XM4QM5_G~;F}ĿZدjۮW>Wg w脯j.s \ַ! ?IݵN=/5xY<5s G%" qN:LE⦣O[^^'d][HA<WQ/^e Nߠ ߠ MYĠ|_?~؞ǁGko4y1)rᶟ`Z~<5x,hbR-nm>eeGk,+E!JɳLc_?WS,Կaq. N=s_?WS,Կaq. N=s]VoXG9rNNFI0IW7?q 319${&ܒLy$-W Cÿ,½_ d?M'T`PF+[Eд )#4 69Hi!GBBZ.hQIXiCHvr: (hVh]ДAW~ A[GZs8-_^mMj-@O ߚ>s$>YG?QEeWׁ9O3{g%jSȫ?c?+W_ FEZ3t}]MrZ+>i.>(׿-qT:}ɴIGAQ\x Zn6_kp# ^:u74uX_9T:uY0z#PrdZ,m,Yn#YbC =5=ayoXYJZF"F{kFWEd9VVnn ַ*>hPLμkrx4Ng v5_^xu8n4봟_j|ʡ:ӯllj:#?M]ώH?SUm14QHi) t Ww__YuR_]mx]?t }C]Ey!Kο7>2YcWO+>0jMkBٿS5WT!i#kاZKZ;6fǣξu>fk8ʀz74'97~t]}]-p$6|0~=\' qvBߓ~}~|`a[}A!l}/->WxkS|_5k QE(kc0>7&XB[ yU?ѓ}nM'p%.G'|jav3G++9Yprl[M{mp-PDgR5Ai|b5-(TƼ\u9PcVi;;J([Sz_ g\~;/O_KSתk@6?WK/fG|%_J3y޼[|I\rLR(QNF*H`rR[%S0tu8*i-"h扃V |ңue$09vI5lRPG>YCMQocN?x{uE~ xm54t@Crq5z<Ⱦv@ 2 wd# ֍r߆i0yhcƿپkoqJLi%mnx>5_\kcRdI,kw0?8nqk0 Zs3A, x6e"h=WB6֛ya88s F koCt+mi0gI}Iz:L+9TPK9TPK郓]nbn3|;ƞ!|;eRyc$3ɮÿ  m܍ZɷhSTv^5E1widl8 _uO ;G۴e y{vlzrZ< !}b& wn._|kOѵxvզѮyKk)đ|kOѵxvզѮyKk)đq>*^ @._sukQEu>]^\Sݩe_v7n6UfԟB~~]OڵYW R} 'n/nxK_RԵW3JYwlG+x.P ?,G?o<a(fq#k&;(CO?\ЯknCB2#}Oտ'G])7q?]_iWUW Z+-k-kϼA!" ־8z?kZOzc?kro Ǭ_a_(xE"C,WW|*ܯk+ˏο3~#B?.kWoo(^'jG4c}tmحi>jwKm\]ܿ݊6MG<5fcFMli$0{+ƯyLҔ?կ~oaֽݬjj>:)HnHZksKeė]ºEP@ [K{ (-, Xc(jlm-,8-`E(]UD ZۼtQ>Ŗ𖡮l[CH. & j-ՌcrvwJtxYO5m'Qawcp81Ѱ Vujv7-#xl}brxHꑫ;U&F#FTd@2p:՘'dg0P2I 3ᗌ.Ri=ķ1)_vg/:]ޥ`{n.cSb)f 7p !` $qPW\mWDd#W??+??5|5?/WǴZ'F+򾸺QNFdutb 9ъ4t3eZ1h|{NՄoE:م~>=jE7ȢT@ `xaº sj}jgPUT]~Z]ޝ³Dtda?#]~Z]ޝ³Dtda?#SFVV"W~||da7O96W~YWOI>3e|{+?s7ok!P ʮ)UK0 'gNԯ幻E (Yݏ`ZXjWY",ǰ9PI=>}:|.?1$ڢD*>@I$u'M*j;^iB|dGR{ t:m٢%7_oj^ӭzNr냴?iG㏉/c(JWv|^AlkGQE$Ҵ)_}[8=Z)'i/*yUyUU}#=}.տ3/jDA[z/z qO׺k_y?W7ҹ_o\8#m+y)p`r>Զkqż8x 9PiH YDЫw~/cx:~E"5 v! 1㈼?WܢG{;مt WjB=uWl7Z|LJeTWU{ui1qdQ䫡V_;OEJTSRKX_'K!%~s|vIXw'\vcqjVQ.H"AN?2+n5MJ3%ԩH?؀EF:[QHG@1_> --M+C!73}Ik)hvx0ۤ;o9?oD8@1LCdW7, <&k$N޹`i4դ\-_/y w`\˙I8Л  ؿdU_nЛ bTo3hؿdЛ 0$0ھW[ 1t~&Eb <`E}ƶ<c-b5LxЊXÁHєOzy øb>V+OƞW]wq| Rȡє"!=E~g^wbRKWVRA5AV TOuCPB߂?W|!a(!R[Oh~֥Tm;`ц;?sFP_;XMc{owk! XuVS1_;XMc{owk! XuVS1Uum+z>(𖑭`G}l|¿LC iݶw> G̿+Qr.9ztS4ZM̸|~b&lMw3.ݞ)6&~-xCν+ f[sM`~ſ|9׵}lnl65J6$NI_DI'$b׫W_\m)+sB~/6fӫT}gV*;hO,+kʳ6qGI_?o tn/kJt+$ş /]7&,MzVP Я ()ERE(^/P/a[_|8 /ZLʥn~ r_(~ܿ.4I_-WTke?)㡣_ͷI֊w#YrTjOxhmuLjm휕?ڜ)kZxdqg=aTt]6#Ov,:.04ͫOm?ϩ[Dh'̜Bk~4)>w¾~]3%Acm: W 4 U=NA? ^~$h,myA*ᦓG9߅O_]ub| Zv-le)))f=k+Q趞 [ЧD(ݘn . zc_!uPMR()) RчR}~!S蕯?J|`{OtSn?Ҳh?#+Ok+1֒=Y_NDg?*[cף~Z|)_-ڽwOo5}GZجSG5O!  :'fz?5 |YQE!JmR RRQE!4QIHhQE%kJ3&{P؛IaC=*}_DVsS~aFsэ_~1\cW+???Θk醚hkKC_'־wZ;#5kS@_cWշ\}j.s _՟\5moB~ʩWב ɼD$¿Ag?]Ii7X\(~?K3& рrԚt$$¬FFX`נ:m^0 Ym"M̴=Q5fDF*I0U8h7>F_<$<0#{sj%N1b0G># uS}?h>+k>#h+!ki&\B32‡Ɵ] .}O܊}i?'-]M~P +T"P@`]}Qufȡ7 8"]:Rꗗ|?uMy?0җTxǓ )wk?Tԅ" `U?>W[Bl_2?jbUG>Rpϸ[Bl_2?jkyMGQ a}??<6<Ho6ylxTZcq$jʰȯ]JXu;iy\Dު~u+mcG_} qz(a݉HX*oey%Kji{lI@wa\W~^VGNozRӧ˧οZJjxw?+?c?+W_ FE^ZT2*[++k'?!__HDuLqGtDG\f!kBWWVy×~dF̜?cjh7e e/?2XL=+Oښ ǃsy5cO̿?J1{B֮~h_uyPI#t#ìhz}e *{0{ \a4{>~2={=mM&FWx|_!~3xc|oC>-?ΰSEk4ѼFΨpy]G4M*. d, `#Y&we)B}稯s|kCyGw2dUOsn>sVׅPKEIoSbʹH1ok_ۃU+#0^jHʾU5X"B03:Evć3?su|\v= B5. T. Tg@v/_$x)!uj}WͿy~cW5y) 4E!k?oA/Zw뭯k=)w][O+>0j%gэ^i^7f㪑4QM5esש8meGj++'@sZOp~k-=+Q_]1?* X Bխa>@G#++':_1`\GJO'o,_ 6|An{Re?z"{gzk?h|3`EK  G`Ioi?vŁsJ;%⑒E*`?Q/m嵻K UчbJ?Q/m嵻K UчbJ٣xhVGS0E2Ujehh\Ua瓰^wᎭ1Am7~X׺\' uo! hG+ƽOBtI\_::Sg`vX)K/u]E)3s;x,}=wP]7MrGV=?6bI$_;#I#v%z_;#I#v%z^XĖ$4MQEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQEU3PN}OFφ<~x5]Q qo&Lw φ<~x5]Q qo&Lw i:eК2= wZVkIǟ־]mK+rdǸ w |A,W#u˅GP+rS@#qsZU赩AJ%Et=UAJ%Et=UAF{V4SETvͺ0nc)5cD9TU>2z14Fz:Mq #=JbTQ_H=E~WA b&o RlsFt*úGo RlsFt*úGexlr?»'UQl!f挞GW?~+6fNt=?|W?~+6fNt=?|WžBN< Fz#CA޴>}O==ЕU #]{ ;ZH]J|y=Y${pO`f\hZmÖ{U {+ uclᢷ]b[Yb.}HS1V|-w~K+ökC&ge>S4]>lFbXίW]hVVE`#!Hk~8|jҾMa qnOˎz:k~8|jҾMa qnOˎz:k\h"K8^¸$idi$b$5 WRg{˙Ysv'$OT.]JQ/.difY؜kGFF,rIiU|!!bG_A~?Soᮃ_ k*+-sCi_}Ci_} U^u^uTXkKON$ A|oE p!_U\U(QVo$rr)kQ'Yo}Ja5[)Σ0 qN^vkIvR6#Ga$z}R?yOC]%7KwSW_ ~)xc 6|̺} wB/6ᧉ~ Ηs<}rp}Vp 2L`G|Z,Z~[*,|eŪxz;g8xU 00a̪U 5zzI Fx5zzI Fx4Uu*2}9&~mypf>YJw2)1^g}?|63y,%aC~ڱϕ5,6C^x;|VLO1l{f|>r|7ZYJi1-l[COΥ*bO@+f d u '9JolW^EЙ+J&*1{аIolW^EЙ+J&*1{аIԵ<3+.P+$RE-k+OاIvaDS$V̿" ?Utֿ ^&Z5{qΊz)QNkO˛i?+״~^?Cɦ_KH֊ɸ͟ݿ$lhLfqc?nISWtƵh+>dz9;ao$oX|[a +>z6w?~$6q=/;$pf|cꢻ_ۿXu83>V1 QSiq?ikVv&B?Z_m Mֺ48pyf`9?l_l|AЭkCgovcԤ0AGU)E8QE-[|3!ȯb}Z<+s&#Ox++دşfֵ Ɉ{ius m^(/kzƷr7-ݺ@`!Fx]5mz;8t#YIUeS Ki1kѿg->m^;i|j>֭~WulQLǛ>:nPqLǛ>:nPqF(}}3(`zQKo}}}^MS[}Ճrד~?_d5`܅uWRoǧj* CAJJ(4)) RJ(}=_f~Ou }=?(Tudz^+Ѯjo?ݮ1?7k?jg]' c=0MSMihw߱ pѫ_G~;Fjh/ֶ+jOU?Y%]v!+ڳK\BW5BOU*::Z:$."xqWПq{ۙ1mú Ox#B?coex÷2bWt@G!Z.Z"xq_hWV.`8o򯐿m/\Yk"_? >2?|ix?X-Pe )lVeIp+}{jA Gث^Nx<=}ԑ bU/'NG+/WG/e?[}KkRT*-Ώ^+~&4֤y$`| ~q|hWĝgHD)h%= /(L/> -}e靿U5je0>\~w?+c?+W_ FE^ZT2*s?WI_nWە%NB>i.>({BQP00R *uSoxמnir) !e$~5_^x;źfp$NٔԶ kuq;!f$Ca_lCXjdm+4Mt>t#I|;B<+Vh}Gb wpJ’r2)Z4oֵn,g7>ylU->m>8[6ps^If#vËK<^g8b?J4m=["3IuqUQB WYmeV Hz8;k("mH@yQBQ*;a2T~gVOU7AW!'/+vD_c9Gn>ݥCN^V숿sQ^]EiK;Qa\Ft׷O3?w=|XCII=<{;z|1 9Ȇ%Sܒ{=䓿WvVJ*v= B5. T. Tg@v/_$x)!uj}WͿy~cW5y) 4E!k?oA/Zw뭯k=)w][O+>0j%gэ^i^7f㪑4QM4QEu>Wb޾8IB={eBVZe##clm|+{+az=Gdyii~JЏC5_R+PAR2kE`H*FA uVϯCk<+ h(ڳ2A"s>0|dMEVfR$R٪u}[CjxMF]uY~Ͽ mnDRBw3 9B}kkr&2rkG_RzR6gٝuitU3KӬK{;8#"`8L-&+-.!0+V(1HPn" t_h!3՛~8? eZޮ>v9׵i5[ BFmyye(QEhk= K?+_7 ׊Z $w_ֽW_bXw_x7=/TcaoO:kbQE--RQERE8RNFd`J4fF ) JGuB ;I>k-#H|A=ղ!Qp1鹲}G"VEǦ"AZG>kF?݁}2?w?o#@/t]r?52][ De|֔~1[۷eS\%d"ϟ^eZ7EDtA Dq֜~0p$*L~Չi)kh #3ބsL?k[EgNy CI<`~͉i+:_Q?ϯ^ao+$Kk;4KG+`d#BK0C%%R!%ve/ATehuI$rMxHij3ORMxHij3ORMcI$Ҋm6R(sMOQi ?һu_ƭs=Z#,(;c^մ;{gkV[v@Z , ̻pHA}K[o|O7j+?OJ畷Y7W uq$ $/Jž'5J8"I"[XIk|g;Pu(A$ncp '{ˇysF+j!KEcۈcֽgǟxQzd]ݔR3ؤv1U+"Ԛ_|Y? GiwvQHb0%T6'RkWO.mN7HՏHq@ <zj+?Co:+̨FEy/ĝZPm-浃EGE+NcZO_:X[kfWql9>j2*)Ql3U*U;S!XcIY t- JQ3Ȥv q׊AMЬ9G`@]x7UOj$7v~8W=]5_?U[o| ?G5_?Q WxoԿ;^#}Wy2CHjGɔ(v CH|Gzz,+S5^]V^ G 559G=M6Q%Z559G=M6Q%Z6}/rZYbI=I8KyV,}I<󋫙$Iy%bԓɪ,ŘIIj(ZuRҷ.!"T ^O;ޝXi 0L\X@ ~.φNd`bGBJ~Vs $%P`,мlas|SGľt[;@`X`&R3?KGEӴoky^& Re#?Piggt+Y╙J(RE-*A,ʒC+Sj|2 ,.Ȅ2>RA8"éD0%,=f7?!x~4-uפz  Qk}n#OjǣsqEwVwQY1,yugWx Ecǟ\]zp>h?LS~QM:;v2\~A:;v2\~A^أ\]NPApQ\W~?A׭淓UU*Yۢd7[+Ŀ [ɪem*x2-y[TT *yEyEQֺyqesA|MK:4+YyYcJ|MK:4+YyYcJд浇ˍc+Կ"O'SwFSo 8WO'SwFSo 8T[$|--+>p^ãb Y𶤷Ԯtx_="Y!}9Vi@++3Ux$>͉p%~KcG OBF8 ҇XF%EqƬ&뱇Jfo _%0+Jfo _%0*q9:k܋&5l?d%?*B_s.EY;Iuy ЩrĵSi^xߏ1=N~VKDGrY^7~3OogӟQܖa+vux;;▊)E-R՛k-Т +>j}H촉kkȤgQTVE޵ 5xᾃqhvZDܵ5R3(@+"aoZk{%ePs5)f ƺړƷ6@_J cWWuRxhKIP"|qF#5LWWUuS($)A KWVPa;kݴڇ6Z}YWF39ZB0Dc$Jc @З?~8W=Vq@ <zJo9B'f׾:n貥yfV+"8}j{{JHOe WxoU^yK/S?Uً1cԜׇkֹ_꺃%as1'ׇkֹ_꺃%as1'fbYEP (Ebz'm?]J )|Ān*pA l?W6%픾db@J7`8 pG2?$Oʽ ǫq@ <zOiҨ ׊'|i#piz嵆UX0 HF==+_nPN.#VE`-# yKpҨV .k\5ƲX]z߅_us26u_k(۵ǮjH1֤C7?j+?z-0'xnj|Ew]IȐ)Tp 'w&c>"g wQdH8;Lf,I=MXԕ"T`^~𵆁ivJC+HAb%e½/k L9l앖7VŎJV=JV Wxoչ WxoԢfaU^y~8W=K淠>U^y~8W=K淠j?q@ <zj+?>rs^)nľ#u;T5)|K=GZHc%HAHPI8IiEW5}fSX{+cY*Y0dzj3h͆lWƲT0`8 ?qs7?j+?>ԙyoz4׭ts_bvݹzߊiZOss1ZkR(wĝsᶩw{ Y~h.њ&l+)9Z~|I>jwQl²ÜWU^yz_5_?QAc72hZŎ $a_*r9icc72hZŎ $a_*r9ic%y5y5!)QM4[_ ih2ZX!b(^/ž֝v%Bx&.@8R=h׺nJ0pFy KoK"^vm+CºJ)4N)UTCEIE(4%1rAb%8B)~'U Wxoգ WxoԿl?*O迕!pG_=HjƗR}Oi ԇ "ZBq}U s‘ - 8٩^GQ |{'/skzV2?,!HC5|@O^Bm&d2&Y#e`C)2njRkLR$[OpGK4,hmQA>ƟiO{$DI$g?|!?B4 +(! I%@$IimiH-02Ҿp˶1r?Zi:]呱m/ &GI9i:]呱m/ &GI9Y5F] duxMxMehE) Ogw%I!Wc[SRY'3Fːse9psc[SRY'3Fːse9psՋl2D0Ctۗ?܇?^ Wxo~8W=W}x*eʃy?ĭF\-b0F] 8$ƼčSVe}XVUt.q}Tu /TYF2Λgts" X02Rk:$S=[FdI8VSw y|;ΉOnnљ6RN7rYLe)b~a]ݺpGkq@ <zO Ǫ$7f3fJ~*WZDVXT I裹ϊ/|gj[yzUKuemEAĞ;ʻ{@^1P `&EYjQsֽWO|?&wbvwUR\Ԛ_V%,V^(`?{l WRŎ-? G-fK$/9 d8XǢ(¨V%rog miw6vI E N}}<@x>YY[+HwrV@:a+^/15'bH$F~Zm*=#FxQky )ЫnO!µe􀙇r?<՗f ߳5(jV8m$'W^*u"'q;ߵW/x?XiAess"_Mq&I}J Ǜ+d*jjߌ.[A9yVR4ǥx_IRkW:<ϝGE^ok>)Ԛ:Ρvx3hQGW=yu=e̯# dVEAIE)QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKEQEQN)ihRE ( Z(QJ)hZ(QJ)ES-QKEERҊ()E(QKE)E(QKEQKEP)ES:)hQKKE QE( ( Z()E(ZuRRE(ZQE)iER(Z(R(SSQE-SERZZ(QJ(ZZ(QJ)Š)EQKKE)E-RZ(QKERQES(QKKEQE(ZZ()hQNZRpZ(QEE)iER(E (E( Z()iERQEKERE-)E8QE8QER(QJ()E(ZZ()ih:QE RRQE!)QM4(CIER(J(E!)(HhHhi(J(E) 4E!))(E!(4QE%%RQEE!E%))((E(J() %RShh) !JCE)) R(E(MSMQIMJ R7JJ((4QE(E!((mRPhQE!JCEQHh4QIMJCEQHh4QHi()E%%Pi RPhi))(ERRQE%%Si Pi()(4QHi) %SMQE%Si Pi SM%QIECECEIEPhIECEQIHhIEkucuK,똯G|%^)k_7 ׊Z_ cB׿#_ |W +Ro?{כk?#T땮VQEQJ)EQKEJ()E-Q@pZQE(ZQEQE8REQNQE-(QJ(R(QKJ(R(QKKEQEQE8SEQ@QKNQ@pZ(R(QE(QE--RZ(QJ)hQE((u(8QE8QERE:QE*ZQE(ZQE(QEQKJ(RE(ZQEQE(QE:)EQJ)ERZ(QJ(((QE( ()EQKNQJ)hQE()iQK@QNQJ(p)hQE(QNQE-R(SSQE(ZZ()ihR(QJ()åQAE%%RJ(EAJJ(4QE!iJ RJ()(4)(mQIHhMR()) RiCERRQE%QHi RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii(E%) %RJ(4QIIEE(4QIIEE))(i RRQEE%)h(4QE%%RRQE6E))(EhQE4ERQE6EE4QEQM4QA4QM4QE)QA4QIIE)QAZ(7Z $w_ֿExUl똯??-{]B5*^1zK/fGy!B5NZjQKKEQEQN)ihRE ( Z(QJ)hZ(QJ)ES-QKEERҊ()E(QKE)E(QKEQKEP)ES:)hQKKE QE( ( Z()E(ZuRRE(ZQE)iER(Z(R(SSQE-SERZZ(QJ(ZZ(QJ)Š)EQKKE)E-RZ(QKERQES(QKKEQE(ZZ()hQNZRpZ(QEE)iER(E (E( Z()iERQEKERE-)E8QE8QER(QJ()E(ZZ()ih:QE RRQE!)QM4(CIER(J(E!)(HhHhi(J(E) 4E!))(E!(4QE%%RQEE!E%))((E(J() %RShh) !JCE)) R(E(MSMQIMJ R7JJ((4QE(E!((mRPhQE!JCEQHh4QIMJCEQHh4QHi()E%%Pi RPhi))(ERRQE%%Si Pi()(4QHi) %SMQE%Si Pi SM%QIECECEIEPhIECEQIHhIEkucuK,똯G|%^)k_7 ׊Z_ cB׿#_ |W +Ro?{כk?#T땮VQEQJ)EQKEJ()E-Q@pZQE(ZQEQE8REQNQE-(QJ(R(QKJ(R(QKKEQEQE8SEQ@QKNQ@pZ(R(QE(QE--RZ(QJ)hQE((u(8QE8QERE:QE*ZQE(ZQE(QEQKJ(RE(ZQEQE(QE:)EQJ)ERZ(QJ(((QE( ()EQKNQJ)hQE()iQK@QNQJ(p)hQE(QNQE-R(SSQE(ZZ()ihR(QJ()åQAE%%RJ(EAJJ(4QE!iJ RJ()(4)(mQIHhMR()) RiCERRQE%QHi RmRPh) !)QIAiJ(QE%6) ))((4QHi(E!))QIA 4E4E(E#tm!CEQMJ Rii(E%) %RJ(4QIIEE(4QIIEE))(i RRQEE%)h(4QE%%RRQE6E))(EhQE4ERQE6EE4QEQM4QA4QM4QE)QA4QIIE)QAZ(7Z $w_ֿExUl똮v׷$d͜J?~>/|gjK,UF`8&߳Oڽ%qu4d"3 gQΡs:MlYY,$Tk_±eO[ß5G2-?Ϩa*x?ޫGޢeO[ß5G2-?vZ?'eO[ß5G2-? O}O'G2-?SQ?OΏeO[ß5G2-?O)?SQ o xsƨ6y?3Hld~feO[ß5G2-?O}_'hT9T*x?~g(O o xsƨT9T OKʞ6?jeO[ß5Gtޏ?G%~feO[ß5G2-?:lޏ?G|Oʞ6?jeO[ß5Glޏ?I/?G2-?SRfM3NSQ o xsƩ?& ? ?'#7?G2-?SR)}= ? ?{ZM(T9T*xOC絯M'"oSQ o xsƩ?ֿ4 _koeO[ß5G2-?k}7I(T9T*xOCo絯M'"woSQ o xsƩ? ?絯M_koeO[ß5G2-?3P47[[M*x? |G[ibiEVYm\Gsep3u=QV袊(((((((((((((((Q VokVzt'N,GEWC sBChj V[̆.Qܹ6`EEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEVOI_OKji eKH_TQEMkZotu-+ [i*q (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((◎x_6zc~qTQE}EQEQEQEQEQEQEQEQEQEQEQEQEW0}ω}j<[,5ҚCNy7m.d1O`Go_|kq5.(n\= cr8Q^34_<0AB v{9zψ|Hb_ʰë[?}Y 2IÑQ]'|Sc j:qiV0pes ']'|Sc j:qiV0pes 'EO{; OfmYHzzO=񝎅h6,A{p=IW_DX_iLUx乂Fq"rC~,xᯉ4t]&m*ܼr\#8[TQ]"O.uXam.L3GlSi$תg?|!u{kira;e*H $䎽TEzzW5E!Q%]#:K8V^I'5Cmtlgo|eHΩIMV|B֡ >'MW.s6FY@:sO^5AZDjf(CE_hxkǺicvD[\/ Kn\u ;QEy΃Rx=5-tƝCo"T#^sԞ+}sOMfD]1AtȮ",7&B2HE}C) drUe!AQT٥Q^6|S~%y|7v;׶͟߉k#mD3ݻs6~NQ^^EQEQEQEQEQEQEQEQEQEQEQEQEQEQEO&ц= ß0Ez$WMkd"o|EutQEQEQEQEQEQEQ\_ ϦIwsasܫ&8<^_?g$vUqpAE|_ aj=6ڋ,I,ɓJԌi>  >-\x3ǷQe%VtY2|Qm4Q_]tQEQEQEQY#M}S5 q,H϶EgM7ڥĹֲT#>Q_Sx||?_E{fU:궨ȯ3Sq}*X]NDu[TdWᙎC)qEQ^G|cԾ_w7ho-AïEWAEQEQEQEQExEW^'ⱎm%*BN2?1\獼oYEu}N+"R)\d*$#QU>xJjzwIgmv֙@>qמ:UO>Ҿ"hY]nP#;F,'u玔QT8 4QE{_Ozo>En͟xz:6W |AqYŹ"-rBb9+^}ɥCqxv|< ;+io|J¯Gf">Y?ðuǭQ^+ KQx1 q}(koGMZגZZo2TbF<b+? x7SxznءJBAO v+;SѾ2=Qzmhaxke kwUSǗ@3E~!?O [Qik4Pvvtz(~x{M?RY-]4`Y<$dEWE_3D/~apv-EW / GUDM4XĒ[.Č}юQEzh=ޫܥfIe~'HQE|ͩӺ歭=#;$HEWM/R=gޫs ,Hɓ<{(%,袊Ox`C$U Oa(riCU>xNZ)M$r9 _rGQEC~e'q-bHW9>0hCIm5}2Pn#K ќQEj(((1Ggo 3Bچp᲍zovڹ 8QEyD@F/L\cy_QEsgmG|1 R\y1EqNBW_KE|8mV2B&v`?(Q7Mj~ɦLWHCQE~2i_#mN֭̒xt7`dFAh:(((jFL ˷8ݵI (#wZLj4C Pyu$fAU?LQERWB~;|VvVw&i%@;xӽQ^3B+,;(}H>?|Eב)4N$\\POQE|$[_Nm]v1Ĭ墙T9QEEWwc/̑$"/hcMFǞ7I%ȿ .w}2>QE}5:g3ōbXe_Sb;(I?uF5Q_YgE+"Q^C?kd+h^]]'Y_/xz(_n~nTݭJc ;nV:w+᩵QE } |?tQE}#}uO\kqlڅwnp3QE4Kognk>wFdb >QEr~>6K%B;2dʊ(<+>9Yʲ8#"EjVq\kgnIf(MQ_;xҭo ƨ|sꩵEUmZk"WvsQE_ux|?OXI$"*)bH+k_..Ԑ%1OuMQKz]]7?pMn x'9cEWӖGqs" C)(LwZԏ-P1O<(.+Kq_8% +t3QExJƐ,ܫ72~}9+etVF 29QEQEQEQEp?~( 45%{B"&V'Tq>EoX4юoĻG~P (9T>$$RXj֚?jlnS Q^*?߹҉($xC{ikJAo ,?EW_\L 'ڭc88{EVi<4y7{wn&j(+YRkyIeu# :(((oylqa!1c6?~f7>|s>>Oj(>xoLdԠ ?{ow>xoLdԠ ?{ow?jiŠh+6ZH)qpF :h-+%Kܬ&i"l,ܷٟ ڔ;uUVY^ǜa^36Rn8aAT8(/{cwJ@dLʇ©uލ*)ݐ}0C(3;7Gĩymnc<0}H M*mgoۘ':<R(ۯ袿??i_2[ذӭW.[Hfx+h~_^5z(GiѮu]n;K e$z:OIGiѮu]n;K e$z:OIğQ<~ٚN{ۍ ?ğQ<~ٚN{ۍ ?(_~ԺVe%fbRGV?j]+Tb^BE3y)?n(D4'Wee9 B },i$Nr(>"OFԥn~0q/nkh{OQ5)xCK۳('~'Aqiz\ݫ]n1Fňxd.60cp?®{(z> db"^c8z> db"^c8?j?>7𮷠NeDeaq'̎;0?j?>7𮷠NeDeaq'̎;0(~q {$WMhOEbD-<>h^0FQKkcg?~x|0яatPy>!  (j9+sN8<#f~3]WsoW;]D:pxXF$ f++q}Zsy4 9UjG9o~|].>#|oNo4\^d H'-%@iŽ양l/. 74N-od؛`+J]qOW& ?<7[WuܶnPzc@k+dÒ-oK]r[A]})kMH/ Yxű?J)kMH/ Yxű?J(VS~kk&F?{ R;|W|[R}&MgX~ w><1W1?chsmqy~ G}qnudvrA#>Ɗ+<[=ĩ4Rr Ex7Ǜ{~#'&XUѢBB)Z)Z(JXh7o3K28;Na^/<+ CFoufe=pv1#>Š+^A|y0} x?r6_ /O&L%B =7H A{g@yNXH[Y,p$(ƻ((((?mÚ_ڄj~|h^-m&&$UX~P}l袾n[x#au?㷑_?-Qp墊ثm+>hO?p(5{U6Xԟ4'8Y}Ï+*+ž0|w᷊&{d-،a1wּ[x~x=oɨK2݈c}h7 :E鴚XmR6 A8a$'0j~~м3^IF.`I1{+kXWShOG1\FZת+B~g= (~o:M[U;YjS*} {xL׌7lV"#VblSh3vZ"Zi31c,c?Z_1hiϧg4Ō߿gLlh|pi;EyZIkg?_,xNGn/{ֻG:h|{a`Bl#P݃w\W՚bL#x/˧9ă#l|"oat;5ؐ|q֊+ԒxuX>x_Cˤ]HRI֊+_/t ajڹrt<>ފ(&R&N?%˜1QEd!k%vb(h((o|# ILơ?&w(chPЦ|ͤgR>$QY? Z6f&[v'ʃYR(kKqZP,[i?#Q_+~q׿Q_GDU\FQ_?~KjZnQH-_,THcݳ (Ho.Ѵm`zQE|QE{O%~ 5J(QaaxTQEt\(ș>EQ_/~0aڊ(/WupЀ(h}WQƒQա[뙱0q5ϠR8$+c㏃,iV4rF}Q_9ĿP5Q][;>k#"과?z8سEϧ iDuNgd28Fdm.;`&(~?]x?ſ ushZ@ז{/"i\6r}QEsn=]"w.ehr~J3{nW?#EWQEQEQE|#Z$MT7"١BǮhx(cP(UU(e/^ HWYF0rՃ=I+G|%^ huY4}15ghSmH!9۽ Q\eƟ:|^U#*(^}鿵d5ƥP*T-(碊((+7-/h_h]!MYLE&ܟfR;ECim1qFSpJ(,}]4n;mlF/HQE}ieXCkg[B8TP0QE|\ @7; uC%#xʘ;I3+^a`:#4QEej.WO}!!\%!Ey+Ŀh9Ûk j\tl C@BgAEWEj(-,Q(R7(oQE}g@QE|uOqEWQEs;f ^kԻ-_ߙE؟OEO<7~G}0RBgrHI%W6YmiCo 5ڨ`;(5 x1$mSPt;N4,z'+)L_Z5ψ,%͸%%g Llg6;('&#źs10/{+*(|[r?d0T%QEzW<'a;E'.aYnAuf1qEWZDCqpF {ފ(]Ayk51m2E `QErzoxaŨI(f&J1EW?O~m5K1"[K( G/h\4B雜gw>}_Ͼ|^h-:79X}rAz+&Bh9~9_weuJ#/?^}Z?^}Z(jo.#[4UM%Ko&+OH<#`迕}7Ig!䯖l+2J(?e!~LG$/[)+իը((0?hO-|alJѿ:Z(cjP{@kVAXW5? nԡMZ4 ϔ2ʱr)W>McS"] {l)W>McS"] {l(_&[Ee?4\kcUNh𭢁2C h Z!]Arg#]oCx D+h.C\l;<}(a_׭/cxe袲?m?\xI20^L`uGSqqM'y2hᧆ| a}k>'pח!6Ssa=X|4ρl/g$ f`c#s(<<^CCwhomۘ2CsyUx!jSC{o񕐢(Khm2Mܽ G׵~~#^M ܆IVcc]?hZ(*˧gEݫlZh ne3նOoO4mŁ袾W8hz,M}uj1 syk 8>I'8?A|+4=G–z5Ɇ9\ne$cS49e;ŞIl';ڟ]o,|!,Q,U*Oe=ފ+ɿfv/_N`7!@8Zo٧+W&S: ĤgiaP0N0~a֊+K-?P=<,'t瀴KO4Ak{a2OK *r ;+φ,ekUyR昈 _qkφ,ekUyR昈 _qh7)฾P<+f;͟= x./n;sghsS|:G{mdHG 9`q޾sS|:G{mdHG 9`qފ+o+RݔsMl7앩Mn9ܿBNH\ߊ(~1x?(kLb;d I~1x?(kLb;d I Yk:wun碎ާ&+گᮝwNռ=nf^>3.  v jw;V隦{d̸'ol؃+ۿd\xiZ4eWca+袽IuLj6+KuMUv9&?O~(((+μs_|]lgm1#^9P._ɶKT]Bu FJ(oY)4|(0و-mWEO"goe@f Q]>(3q1ih7hU-M'_|ᛈ|7OAEmpt"m:hGz((+&kmX63_}j(g/-~O_~_Z+_)ߴA FjCMiߴA FjCMh% ƑHwqo7ɟk-oRiwpX ~+O?&M4 q2<~CIu\d5D+;*P?^mT⇌ z(WW&]irW?{d{Z˺; 9Jlv?b+v?⅝ӽx^~WvC`t 𶝨Ogit{U址P8+;w,45bƕ%MfI$~>9{>~1xcJ&3[$?yŽJ(:)~|JJXRŷU=p_|uR8=$:n;F'w\+z֊+ |D׾fyA<^Gm̠ |D׾fyA<^Gm̠,u۟4&S&r]\F,܊ׇn~!HtLIupN_hI'r(ԿgzhMR)̍HcAn?<ПNDlڗLdl}Cbgź%φOhFp{=|3^'4[ qapm8 =Ɗ+)Z'z'x֊+ϵ/|1𾽩xŇImGR{T9m'޼R7 ڗ|Xtu+/LAcq}袸߉OSRjbkK[)P̪2 \oK৉|)YA{51ŭ(RWUNR5NDW* A^7#SY|fȊx%\!~(h(((;~3oXwO ,ly~vg,?XX"5;o-j(f#I<ҹ2}|ϟ_mA~/gFyrd?֊+:ÿvtf ػIW@_'څҼOݘ/b%%\z[+z)hH^7Pr=II"uxC+) "+Hc⶞}tOF)>+iHiكO hy46v;2Kd`6x^_CϙF [#߂j߆z'u_ } ődP d~տ OϢՋ"Ƞe8'#(;=ot-N1sboD R'^:[~)cpѢ?kxw#i6wھy |:?kxw#i6wھy |:(Q|WRi]ǪI K0$DBzek|_>ԯ|EZjqB !Qb(^ck Agm0ĝ{+׾8X+mS6ȑE; Iڧ l:5Q"v?9kR χVipo PBC(bh#i|@)|a˫I4۸7!!1q֊+?RU7[/(K1"7h肾)_~r_$#v~(((((((((((((((((((( G?0Y8袊~((?$kş!EW~?)xEE. MCMQ_"ğ= کEWQE|UO qEWڴQEQEQE2x !J:`F4QE|mIkIjv[[O7ԀEUkFﴭn{lP袊(?f8~f(h"~* R(;?E$?RQEeQ_+QEW|# *vOh? QEll FBj{.QȢ+[Kঙl \\E _Ί(ΫSO'A(h?QE^t| jj{fnFQߕQ^OTXKKf Cn((h~ u;UY{ '{(Rk ?6:(oۋO%*oqn3G*(>|yhzM$e .1"~QEt̟_cEWsᮁ=A<8.i/n8Ɗ(֊(((>:Sԏ~wEWtQE|pj3[HGSr{wVƊ(uo h_ g?L-.rْ2K&3vGJ(Ono_hYȊr31*O\`(=5~kzYߠ;iUvG'(hVO1Z&g=I,Ei8/%Rw7UGQEQEQEQ_D/Yu#Du. *(㢊+kU/ZAuUơG?EWi*?߹҉(]|#Ww*5ոۀ} (袊+ͿhZ '׉5%=]`A(,b㗛O2{F&G$zH|: /6e,,M/ H4Q_L_;bSn״Xnwd>=}35|IgM^ҕa~iK`Q^^EoR 4)g|AxW)[E?W7/~ξ𯝛ȵ !g@͡k~&1%ܑϖ3X\<1m [4/%v|bWW/?+.ο9~9_wetQ_+k_+kEM%Ko&xmQE}7I> TQ_,_W d?%rCEG$/[)os2EzzQEQEW ?m)Z7GKE߳o~κ>zn⼂UFH{w߳^[ }Q&R?#EOnct}Hܲ1G #_$F?P,Gԍ(}P>QZt!r|ŒMV<+>Ŋ S|Ce=%䚭yV2}_W~#h?)?mQXk'1U݄2FݎG濭V_Nς~ڐ&@Hd'`ֿ_Nς~ڐ&@Hd'`Et8+Ho9ECӢR]  n>k> |3ᎇE>+o}:E|AJό?+s |AJό?+s W,vp" *Ơ_h0`W?3xOSU&'v2an-:g𞦪MOql3e?Ec(-%HvoF82"#mPgV?b`^TPf$c*2"6]Q_NWӔQ_-~4g|-misnn*f?mbGC_-~4g|-misnn*f?mbGCE| qX|G-Rm`P;̬15| qX|G-Rm`P;̬14QYO |7C_ޙ^T_lk$F?i/o/俽2s2hF2IW-@7?htQ_!k'~"_-d˧jr \I<;nc&];T}{ ʟł}O 6[nl NTv,TQ^%F/H_70E|e2I?ꟼR9>T5'"f~HRE~yi լ-ȲG"R2 ]7ZȲ̋$r!u# b Wl4 hm, ?R[톝]ZuD`'KcEo!^&H(P4%bտ؇O/ xPu" B{ЖыE}-EQETt&*ndE~rֹkD sts-R vP98'_|Z3wmi|dw¨3N E}-ʾ1j>w2}kWPZF5m[Yj﷐7^5o.ե>j﷐E}Y!cɶY2G>R?Fa}Y!cɶY2G>R?FaWȟ?=OSaaQ_|xNWCXZky5Y@N}:m_aj'Xuf8Q_~κWWŘ,mW߳o|f@=f8F=fQ_E폫j? uvӬ#b;HYu폫j? uvӬ#b;HYtQ^- cFcyV7q9*~ar>ЮI*ͦCd *#{~"Ÿ$ZH2TAW +|]+VONuw{>ep @WTWڬh^|  3Egxoz}r}I5#z?7=SUu>k$qUIgW/ݹy+eÿ!iRȟlզ(b͵$Y6V'sM/-֕,Zh,REhaE?O[kb)EYi|+̰6pG$&취9=MNƋX.eI9%47e@@Em<#mEuk4t-WMM?bIyg$*),'EWQE|~#kWJ: E[y]99"((((g> zEM F 2?ܢ+| {GX]j;Ț9DIl0fQ_AE xKwj~혹8vs۞hߏY閗‚8-2HCx(@е}&#xYQFGZ((~j^8m SiVXaʧ{('q[G; ^=C$S#LP9p:pQ_K|S|^;.K K dG*OF4QE|9~,|կm,4-Bosk3'|z0=3`MƫO-ByZG[„b\Ԝ sET߆5]$imזBlX Ei wۈb%f\lzrA&()|W#{wG$-5۳tАQ]եįv1ӏ 5 [NBs}xQגQTd k=~}cAtGhHQXN (x>BԉKp2ʿu 袊g.&<N:{(?hojÿ[p=UtQE}}zL.F]2HȪU /Q]-QEQEQ_4~u]_\2DO.7vYeհ s#'4QEah_>0i//4Xm6\WP@Ͽ(/ |ku5GmꚂ main#I+ςWZwŸ Zjd$3Q)Q_58I>_#NRi% L7$2 wNEGߍǁFa+$ egA# +>_zvVjdȭ#yEWQEQEQEg7@{YUUFKZ(e- zIdyi$*X (+iSa׼3寈-c`1N FQ^ymT|[+JHĚanp_sܚ(O |X_hw$ҴF}y#mn+=?/,H+iй³ =V#(u㯉 j.Pі$ eu$y'(QEpABBе]JJ;2ypJQE}9-LTd-bVV*B =hO᷄GgTj~ҎH/ea*>WnFy+?k_j~ Xjַ3_Eal)@ d zQE_ CG΍.|4<ɮn4[ƚSq ܒJ('&]Q^ѩ跟 gxSU{F; (||MI;KL($Lc|r#AE]֎z-eo!l3d/s*:Th`!!wdt+>19SI{gu>TC (]o>,]=l2GOV!I#(??7R3_Z(&CDR[4[ C0hCRx޼zzJ(?>/1h~/aQriq~nOrzE[Oemw⋇ *#!vXL2Krx(j/%eucy&EFU# E~?fClF㛝A|uͽM6#o ?_ |n|ss/N\؁m?T8sH(G{Կ*Vs)pE(Oz( o<>fs;ٍ][>yS7A>h9iE}{=f$qaM:bN2A |sIz͟H1\štg:d.L ( hh@Fcug >+k+#55$јA)O<(07>^EIsHDʠrIFnRy-a->KNE$,WUJ3p:(+q|Iǎ?M' h@xm|!CUKKecW/ <jIillt2Cj(z(>2xڇ?]xW^GhtIOjQwa]zk)Ӧtu'{(< 7h`GGR#PAt2[GCx)JA(ixW˯>ﬥ.-%7ż`H8 ixW˯>ﬥ.-%7ż`H8 ΟZCaK Qр2A5g;?g/浺4e Z͍F̷3q!V׻mg@լlob7eMʰd~++(((J|)-{snZF2y q+ž"׾ W:jV饤m-*)J+ڿf6H3-Z#q[HFAkڿf6H3-Z#q[HFAh#k|EMkzA[O+WdT!xGU[׆=KRRVV6ɓ;CS(?mw[w\2 5 Jkz]A] pEwC ~gm?(OBhZU4w;;w|!Az4-_^n_SG~]㳷yWa |9x}|]jZgm<ڼ>f;;wdgc_k_ohږO+gǨO_ bḣ;mnijuѾ9p9@>=|-_Xg;7FiGHo]>7oޡf#8(O9t{QUv>b;(ωitDIfcc.ωitDIfcc.h |?aDp[ðlyiOY;]ker59Yar80ϱi:[}knBcAYeG9Knox:s\(uxb*9N +#cm;mU:{?J @^Ogh4SuİS>O 8H| >'|IybX)D'qdsԢw+|<ƅ6eb^Xg#Ҽw+|<ƅ6eb^Xg#Ҋ)'ÏNڞo{`gH7:* }:4O-x=f1pϩ1S ntTu_[ ISkTvҹ9gorI?A_kº+a*~j.zW',I'(~((+?[_KbKK!K|6 %J|>?[_KbKK!K|6 %J|>{scNM6)/ |_#:7R0p(-OO7, sQҴR,)sj |WῈ gekXNIe!Hۜ*(((%DŽ`K3Md).<%o,XΈRh+ i5yxc]w2Oqh<,T_OKK흜S{>XAbHG' Zْ"QF  G' Zْ"QF  (7ԭm"~ mVHME31 . MVM:]JĀ0AtdӭUԫ,H# (:w3IcNHE$@|uwoܹKfbrB/&zth?t5tRT_)$ӷ\(錕>\ݟf){*/\iۮtJr x]]Oi\7[NHUo'9MW㲂%8@U\zcjMO8젉`>U@0+OC}vuΩJH~ȆIm9>l20pkOC}vuΩJH~ȆIm9>l20ph5/_ ,_&F$D:ZF+yQef S[éOxTYm٤o(d 2TV(1|JKtqṉۛ&C-_o2\[,wv A# `(<+0ˢgzԆ,v|^i^!];6d48'g?xFS:啔fq$nFY+Ѿ2vTιeeI=ńƛQer@ࢊ((S_zz9Xg$qU?(+?j_\xϝKwis "2HȊ'㟵/.(Ӯ&J-dE*穢\0[zω'Bn\<p3WԺ寈نTn|I>[w8(sb+e?xDkƟk λJneOkF+KјѦ#o*G5>*x+]f4_Z^1|yR=u߅+ox?/ݵb\Q랠c~x P7vʖvWY)sFzFV "5{(ĭb@>EI3Ehڛ]ZxZٯn 86pp@灀yqS| O_;*G @W_5EEԧ/Ε#k }(%|(ek~ io#klF9 `PC_ > zvYj߈5[-crࢾl/^լoa@ )7` 5?aeuc{\HFA(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((~,x"zNcizзpXӥQ^W~+ iXPi FAdETQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW~qkjA%B"IԔbҢ@ |855 ١$J1iQH ~nQ^7ZcZφo"N#_ixޏYij>~:Ȍ}~m~Q^U㖡=&iz"H%h䝇B:Ǖ|m|GI^ Z#&'aйG~rp0Q^ þu, ۉTn|w _V xa Gm{E}_AQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW~Zs&/+h/=x+֊(Ÿ|;H]֣v6{{ yYs3'$QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQU5m2XVaฌHi:ń:휣bDo ×qX~nYnyʞ%A4Q^^EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQQ]\i xp^G 4QE%ݵ^m7gn8ϦEQSQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE$EUK=RCĀn+\EU(i&[ē+7x4QE\((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((()KWT^cEQ*SES((((((((((((((((((((((((((((((((((((((H]jE$tQEz? R7ÝkGНSRi `"N+|/kS\u=ߝI̠&ONA+((((YOS1XGc v'=sEWQEczo;yk4:}S#?3PƊ(>=Ӿ"h7:ouWOji ʪp>o^QEuQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEA7ͿQ_~R?((}ͨV(((((((((((((((((((((((((((((((((((((((((((((((((((((,蚞i xRVsH$d6QEp C6^]tڅa X]H+>[x?}_tDQ6ь\hꨢ(((((((((((((((((((((((((((((((((((((((((((((((((|ktY? hjiʉz6;(y(3@t J-1Q/@'=I$E~(((ڤ2\ipq,!' QE_ĺ!{O&0M)OB8((((((((((((((((((((((((((((+$nuHyGؐH(lj I0[Y2q?.L}FEWЖ71[Cʞ57 0EVwKxOEUVV1p],ݕ@h=_d|9^@ΐ EWE_S#TBG*z V{E  Eߵ=[բ++4IqaI袊x5B絲Ug X/ uaފ(oωZE棣^Zk?n-6F,ݎaBEWGvĐhKl!2Y@j(V(8|z< xVLaHYfX`:1BqEV?ßOjvsq%!2Y@(%:ng[_ƒApHEW'W߇~huC$6Jb ڊ($?xN7EW|/MK,w0cϳPŞT}EWoEWj4];~QmM:y9x+-ojiMι4,RI`uGPr[= +kO|@Ɣ ҵw,!u sy)>>x_PVբX-H }8(<Kgznaup8Eǀ =H+hkɣ2I,Q@$QExjO i[zmϸAH,QECګWi\nq磋Ov 4QE{Yjmwep&ܮ=A*Ԏ#*"pɢ+|YL/EMYxVUaf {E_l4Qw0*<{LQ^EQEQEQEQEQEQEWu"Qx&آ(Ԑ˹8 ǽQ\֕X]j'XnbH_EW~4hu݅T؂ AEVQEQEQEQEQEQX5|-M5~cd2@EW |vYvnn T<sÎ9+OD7:NLzmQE{E_ xbM.^gdn ߞ6#;c~hz% }cڊ(?|C̆)`t @;u s884QEzQY^(m}W_$eP9b{Q^LGu Ay }hG/_EeAuO) \x2{w@QE{e # QE` F絲mΨ1V袊!3xomm{X-O"N F0Ò@E'ߌ_u}FH"o2iUEQEQEQEQEQEQETյ+-NT,8TAMQ^!~^ xtMWT qE}7otQEǎLW &?W@lE?/c֤;\QEx+λçu֊g`I"'#(}+?χ#ukky.%RۙX1QEs >ҼM~QR6*́X8du'QEyͷg5[ id밀?(~,ѼiEznmn0ꎽC A+v((O \"NM"[HQUXc֊({G4snhڄ_]hr2vN9$aEWQE?hO 7RLKgRQL:H{qEhߵV5C{Qab>{œ}2}Q_@ڥjZMWv7($hUA(n3E,N(5]QCץ0}K}BК(AORK=L˶;$?(}X9`$E*#+'Li_Q]`E H!KdaQE`㯅<7#UTZ]i*l2 Glq(7ѥT|5mjN \$E'u;z-%ՅoT:GPA QW;x$y(cRUT I+QN3ILuhR#f 1EU߇ߴGe;--3U}2pO,#Q^EWOSLQ7(` C=hm?kM-BV+|]T~QE{ׁaxAWןjģ ،#"((wů :TZ}FEH =QE_֚w1ߑݏvc+\MA"{ .;!Мw(A((((((+Z.Ja4'EO$Xa(>!6\k1IZ!FW9z(x𾿩cY\rLRydY` R1EQ^ rB(6aXh,%uB 9QEQEs8^$K[rvF,QG$(Kڻ)rVA%4':(W_ĭVwy{c.T##X8+(((((+uzSM!LVi+<ͻ_; OZ(j(ĭ#ᦕe{us1Cj’[ `p?B(kvokqi^tq\$IN B(~*|iÛӵ859"-cI f zdQE|/>:uy5;xA4QE}-\;$.`c2A ++,~37<lᾂI;wd )EW>wBO/J12@+ޯn{1(oOZ杣}P)]p6(>(;[s[E l}NO`hu4ߴa'x [EW|2Ꮘ:w2EBL!'g++? 2<ɤ{EWa? `C"~QE{wY er\" WX+((((((((((((((((((9Z(7iu'uiInq{88lEΗHiZ:ѰSEQ[0DC0HP` (*5Gm%c)-Zuy| \}EW.} ;D6 lݝ}:(sa]xBź=6& ."f Ke$p9V |;M%iY ǟ~(FQY_K MGEWWIOqGGEW~ğ"kIEWwiLPm#;e~7T3hfMg㧾gDIpc ;z7; E|e hF墊+_B,4&L-J B zEW߶o?0٨^(KnD["8韘 EV셠-*aJKt$MQ_C[koG jTz8(m_>5m[Wm/c<<)A|f(໫)4{PڲkkviEWQE|!Dߴfi ,sģZ(?O[öp4`\]]$N,s(? -xW:|Rjt;=&tJ(%A<aeJ%L vqG$ (xgTѵu2+ @i p s>\&(jk |1]9{=Y…f?R +m?\ S1CmOrGQ^=|/Ҽ#7Qo_·3ʁ "4u9E᎑ ^DpG=Y@2u'zEW~.^el r8h*M[OKO,0آ+{m(!t4QE}EW症1/7x~9+Nn]E8|QE.:fefaI-QˏV, cI4QE|isCW[itqk$j[L]qEWtQE|UMk2ZBBm,q.}}({YB$TkA7vftQEy7SJ<w&]cNij(1n.wnG (.|C#P%Xv9>CcUv+x㢊+كկo Q_v +uZDj h9v9+?|)? [XKiڅ>wunϏ碎1EW->P > RʫؓQE{-ڷbbgCd2zO8W~=.60X-㽽62W 8Q_E|f־ZILOۚ(MiaX\QEq/iBo*89gx?3=c(}xA5=2oBG68d`20{t=QE|/kuK?([Z(v.|5os%w4w|a=+|0W/ZdsڲW/:lsEV',o4 Z->r"+?d/t~>2cԯ&tyT7=aNJ(e7~ hci9Q qQ2;((%ɓvhbUF?%=sEWWaA5a+E6+̧Ȍ@};E4=Ӽ- 3V'5X[P]R5?6ܓ(< xᾭX@p\Bz*\(c\k_ 4I4{&"$Brڊ(sDAY*/sᮙVx-R6KvDvSr(9+h}[Um.uż+dN]ns8E~Z&#)|`@EWіGFuE2び(CA?tmCLM.wutyP#W=`nFw gE .5;]J]&ŵ f אT8#zEVQ\xKp"J:5U 0[ ((|xY\>"մYp lpIʑ(?c-N{z懵ɥ;NTQEhj ,[(WmGWsݬRN&vl$~׏DQ_k.m(|1~QE|]@xL%kfLT~bH+ѹ'$QE}5xG2šiV:lR#bVlc$(8*[C,-s, pXTzET:[fӵ+ kq4H(N?J(5h]ھnmlY#;m TQE}EQEQEQEQEQEPx=(F;/d;|UY*H(Ѽ=ZiNiibC@)ԜEW?Û ^i- u?qرtl=I+诂~+Ɵ Mf^f,lQ*(w-$:Qh?&SEW" $I#}hR(~ 꿴Ni3n-QC/>X4QE}y~eFin`v\ڊ(ԿOE7I#޽`QE}_Mq<5-c[CRB'+čW\s5wK!iVgc@EW/riϦ6gٌ bQ_mܟ>.imfH$^Q_khZօj_[Gs?u ?CEWtRKZIwY2څ@B+:Q__xnž.rhgKԴ|FTbQ[6zXhpYY#3$ DRXI'*QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ^e[dž"nGV ́z8(amy;x[߬u2GU#pd?u#=x4QE}[šVf8o`rPʓ#+;D]D囀+IÃEWQEy{Ir+W=EH+aiSO-J{nQ)?Q^Yտ뽿Z(cO$@(#(>?D%(O6k֒ KmVee1ʙ:(:me&e L?*(((?l+ZaѳQEQ^IU륷J(c$EEWEx?RM7Ñgk@OU~&(4-;?FhCj|p'EMQ_|O@i 6QE}EWƟcFEW8H`㢊(m3_(V$kEgm,4ɗJDC+,袊—j^/m5ŤRGM(g;x$gT5.@$E찭xke":#|?Q_pQEg OfUY vW6ҷPUEW:~x<%dHI 1aF% FxQE}EQEQEQEQEQEW-Gŋk 1,ZD<ۣ>٢+必~[OH6/<Š( @,< GEW~?CQ\E~º֎9: (((((((K2xkTMv)߀X1(((--<@W|ͅQ\U{ k$a}Quiv0((lK0[Z~{}6 wU/#ċE [[C!RQE|gtFAAtQE}EW?eQ_UxDM, hkD-I袊ٿH넟9袊l$֟EEVy (b kwqvbZ((~~֏saʺ(<EWTQE|S4hGE#+j(ϵ6R K}V)$S̀holu ?\Śm 2EWk oC~EWaO]kjc@tm~QEyk/ Q7*(we hŷ5T+!7(%~cQEݫ+Vea ?(#«_Vzxٌٰ0;J(3ÿoh[¸Fc(J|c`{QEx'12KwŰ 铰GEWϟ-fiiw* oE袊֊(n;ثrs3c oʊ(w#m-? E8"O EQ]QEQEQEQEQEQ_xO>r@OBzTQE9(o9+Š(?'?kwNmKbg'(x>O.P8x,CsmAEoٚQ_Ϋv4 Pvfv#+~[߇{o.6ϼI `wEw$cŸ5Q\$K_"z(h/d (V+䏍8?~,^nܡLfF;uO<`Og5}GV.H>+3;E73FUKi\M&3 EWQEQEQEQEQEQEEwMi4HpΌ(CM;3^.ygEn\#j(ᢊ+m !a;>SƽXEVm-%-ı54QEz5xFJW2QG*sEW_g[\xZֶ 4EwV9,==hⶡ L&Y D,#I(ڊ((((((Dž-W]'̏{ ?p[ Ěn6ȴVm@~ =BtQEbʺt0oih&8u7 (;kygvd(-ӯ izOSk ;F͸HUEQ_X߶C3:QE}EURi?EW߱'zQE_Ǜin8.,^BPoMQ^'lKrfGvAGEW4QE|p&[`n!g» _6+߄/+*iVS/J('|@V~cG"#h U8QEo_,)v&4bp~XxYSO ( O]F$Sݬc !vǮh((((((((((((((((((Ru5&'t@ ,^hMSk\')\_EA?h?ivE|UgLQ^E'h)'u߫0bMQ^R ㌜d9%Wn[j:d0O?Q_@+׵?Iu1eݬ,6&$`VP=s(Si FEWQEq5s`&Ig7YhO9Zj]O TK+++*cEW؞"x^Z^hyAQE|yZx ޏ$2mfq?Qgcd!s=ʏSEWxkiNnޭ{ieA#s|f((w=4ފ(袊,(HMpOQE"O(V$kED17bs4"{g@I+~i׾7? :m%ΏmKU9kE8{f(sB.6QE}iEQEQEQEQEQEWEW^CZ(#'-hȷפ+؏G?=`+J(*;'myaOMEWڴQE|u;(Amky&ўV]m}eQϖy1 (/ўNF+>e$bHQ]_msckvo)viTWcZ(=_x[ScMNQ__Eo:?4EWTQE|oFQE_UѿQE_ZE/  ?sEٿI?+(Cwm +7XҚBq\b8C& 2@ kÚ[&Ҋ(S+MOǾ[Kݼvnb 6[r[QO~"HސFf蒨 Q_4>⿂RI_hWѻ41H[œb|t''2x4QEwa r4 jSn%H?UOEW7#IAgwKp>c:E⟶EW~E)^F5Q[%Ocxe袊/>)ռ5LӺx1,Q^5g Bn<)x[)?*(_xS?./}1q4̅c1,Q˒G$p(Ś:x+iZKj_ٽ 3(/s~񆫧xDKKͫ2~vfQEz~_/^=7: r qs@N(em;#޵oncvɑsQ_fKK*+ Phƾ Wψ#[ $gpbnNN8W|-wX_+ws Q\Ϗ?$4E͟iHQExzw]Quh<)J,}OEAn4QE~EQEQEQEQEQEQEǟ ~y-ds,J`d2QEohߵk^:ξS2OEWߏ~Ѿ7+mv`{88N (1Yo~K;(V@O9'E_4j lWmCA9KDB[pAVQ^}_]Iž%q!@e=J(?Ꭽ}G#{; {I$HYbH\=h(((((((_v ~"Cȳ#{p(Q/hm" teq9 EWGyg=|z袊w×"%]WJNZݛKF#p8 (Zr<)k72=X=J(7j+ \u #<$+(*_R EWڴQEPu/A4QE|7jQ_a[wk5k$!DaF?QEWľ%~AKua,y|}Ӟ2@#EOYٻ՛8E)m"4H<rI'E@@`EW+XѼEYd㵹0x8pCg(_/!<3z#~K V FnӵQ^9|?}#k5`U#@8O\f(T((((((((((((((((((*+h.@E(7l~tQEHTP8 EREQECPtJ@cvOHGEQVm-m#D~(((((((+;Xd2Cm r袊((((ze-ݕ/G%b>(*PP0(IcIcdц ?QL [A(yQREQEQEQEQEQEQEQEQEVNcvQdP4QE:11q~QE>((F"(G4?yoeM4QEj EQEQEQEQEQEQEQEW_l#(hFw1G4gH QImo B;hc1#PQEKEQEUqej.M\kߟZ(QEQEQEQEQE@ A* k;kRK}-(((((((((+2-HӦ$FlHQZ1FFĊT`(uQHʮXSd($D؁sQE5QEQEQEQEQEQEQEQEQEQEQL`M4QEjEQEɢd)4i"ERA6?~QEIEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWW6?5]A܉-,ˎAQW>x>6#,ypQEtQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEy?~".uMB+緜AO,BQ^EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW~~-׼%  sOv#Ì#֊(B+^ <9/u}qmY9FOEW|S E&}3.>>{EWQEQEQEQE|?K&]Fs_)?yQ'eT9WF (QEQEQEs{-έ4@8+袊(((((((((((((((((((((((((Gu݂'SEW{CW (8*h>( ? i-VQ~Z\,~IEV$1<:pQEyޝr\SoR?Z(? xÞ+FoV:AHezQEoExúviڬ sIEUx/7hW?Z(/SJc5"(˷n5ӢijF٭Cw.##ڊ((OVZŖ2a{gnHx'WH;9(RWëkm/ 1?RQ]Xk:|WM휣)5ѾQEr(+_mvT>p'}L~QE?ŴEcqv$ )*QEvTQEa.{ i}8nn6u$@'GES|WJĚŞ$i>wuGEUO B🋧h<;^(aV+&;(|E #v^ԭ4\Iq @gEⷁA[ $;R&&2w (j(#Q2(,ԓEWgy]5ϊ ;\GEWWh&7~-5ppo(}чU>Ɗ( ۻ{ 9f X#ieF 2X3(t?hZ΋X_uu9(VOû;k7 ș}TEWkj~_Y&:lQEP;ɢ_6YTiup Ȣ+HnN=FAz([LzQE?[K4ZjRB[[<px+bic'gX@YԓQEj?>-NJ@p|/GEWIowqwY C(.ՓQEEUgXtK3ws2ƹQ\"k+ĩVe HQEw_t;_x7MVm[O1mu+ 8آ+_Yl4M:[^,yH$x$Ɗ(^&tI5McOI;L+|b(Kgß}38}(+)⸶C,.OpGQE5Q\vCU[_xHu8d[r֊(x@ skZvPnuYr?(h~H"7Saq2?:(֘tOkyl;t;EDzRCq+H !@UpNQEz^i[ ^aRA%+i+hU xM~"llf#"2e(o?N1¬@Eނ ((((++~#Ѽ5d.AY^P>Š(KO[[JN%ΡZ(7Y#Wрee9EQEQEQEQEs+|% Z퍌nǮcQETxm4O]@bw>c++;\4Zg[% EW3ic7Sv2P~mEWIF&vvsu4ʱﻆ'=Eޅ6̲*RTƊ(ψ>oQEwQEdxc䈍1dΊ(k>*tMWVm4<30 (##g94QEck⇂M-;8HKϢqf(V4{ ok{+8^khRx+1|>[;oivm3F`+9((]- u/pkE*}p}Q[~<[5-C`ˤ2|=YQEEV],:jRĻK[ Q\:-j([;Y"-6J4QEt&{S-o mчU>QE/|Gr[-6)ou2'(2 "MNm!5=6Feh{n遃L(omzYh!ү ]$@pqEWEӭQ\&{:%[j(p 4O`E_\W یgY6ˏ]EWQEQEQEQEW=xVtO] Or&X)9#+*i=Ă4&(z֙؋бO:A"nFG*SxZn^khV$EW#>&~QEvugޛwoyi')5DoA*QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_|ULj1Gκ7 ItF EKm=[[⿼x]aWi?4QEw ~ -f} E"QRl.O̠cEW~:c>rI> vm\1(G?G(CƱiđ n Gi,=x@KKIpH9(~ |@aH{N2c8v (]u9tO UTyc_CEWx+{"jW $F!2X t4QEyυ>~:}Ӗ[Lng x>%Wؿ zEW_͟u(3Xm}&R˴ (#7>->"ܵ 2LIsR}pQE{]WWƜ.(/Oɯ-{(Wi8J(]W=j( -S^dY&[V;Pl`hKÛ>")B*$jz*#8PQE{ofLhZMs$7mAc(~1־|QxV:tfɢf%`' $yp`{QE$~/d+㿁 f=3KT18QSߑ霓(xeϢKyjʸa"q?Q^c%xQ;۱Ȏ[pڎ(ukOW{}~3r~4QEx߆f閊7>ygxW?ep=?Z()x#DkkhH-^R^"1̀A'"(⻟,-FC.$=]b]EW|wqMGǮ'E,/M~&jZ> ([xی(OB+ʾ6|=׌mCZѵ짐6##r)A 9(#^u7}}uk6u A`pL ('ୗý:]ܚly` J;H'<Q_J~Ϟ(oP$ioWF9.ѱP%vMQ^%KWg>xfVH Cr!X@A#9( >th]:]Z`q,eFFzu>E>o?gVዛ4[d2F9H=;E۸oxhW2ު14QE|iGF|v/ZD_ꓠ1 zEW߃ѤK-ʹeKc>+ʿesR ޻,=qb{QE}++7"_mf(0A+xGֿh+}/צּ1&VR6:(|:|۸9>0qr1+oKǍ~"'<9$a-j$uI}0QEzf{ (dzĈv[8U:d=xEW~{{I\rEIq玡N\p Q^"S1E_u?K/xnIkF0xw͖/~ۺI_LF8Ɗ(Laׂ|7i6\ 4QEz _N*5{>fHϖc8+ڊ(^?v77LItw9#Q^ٟš9SiZhZnXa/3 uEW&E|C'|C,W%pدhŠ(((vާ6pum;G<sEW_ -/]f@hl % $N(_5=k}O}#Q|% 7gChdjv^ ~k;}H#d"Ah(((6<}'XջZY .G} 3֊(Vz3x ]j/H2$8 (O M2۬,k9+|yuo=ZfUҥ,ұJ;{ sފ( =u{3fm!<.q'=h S>]ژ/d^;0>r+>h7Ri0N@I+_?|}e?i17&H0(|'iO2/62r6֊(⟂!FЮ$g4 C (:rood IDײW+^CH/y;Y>jdo$.G\ۣzEWu'ij)?` Q_|B>9|H_ xbgMh V7E`d J(Ye"j{xG$R$)Wi#&(7E ?/{ (m'gka3A(SxoÚX۽ÁՂ4QE|Y} \~%xh`%hvC<py>NOR++ٷc[A[\mF\1)E^5&tho* {:JQE}UR0wMQ_ x?W?c cs?N<34QE}.edqw ݘ_n1߯z(O ֩÷3ףKE$$>>;E=Q^#~; K5su;Ҵ&'! z?Q\Oǟ}=zyZ,rDArX0+_yoYseQE 3~ EuHIcbU"tA|`t&(χ[6ʁ-;q1a:d䞼t+~9=oZ\QE}7~%ް׻0nPq{E >Аh3SM )}zt+뿉_?6v!Wi!?hZ}SLɲe͎;cJ(O x+hlX!v^6J(oE}y!ɨ΁gxaВq(+_ž )-̥H $o8$s(?ٷ%Ǐ UpΙ |ce$# }ԞQEzQEQEQ_&~0:me6 8î^3 (U1߇z_t6j,Q^k ڱi's}2/RR1dEQ^н`dXy 8.jG>(㗊ox}: Df8د!J5R8Þ(\O@V-j6%ĎpFj(_:K$iӖYO`0QEsnj<6a+[.uUmm-6Hs| 9(W<;lieܬo9mX+̿a)h07|\?Py~j>]2:f(~x:<><EW6|U_?P:Ͻyh!EWџunjL|=qzQEx_-Ş8կrm7X8.]r08$J(L?eOnZ\$*QEzՏ`UovR|f(-2SUY,/+\?Z(/xI?K{fNJH~a$(⫏|-u]Aor竼lWq`sEW?g5/xh!(3Iܠ\` ~ С0j 3N.$W!H?>.\7X\G s[Fdu#A+d"_|\EW֟, Tܰ+{3ZBC6ʁEx LϠ+>>|>/-彭$I ϡE~ .uSX[<+&;npݨީ?h(5JK rXQ Q^ÇXSMI6 {!sJ㸢+u ?N@g{[gIv|8ݎQ]-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQY$ycVw8h+&j(S:iNbo|3EWTQEQE|5lߵC:ͻzmv((+RC>>_'}Eſ?<%&}Ckl)I>QEx/?mWI-|?2EZ(H]rE)ToUqy &8Rp@&(/<֩gf?jtS!+0Rx+n?_W̽y+ WQE3[|}o>8nYs1[ pEWρ~'||5}5֌||EGy9QE{OVĺ^mmY#'ʸAY3 9O8(OۏA~? tQE{G$>l? Q^-q3A(l)$ @QExOgϒ~}~QE?odzEWuEWö8aaLsQ_qQEQEQE忴~qn?QEH~+]ytҚ8۷ڊ(Jh?+o++/m|_{5YnfЖybd"QE}GEQEQEW˿! $t[v"麊( LJ'WF6Q0>Q@W91(=3ۻ t?`TК(e%z$%R[")L7g>*xUc&o6{INا~>I(|ZBgu}gEy7G/IԐqEQ_^XeiS o"D㌩Gb(*5Q_jEƁNm.Gd dt Ei^T5O&:[dPze"N>֊('<' \hk/?f6wBr:zQEҼ [篆GEWΟ$v}~G Ӏ=vw(('t(TSrEltGҊ("HGqEWܴQEr[s+&8+?u׋g67|~ފ(((㿅.YǾ8~l̏{ أğj޷ɟ2YNp圃 e(KLOZV9|l* .эQ^ZG]HGI(Aվ˦2&wŠ(@h?+o*߅8Ň/#;;:6^NxU(cß0EW`KohpDcP;EV$~/d+a)ho_Je`kQEx3!tۿ@QE}O/c -Nm\~QEoQE|^co^Dnndq ,IQE>ffkF"Q`´'QEb|g}@ Ii,K%V  (o?;OE6Ja}) rSe+:(XO›&<ʗ?h?iq Q_>jf_Bu(h>7,/?f#? DZEWM'%š EW|t!eƫܦGA&9t 30QExVou}/Vi]GdV(>xLmRRH z(j((((((((((((((((((=A+o/kmIn灾,{0P(#B>:zO{Om̧ +) (o9U4S-i#,^Z8b@;QE' [ȼio.Q. GcEWxC5b&`/26c =@EW?y#`ndƤd9(|MPõ⃝8oUTEWvn?+Z(xh_%Q]$;o%Q_:|mu??~67w!rs4,{g-qhG{s vKYȇR +ŗk+4kM+;>orh|1Oڊ(h?9?aQE'koxwRѯkwr:e##uJ(%V~ϟ/l&bN@DOqVSТRk5}zH0Ie7ʄ~D(߆=~!"7\ B쨍 0(S_x?wgǟuMhбP (f>*GQԼ/8-4g.]bs] :rpQE}?m&Kȵu+[0^Ia b(ޅ|\/X ׂL(csdg?2E⿰]](~(~]oSg+?mMZ.mkݰ3H+l3Š(~/6/FjֺN-ax99%WGO߇4,][SPT+`8Þ df(C䐷gR(#? _-Q_dZǬ?/+ۇ@^+~TQEr{QUc#a Eߴ5oVDM;8W d| |+ڼ""WG<[7|9Xz~t* u3HԵ B+X (,(y'ڊ(Jc`{QEx1ȗw? QE}EW28Mmd-ZiRH_䀲ǥQ__[e~m ! v@$`rGh?֭^3"_ͷ($o;;>(<%zw/2w~CQ^H|\🂄_hWdGNzrq%Wп|/w JfkB*~EKM K`v^yQ^1ijI ̒]dhc(Z(((ki.֒-Tq1B(S/c@ 6K#( :QE?f xx-PM+0QEzq$O MEW Z7SҼS|BБ-̑&.C@QQEz_$ mkQDՂ=)O`N}E|rCu+q`bĜ}:4QEzeQEQEQEQ_4~dxw#43A#Ls~Q] ឃePj6o*PmR֊(H]rE#sE~6ӧ<gW}żG8ülQE|-H}{Mk6/>d?&pQy^hw𦍤zqZY(i,Gg'QExmyeSV[ XD0${EW_?mEſJu Ka+(LוJ(3Þt_M=j+!tȉwm =J(_6׋gN>q|Z(qkck6oX,K|+*E=(_Q^?IEWzdGڔhZKNJB`l?EV? ]kz:}n-emo ˀw0x+{׍b3jTeLbD_r0@TQEyGKֆ<'9 yݲ3*$oHA9 %Wxg9u85U{kl]9QExK>:沒Aɐz ğR= (((|'hwM+g~3p (B1㻿>21kIyAG#.3H GL+0|>{Ar-҄dg .?7EU|En5T\çI#9}ۻ qEWaEQEQEW~é"2t1\1Tz(*8ZŬYtb2O *T19(Q7 ( ({xb^acvd $ J=EW|}yř5N8hohT( ~#x[v6ᙗR8Tq 8EoZ7cg1$g Gb 4QE|k UN+G"E>2x/İi1kP5eo5e=Pv7|%FMYS2HQ_)~>3Zkvwxb :|.p놑QEQ_jx4C]"(5K-{{>!/-Xn8ϣ(8#(ѿh7 =֯>1{{IK+) Q]?Ï{u$zh̚hߍl9EQ_0|dEWמ7>+\#o (3?uMŶc9^ƫ' zuV+ߎ?t{ 5ɷr ;J1~+Қ[KByh{{ (#H{P28QE|A?ltQE}EW?-?)0QE^{|?y^xD&5$1ǰmMQ^y-TcPJT{9s`r0{cV_zw|5}6y ź*ʮ8 (ÿg|[/ET']nTQE{$MZ(Hɨ#(>OEW~W|QUk i;CdXo!BUNpOl/Q]?~!mz:6x2; t(|Gn7d|"(No~QE|WS /((}iN(y|'J ]u(}b"(<K ]B۪|w>\QE|_x9ңαw$c&Ls +>~~ oI5(tn4 s+.`99J(k 7zB^"EB@,X8G9ࢊeo3j3 JXvoy(j(((+MOQ! a,l2ohnPL,zQEWH~36HʆtI }*(S*O:[\ZX=mlX呔/+(^^37>EV~>Qr=Hk#Tq(m9^/ Q_W_E#Q\$~/d+a)ho_Je`kQEx3QEph/[Ld5c04#s{1 +c#-Q^KSWRě?mu,Sy2 +|'CWյ1_}H[eRgP( 7.9o2?åLS)OO+7EW~ɟE4ц(>8ZBH-.&h{\ǀ P}FJ(^yAx;s*60TIE_'^o 2vhUH"4`2z``g'W>G &[U]M 4H#F$ňEV i-ODյGo'kw0G*pJcEW_|=@o+x%-bHp2~cEWOQHSS71U8QE{QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQT'Ol5+{9>7Sފ(2~\\F$Y9)-~QEv~ </4lZ`I3bN=EV櫦j|:s C:FEڗ奊1Ɏ۱EWWo LAK1('oQEw4QEq^$[={[ӫGlj1U++iXְKƞtm|К(gA|1tP|}c1$IEhzgtr ~3&z؎EQ^k+q39'4QEv^#}oxr@tx_Gex6 v4QEl{EigSˆ-W9Xz4QEs^!Yxwyx9++x_?:w B3ElahB"*EW5oPZC;ڳ<#ϒ-2EVƅX:={ HPŽb,I?*1xEI4]^<9(AES<M?Wa4W|͌'EVekMg[Cui2:8 h]WqwtGYn91]0L>(o |}BHiI S6!nA8+u}:Xү4F/:=wUAd9+1Az<)}<e߳v߾͌onEWUEWo2>+Gۯ}c1ٿos1EWkEW^E/4%ؗ1E*## dEυ~yswI⺸ʒYnBS EW]i:Ɵ5il΁ч4QEy.7|;ibov~tQEuUN.t$>;ef'oQEwQEy>L wܓ\T 9 p3EWQEQEQEQEg5W6)I!<EW 7ؒ Ɇ;V3n(>oeѭfǛk h,19QrqQW<=A5e++Lb^O ˱=z(n! !%E(VSz(\op\,W O (xw+y."`w R: hZ((((zNwni ry4QEytØt.+Y'ź$Gm>קLrw*/KD^_bҴ/5w+v( ƿ;X4.m 1 (W2]:$13;M"\QEkDm=ŗ~&#[i^kیr'qڊ(xwK^qkkn a=X09Px4QEVW/Ri Β\ ؞gQEEW/&zѴjLXmw#7X!LL3Ԇ{QE[ a Y9 %.(/CѴNEoE}ExkQZG7hЏ>X~.zQEmhzUzT>EbbͱA$EcKִˍ;VvK ˹X}?\4QEyY7ULuEQEy~ 7{h/sj m1 (ޛts|r3~"(ZPDQ8((((4w#8QEvQEqZk)O?5hn>2`Ǎj^0;}hh|s_x;_,DRHԂ:: Exǃ<ǬhvW+F-˾{EWuo%QQC+<EWýRKw9edL)@+c tf./$ibP}(F((((+TQ6 YE,y&gHǓO.I}hҼ-RE*GSx"(%?gOzNmՉc,elQEox+߁y$Ӵ·wph*(Bk[AL dROQEU߇\vCk^pJQEzX@ QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_6Rֵm?C'u,`g Q^~Ԟ ht-[R q$Km5I+Mյ rDFMQET>eMCKl?G"?5T>eMCKl?G"?4Q^f:-M]$M/6>!lm"o>1$2leܿFQEhVQEQEQEQEW5xQ[!ϕ"u?^x.oG~sB>if>OנEWQ}WQ}QE{}wpOʛ3׷]G}amwa񬩸`#?WLῇZŨ *q^IaTןLῇZŨ *q^IaTEr~mwcQ}QE~mwcQ}QElx;8܌1=EU(?hzT^Rv#?EU3S`[s2U5&(tQE#ƅ݂$EU;m[Nʵ-&̬ hEQE2g1*&76; dc#UKLnlv4Q_ e/Oui>+4R[\+vAbZ^.H} FVhmĸ8"VĵW2:*VPr1dW2:*VPr1dQE{S%GV4> اJ`i|Q_itQ__.|c㫭.v+[IW8kk%ό|uuNB%kxbS*S}MT4ooG$$@ IpJ@ FIҦ?W.{~>!"hLOUr\2OnQ]%ʶ7K>X+wV$&gKmYo|ٔV>HMW_ I7ՕP|vq_ I7ՕP|vqEtQEQEQEQExvᵵ4E{8x8 r2<~.|6t6hgYAQ_x[QOkW:!BpEQ0|Q oWF>^\,q 9GQY5E?to@?to@Q^Kjͽ[Z c,wg Wv'y3Ķo`ւ$#Q^k eW%5Y#TQ^GkiSk0jWCȱDSRp<7ּñ[Ҧ`ԯ&ϑbsy8n=VeqyÆ&q4tDIHR+Ghm8R:"$$Q_ EQEQE_^YCiѷDK[_^YCiѷDK[Q\!OZ'xE@ky)@/(W}_vQ^iP]J2A {0}_vQ^iP]J2A {0EY4QEQHU gh}i0R OW~=x7.Ɓ m̸8"FwРOǯEb4ݡHEᬎ\eIq^̬T4Q^XL2*JfёQE}($&bxE^ź-Ȭx<=^ź-Ȭx<=Q_@0tO|A_Ay0Eh$H)p%1޾a4!6XQn` HSvKQ\vמ)ָ-[/&+{jzIDg꿈+|WjլdME[tQ\!xGÒ:׈IBӫH>2ߥr"J^#-'_ N ~Q\_K(|SlULW=?#_fSj_6>|aia@ws2QEtEq:o }69ᣊC3)! u. SlsGfSBA4QQh,)Ӽ8UZ/k7 t5gc<4Q]Ұe # +PAR2EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEKuW^qq{ow:I!h Q^c5)>>]%"D<:(]Vğ(eP+ǔܒ pFAh+{v񬱟Ua(5_<F3Qnw)PH0+ld. ZMGo2±A*N?TQEy{r^=>%D7p${t8%W֚՝,c5rWpqEW hoz{[+xm9"C \EWy.ix25$?TGך(B"hZ(c _ [T/m`iAr:('}hho_^zcl. %1;!3NIQEz57ÿ d" Xe =9=QEx5~Z gm`mċܩ8Ҋ(|Y"^S(b/G^ Q_NIu/x#U4;jhs2y:9^~#Q^/^ּA]^-% gW?Q^K :]/U,W$~72#뜌E5x|A/Xa}qEWwo3{Q֥ӴTo&NU"= 4 zsEWj_%>"խʽG*EW[MFΑO756/?d@f(:(+ǼM#(LfCiэ<1<|{|1?Di=Ɲړ.@#QsôZX:,)Q TÈ ^icV谤qDQK6(~?TuoK૟O[(?ߌfYe JWK~1[Yg-(/dvFy%OzIbĖbrI=袾i-iumk$(NR2>"xBEa mBn0J:0d`FykKoC)"[k$A?Z(5/|: t[2K,\_ox# =7m,q0ie?¿>(kZ( ȫה? ȫה?խZ(ڥJ"F訠!UKm/MEikM4QA$B+W|e-[^{ɋ.1'¿5~ ^2յ뼇!9"~ ({EQbG+Hy8z6Wg|Wy.F-y#=袾((>O~գTPoѥ`H'@,}qn|;έ-~+A>cw.?H>!x}O\J$T+ (bi=sSF+EP?-wZ>M{gidk8ԾJ f]Oh^}14u/ǩ~ |K>xQ= y27,G@=+(y JOHoU^? ě_SGMh}4Tl}|Cz1O +|XxgNh|"D@Gma:Kɣ]613ڊ+w~n-{yluh$ i*H12+w~n-{yluh$ i*H12(+-?ë~|kl\YǛ#douyqgl,FOaڊ+!wM"%襎8װ牼CUSE KK,qaa*xgKc>gLgza*xgKc>gLgz()u>1UK o\f hzpz^S |c6m0XѸ+SCT}%Mܫ(a|;mkF,} qw*g*]<m(@{|[c:nyGEkQT*('nOrs^6t:RM(UmU8PNܞ+4SӵkIlLY^G5.E4Zk;v,.Cב+ӼyˏM>]>)!W ǒanvSxŗ }̺}RC4%qIV^#.-;cEKc;I<P_|S+K{vӝ"pqҊ*/]CLAHYu#BVx]Nf?$7*Bzj(:#O|q^]\ ?Jgd쥎 ZriU; e,pvl} *͞/sAsjFe+fq(P2HVP9h::v fYbg$e;@h᧎u_Vfp݄<p{kξxUm&g mK0g+OٷAqzA~ip[^[6."YcoU`??5ğ sCZ|I(e!~L$/[)+iߌ: xvKm"ɌBZQé#rAF+iߌ: xvKm"ɌBZQé#rAF(|FO [Mwr!Bz.@$`yg/$spB\I>z(_xP\k[Oa3ykwg!x;N@ qV'|"OØ"fBvA=G8+~0=jI5w lBz.zLdz߳C:]?핳6cOEU錑R䢊(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((-c|2n= \0@+(JQJPI ?+޴~@OT#jh(_Z̀H=H#EWٴQE|n$=dEW2O%  <_7uYP? EWEO/kTv8mOM=P/N8ԔQ[ i{։m.+F(G<+Q_P#+0eaA"(+?kYdத[t`QE[CNdWnXIh(/-;pG!C7MQ_exE]g Q_)~_7F (7Hgy#^ܒqVd*22y84QExޑ㏏`Hu4o꫊(hS|JK/0,6b(~K'??Q^'Ni⋏|61{8dRr g=EW)to*KĄq `+ }Bd5)c9WVB((("5|OhV*_اJ`i|/S%GV4> (8|f+أYf]Dr(OՍ}#k7~ 4 NT{e 6(((( HNJfZ HNJfZ(?7yC ?7yC (Zբ?3g./5>+n'lp+ƿ͜|<=°/>o4 >uv3zePO_%'÷^-fXNnv/Vs (K4]2E>1)IʿK4]2E>1)Iʊ*\(kQmA>C=۷`!-_-~ܲ-'gv, ~mW5 V "o$KURM|j @DH|К(Mc~,?"+nl+g̑! d1^Kse\\Kd] $(ѯ3s’.I`9F5/ KtNta&ჸFߊ((((m)z?GM_R'*c%b3Ȫc%b3Ȩ5(4mP.k+y.e]+sRFu R?f\uڊX+/5kj:܍r` |u쨽:u=Ozsڎw#F\-C*{*/NOSފ+~^kmOz\@Umݐw1g3z_FxSF{%U[dawdAފ+'*+ٖv, %Vc؃׭x^=ޅ{2D*z;zF\Iuwmħs/RTSـ_SuRˉ.-w6J{0((2 IJ\fmNk/ /|K%&fKkf+?0mNETs5akkU~6"TM}9(+3z 3 E s~&^ை_$sD2 .=q(Ϫ/ÖTCƄaB+YS"Q>; ÚZIPeĘpr<]vRH,$ÃvA+?|XdEz/,usYu[/o&iu*y~ֹ꺍ė4:ە rN+٪Y'vFDC 1?"2fȑ #܎b:܎b:(o3Ӽ+wU ń8i?uװo3Ӽ+wU ń8i?uװ>"xTiG3M$پgҾ6ψ*E a'nvotߏd{$WP]rޞx>2I .&?w=66+Ï &D~|39qBzd蔢?5ğsCZ|I(e!^ǭ_w_B9[)+٥{LH!=KKqy<$䑞Bz''N$DI>;g_w~|$({'wUhh{k{)[Juu+[=Rj%R{:@ ( M5υtiI3e O]?~Ji|+OrI[(^Bz( hkV((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((*_<(h7?(o λGL ZA)*-VU#Q_iXx7b6 Ҥ+RQO}+oS|K-,3'|EW~3tBŤؗA#p`$d*΋ kvqJ\eyI~ (I_ 4SZ]jI= r<,3=@QE}gdž-5P}n+aO~QEtQEq,3qhp7nPAe>(?e>5o xo[lX.u?w Я=hG}mB]PV֗ ,UIxQ_x&}N5vQaxی,Hآ+ȫה+/؋FׂETݵ@p`N1DYXㆎ( j;@#3*}c~R0}(sa 7Ò}Jd?iQ:QEo#QEi'EI.ym]\8@u 6Hl%+*_}ҿ94^=4"eFL| ~J(n]K'4'n-5ȃ ̥[8|W|.~7ROmQdARg(w.ʱ@.5Pp9>׀|NǏo(1G#Ԩio\xTf]_LV񎲌ar=Jފ+?xQO5=BXJO( 7]u~k?xQO5=BXJO( 7]u~hj fխ>dc3ԟ I<'56kVXdϳR(V'ƇB8/.oI~IZx x࿻HdU'"dgwh((((/O5|_kK:j("":Kk`e=*_bxIm{:ސ짵V=eAh35M>JԮl5FXa35M>JԮl5FXa+?妉+z5 ofURp$g=}?妉+z5 ofURp$g=}/⟍ ^-nE*I'J~6+z 6j0'Ԟ(<)y׈bhLpZn.XbHkس—~x&D腋8$&+jZ(+ڋw}M;^A(yPPğ 7]Dž&j+fkNאJaT'1'Š++OhxCMhqtlF=e|0XmQiC8Ǡ[gw_6I)l` lcI8[gw_6I)l` lcI8(«hGqhXy2=25#sM߅W5~"бd{desvhS𧉡$Zrpʍ}JmOž&pYjeUG*6pA([cD-oBc 4D )L<;Vzk!5K[УM=,Gh}R鷺t {3  g6ou++ n7gc'b_ (k((oʡ9*(S?vH?gj(m_*_ͿM/袮Ŀ>k کWb_5TkHw?܃J#yx?:(lξ?:(l:}Ͳ3e-¥l:}Ͳ3e-¥S?b7YFptd%I#vGӷZS?b7YFptd%I#vGӷZ(|J|jkj(m{U1B*bLg<׾|Mlu \ 5556=*!Y13hW)9*vFFE*J=AK~ |&ÐtB?WoᯄrhGJ(sCZ|I?5ğY῭_w?B7ҙhT~]Ǘ, 6S-{'_*~п e{)@c=z` _WFc.!,96Tq=l/Ë+#UPêXnx*p8+C=+p6ӕL.B@'NNst OKd`eiʦ!W '9(==߈^3mdy yB񝦛og%,0?8 _`hͮ_xK^hR%Q c ~5mr_ [B-lceLȋO c_=GZ5ޭn7*8U_,xKFխeQgʴph߯袊((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+O}WW6?#~1y{+(ϊ t/izX,ؤW;#ttQ]ãh~j=vѴ*@8(s'ß Ao D7Pɢ[؂=du5?qp?J(; =ZMZRn`(=B_ghu;}OMC%O`UG#zQEۋ%!9򄱺)̚(Oumu;Hh$wTP>Gj(b(((+/^<RK;T6LWR'`(6/ڔW׭{H|GBQ@$j(MW?{U5he9cf%UQlaF~oʊ(AmOqDN 8(?Yw u+ U! cu(?DW؝s~̌9r("/75soҊ(\S63M[R(YB2eշp(Z5hz|ic7rgQ^7~~ il/u<1ϕ"-EV?g/v+ˈ5!j+FUQE{0(((w/|F:Ʒ{sڪf`Hh.{W|N%ψ Xux.b[U[9cTڬ J(|/+߆Ưl֬ ,jsi w᾽qw35-䱲.H Z(OOoGw,#ѶvyroGw,#Ѷvyr(?%kj@O ,Q6*?\?CogobϫjQ~6T(>ƻoد3ڔD4s߰eU 9#/k+:ÑIn=T?סxY_GYXKpʤƊ+ nj|oJ?R }>7tdgiu I N]  (Khl!cXEKhl!cXE((񏇭K9$(gߊ}:,4k8K4V,JX䐠~(xE~4kX/0I-*`##BjXGCFڲ X22:t&+<A_DfWS'Ah🆴HW[+(q w, I8k(+Ş[˥x+)9n̬9VYź,WlbVÕa(#P<;-{jʑB=`*CPe|A[ۓ*DI #-QḖP}Bw 8ԫ8ڝ{L^ ' h ķzinX!zg8<A_DfeOWğ#JITP=p{a%$(Q+^>>nm omʘWO||wN|j70=08K7Di6Yd1^Iq&16&ԣ<,#1? o.uMNYeGe9?]fw:q#2ޢ**((ʂH8`Tޛ* #tlSz(T?|I/eOWğov~-:I崱ˍ`FI~Wx7öƟiO-~\o;r2O$;+Sß}_\ๆmlP$4ls=+Sß}_\ๆmlP$4ls=([k {GBծ'pl9Iׇjzy\Oso%.QNrz(^/?KsA#2kuQ[ x—% VA :h/_ʎ20y_#uOeHa;(v,;Y,Reu#zk;mB{;# r*WR0A?>y}ORґ|hwa&υ/}SԴs#5]l}I~𯁵H]:3] IlWK| EյHanOrN;b+]U̚摤eK@~5{.*MOJH2 Np?sӚ(f΍|;֒-[D\f΍|;֒-[D\oW7SO&0v q2Nxx૛Ty\'<~+ּ;NL3YZy啤;ݜ䪁Տn^𝏁'e&[<rrU@ǷJ( DNn׆DŽn]#R4c'r̋7~lhe_ Z,ߢIocN>TZ/k[U5[S)6Bp Њ(p𷆴o iI{NNvD9cycI5֍M)4iXYȇ,}Y,}&*/f>59n"UYݕd0a;񏅯 N[UVGeY `#Ɗ+ُVe[~!i'KWd`D2=kُVe[~!i'KWd`D2=hҽҊ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((* +]F[MB YF$xãBP_Z6rj]Z1$3z<(3>үKev8r0pʠ<#*.WhY# 8ۭ(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((jo}kigg2ǻqQE[<.asEU((((((((((((((((((((((((((((((((4^Hm:`p7((((((((((((((((((((((((< JڊX E /gs|_ph" ,(J((((((((((((((((((((((((((((((((((((QEzQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_u nD~Eus \Q]gy4{\fZ&7PF>Yv+J(((((((((((((((((((((((((((((((()'}ka]/A(((((((((((((((_ރ]jבSX=qEWҔQEQEQEQEQEQEQE2hhdGRh~|'u[GÖ0 s-H  +((((((((((((((((((((((((*dqzd E?k^Dְى!!q x&(h(((((((( "🅼W'[G ;3/Sz(((((( |UO>6Nw iV\vL''QE})EQEQEQEQEQEQEQEQEW߷+^kEWӾÿKEW7 a[}ClߌgoOŠ(@+G⯊n?i;Ow 40L^OS((((((((((((((((\{uS$0!Iٗg!x'wѼ6ı.srh&(/Qhwi.؉&oPWcqEM1y>94:{vM"8hcNo,4-lhg9gbrԒMQ[QEQEQEQEQEQEQEQEs?<GL2i )LgxVPr=Ew|!MDH]Znvs(h([IfaDQEu? nZ(Z((((((((7W:2<)qw : ٠5b]ʃ=R(?G/ űV}U l.W1o8( (-$TϥHY wğ#QE}hzfYm1~h |%𧏵x5?\w + (P`QEQEQEQEQEQEQEQEQEQE|SOگ=Q_kQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE|LD~ &HW}­o5X4QE|bKO^I6pHj(o-8RO,~%>ʥFu+lfa2I$Y*I#QX(|Dg='K5CL̒]FbvH袊gw4߇\ɴSS I='QE|ˡ?K7} g#o3AET%o_ ]_Pί#4irxC'}y+޾ P.cZj%l';dQX?/xN<3~7q,hCFW+4WO|J=;,>@ 4:$1MQ]z/۝`xOb-t̃09EZoE>!R 1U=F{hU%rIEW>0x)p!ek^USsq~㜐(f>Yj@I-ay@EW?di6ZQ[CJpN<p#p (`(((+˾;XgB-]~UvOАQEyώ?ӣ%W%lY*BD sߞQE3E߅>5V:68vT'lr =U~(a{ CPl vA3OO+ox/+ۯ zEY+[ ;60N8Ȣ+nAuHuoKpxRlNU}EQ]{7^%"D'ڊ(A㋯I+Ņ xmҊ(Img}\~õ;qVhyJ:'XV -7]1(Q^m|?Z>%o6;tU?A׵Q]OS~qmb(K{30_8E}m,¢($(K]3|)]S}Mq0ǵPqԑҊ(FIZEŻG1γs|?EWо .~^3֍%s{QEx_'ž3cmbKXt#hcMF3PzE<_·@H!C'++ƿ>2CWT-00(s4.͎(KO ,εspӲNnC(lfn0,UD;I9$>v^jwdaQ^Cc%xoQ> b]KQxp)ٳ,F9d(Cvۺ0%n"gj(w'ď \iqzsw^Xʬ희Wc7Q4jfkd"G\O -K7L${b+EPpi?Rӟ "NVxǙ I (.!E dף)~(|k_ }jK)Hc9O,x穢*\ r m \\GnΝ!#1žQEQSۙ2ioT $烐}J(_,^}/Er!yFG>ry+~+J]X{ynVhIϾ0H(Գ W[2h_5='ĉχ-ξMp#nƧ:c9E ԖOe[o'QEm ͭj>*"k7l&s>]A%WuFVSg~ʨ@f`GEWxw?K-Þo\,ߴH~k ;v囁9'+ VfjoiY Y'=(s)p kiUVdlǂgQ\}bp\BeD<K}QE|2Z֤ .m, Ǹ`~('ŷ-|7vnVU7lae1C0?v袊?-7o/r y<5ʉ99q(~-{[&M1QQ㧊F>-B"U=dNOBQE}`CGQKEQEQEQEW?&x?t=gZJCwQ^Y<=pm hU(bȣt'Q_Go TnmRzm+叅0x a!fF1Wp^+?Vm-q:.ef{Z#aQEq>6_xw]nG!To/]4N!< OW8=]Z Joou tO/>ǽQZ2x .! ̠gː/r>u4QEzG S 5}[Ak=BG2P"БҊ(~8xW^xi|i|=[<1!UT dW~zĻ+m&IzIF\\(ݖߍv񷃊(VvJ((Ē980x'Lc$+]V/ o?z(+>> )'-ʕP #(| "?o(fxg?~_&_QEJ}gs=EW՟,>-Z$Gq6L݀~j(piw+2GpGy'$J(%kkItKA\A"R%'^zE^/ :1fQs08EWQ\xSD~ _iڔ7BdP*e/+AEW nZ(~?qk׈z$yIIQEy֙࿏>*M^He#`#)m_ (o1/bůC+%cz*O?%ާY-쯐2Q Q]S~7|Y*\j+(F/GrsR+cJT[vk `'Q_%xbOhtk_^bc 'rF@~+o_m5-M&^GqhШ М>ՀzzE&x@mԖKfCnJOz(=.5h VVjff1ñ?x=袊❷"[Ekĥ!Sn>_zE7]|s7nI>[lEW+S|Jw6dQZA9+FݭIɳ̒cwo#ut$h᧌-|w;_CR%S\Q^KN[GVˮJ#g<I#DXGE"(]u.$F!cwȢ+((((((((((((((((((((+_Wm6걩?4QEz]G yx|\A{5ygw?1 {EWXMx /_ѮM&q$qC{>T6O;覊(Ho$ Ju'و' e?(k@ӵ?nu-(ɛUDsՁP@ J(;IEIO xNTZKbUBp29O4QE}K{K._A}c/ݖ&pGPGppEQZtQEQEQEQEQE|HLv\ӈnu6xOT=Q^?ᕟo -֮ݑO''E4&摸xlobr~?E} ß<;"e@:vXEWGjmՅK5M FF#4QE|W0O7~>Indo,3_+mo%ObE"wMB(\jO+㓱% OQ^VK᧊mn4o\фeAQE|JSt -r=H4QE}3SVVjv|v台QExM5AoXԱбX{7}h?)qK᫽k4 9c2BW}~Q_i|:bIJgra\Eޡxx&chnt Cé0@-}udu(]¾<Rp,bFN8'Ҋ(X(((+hF]/৊'bI [vYR6XE$yXTU}K.QE}=EW~1ѭڲ4XTQk!v+z7[1I~G#EWo8e}NTU{x£f9Š(i?(S~g'<^Ť78BȪ@'`{QEQEQEQEQ_ z֬hBYt]6 bETwP K?EWڃ O.(~*xO>GC.crͺA2ǝʜQEd0QE\մ1J9#qe#EQ_mkWo-?~5?$CQE5QTcM֨ &9 yQE1ScrḲ'v(EQ_(r!o#ԉTEE[GTCU'hO6d;b q(&Z04RHVk-+ʏ Q_[Iِ.O@(3⮑U\i7{Y.?o4QE} i I((UE @Q_~vq[|[% Z\3HG0y?((-|-hhBHNI4QE|qB7N~7vQ-(%O~-iB?+㏂^;|76Ş4[9Hh9#KQ_EP x ]Q_?|Mޏ/O<$Pk$xlfr6Ί(?k"oEź-OWؿlh.5]}3Ɗ(w׬a4=Buo$2)e :(?q#YݾG ?#EW׾$wUIEWɿ^"т(|M~W]E-ii-+H[}j?;}_4QE}EW߶ntkȊBWЮCF(\5Ybҭ[zQEQEQEQEQE|Q9^}Q_H~џEV4DlLEWٰ/ɷj(DS\sjkg䙙7|;Q_nQE[|A8RMF}bң(#w)ho-Q_kET?y'M(բ+B:EWҟ/] ñ_%嘖)MJCcRT.>ydcݚВa?+n[{X%Ce#EQ_ WFm4)ew[)> (Kin.xHU I;E(<^=mkR)@8f9?ފ(6żkTeNgȍYIXȬLuEW}LU+&l+q@S\ Iq.-mU>QE}mq մW4x䍃+GZ((((((((((((((((((((*;⶷{X U$Š(|/KfuyqqkI\h\$(3~QEz2aŠ(?0EW|~xÚgg8{9+Q\?>ޕrͬ61hKz7NQE|kdvӮYvג*(Ң(((+iߋiOxX67{QR~̟Ğ!*ul=_AǮJ(z+wAj !kv%p8F ɢ+x [yUm<ʊvcEWQxSw֭*igp\QhM.CR좚Y͛*C9([]f/=Q]g$+K)(~$mj(f5О(o}GvЄA#}x(3A~5}=XSɢ+__w%m*s4NvJmSqqŠ(|3<OQEt7֒sm*):8 EQ_~?/5?І%gG8;;tq (>׺ jZ3YFһuݱƊ((((v7xKC%̖lH.T{~4QEx7S[{sRw,<{)ǠoJ(n.eH`K$Q@$ (z( ZFWwPIˁ Rab:1_py+((m?ig!$y?%4QE} H#Q_ ζ>>{w$K72>f;Q_ooehXBI8D@Q_[_oY֗Z y68SEW~׾=m$U_21d>QErߎ.|("yms:';R[#Ѓ낊+(jd6xT<} Q_Qu7(gN 崜wd?O(ٻŶ(WoPmBG(>Q^:y곭fYdcԞw$ (0mniA&0u\z)pUϮঊ(o7 ٨#(Zֿ ^&(b_T)w'4=%u/c#(hм-;/ i)Ft}nO\(qAg4 d2]*T=+ TQE|mZ]8=j,)>a`3QE}EQEW~Cm㢊+0O{aiTTQE{^Ym7hF+/S~9i eL*IJ@k4QE}EW_-*TEO?GRE'?Z(ע+ll` :ڀO}@_p袊^('i5hǪؤ;o/QEkitY%XUԌ(?گŖ1_cEfd|zϫ (س@:]NR7mh"((((#[_xѧ:gFaK.O-EWؑ_rF0 AAQKG]I8Š("D5TEUT`;EW;x{q& ڀDscl{G=+?:.x6KJx̹`8EW, L䡢+/؊x# dGUB?袊6u|?&/-4뉡a.#?Q_.~uxSQXM\w&VʨlExCu9 898=HQE|q"ύW,6.$#2FQ]sxw] Cg4Ӑ3H>(GՅQ^2 X_-9/= Ϩ#Q^Z&w oekY\*;(, ώh<@!eKVfΣ Q_pQEQEQEQE$I_"z(kHW?S-Q_8xG&|_+>EW6Eqk*M9#`FAuQEIѼ+i*sTJ!(Uos2E׍}RZ6s{ԇms+_x^+]E TzE~M ?(AQ_= E*圞;(n((~8e/)$??Ryu؍!nV(ߊ m۝Z|ImkV"aX+"p +O6k3qUku!c(\-Jcep҅t6v"s@Q^EQEQEQEW^;:|w8L=$s#EWџ >zFO=Ę2O&9f?+j<chw0\~L׎r)\v+sׅoG-׶~w3`F(vEkxBBt* '>QEy^gsz]_EF,*XE3EV-n]CSX󝏎@Q^m|1ǣA;[=.1嫋r0: {QE?f .ƹ{KR$tkW.r98 j|N/FydGyP}֊(`$(ADQQE5QEQEQEQ_5|UnuڄuԲyi+4KhA+pz0EGO)?+/6hjGwNXz()~Ei+7"NdK3 ˍBQ^s7~7=މjNH;J8aЂ:u(|x[x-HڄG~QEt g'5U5x=9r#/ x&7I bA~Sd('?}Gmg!g *۱EU>n>&m9j%6[$=hDY#dUсVV(h1%֬5Hgm1ȹe5^+$.]J`/?CEWDž3*XݏŠ(,> xῊ O\n-,-;2#dF0Q^=Oyk6sav\q؃؃@4QE|>7&c9 v/[c3ETW0xXmk(cF V{"q}h_ýLJΛiH{'q$+7ρ/>:&=f9ݻ*m\V9Ҋ(~x3Qm XkB̘fOEWq:}@ybdsEWCi7\YoV܊1{EqKe;K+r,u-f+J\A.٦JB./f2=QW|W6]x:;}/V8(h_#K-_C OKF[dW.HĀw+UP=Q^9G|/־&Yhp7ZuX+odt8P6F( މsZ-%Յv$, }@+Ͼ7Ӿ#H Dg);s0``=7=$qmIUW_5wEWm ?0xSP0C$qI *sEWs~\Z<֐4RfT¶NJҊ(~xR}1k3v.}&9eS=(9TNQEW_ e}kD=32F!Q!EWtQE|źA H@vkpS8!upEQ^WD񮋢=|NQ\>>}kELי@ |r <Gz(6iv^"o(خ;WaJ(o?FB-WPO=-b,.s0zEWѴQEQEQEQEQE|!j.!";ydixN `w(k⿆<_Zt-⼽R7b[=hgooj~saq5؝.;yȢ+(?WNj5 "M:InGq.3EWQE|7} x58-sw<J,cp OlgE?Fmfo-r [HohQ9AEUtω";{Źٹ&QdxÑ+χ<57#1<^/Q+[%ljZ5cuM[mXQ^@ 2Ph;_{źw+O:z0c*&5R 24QExޱ;)}_w"4SD UQ]c,狚KăLGUUN3:E{k?u]\i+r'(84QE{fxFҵ{d,Oч 9EW˺? kϩ|3;[*b\gҊ(o|ck?Dz0bݙ{K}q+  Xi;e8^=I$Q]QEQEQEQ^_C|>~$x6I,`. RUcEV _x#ᶑZ[im c34g|=vEVWƿo*$am5M㺓 E'Z?a2@0S,jR+EWS~rÛ;MԭY=ާ3RIE 3X+ xN jM{hfٙ;w,÷Z(`]|Lѣvmmo]zS8"( mHk/ 4IEyc=W }qExcōWź&Fu7iy`F'8sQ^&}{Zf%ΡkJHEw p Q^c7*>o]i?g#/ݻr.>3ފ(i+3~>$unO?cc۟Q_CQEwƯZ9QExoO 둤Q08޼ݷ(/E~TX5{QxQ^η MeIŪ_jRG#23ҡ˾ gp:QE_g}^/Oz:t)HдzNr~S2GQEXE?]ď rypݏJ({N6)-3k'mY ;k %H. (g/txRB,3a>2?PHEWκ'o_lc'dVd`EҧcU5C~!]{6oodјc9 8'Q]Vo-CK.,n../Z)T+;ռI?%j= !C+ާQEs*xX!όOli*>(#It]\4r@@1EW?c M𭃒 iB?g(ӬӴ[8v,1 訠? (EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWxGŦNzڅēʐ''8R+h(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((G`ɢ+{s¾?'<;=ԗPn\Kl y=Š(ĺ"]S^K+ (+}Ścjd0c p#;EEQEQEQEQEQEV|[x'k:nEvQLt#W$K/5̱;EQ]QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQU;m3MaVf8(< ݏ g 9Ē7R0d%8+c?eLcxdL뵈(>#xKK:wP֚H^袊h((((((((((((((((((((((((((((((ۿ>i j[>n4QEzQEQEQEQEQEQEQEQEQEQEQX-^ |IEak,@3N8ʊ(^tz}*dOPPGEVQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQY~&}}W^,z$h3>vk-%Sef ?v2Gj(((("C#mDR}EW//^}~`?6HWS g;EWUEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQETw?/QEQ%;W<:(_F@ 72av*Ÿ9̚.yqy ܽɒpeq墊+(((((+k#oE[=>-Q^EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWrxw /eay ).rHsQEf|sY+ UW$QEv&c7CZKh&7*ȅI3EWw6c7w" hU<}+m7_袊H?mEVG>^ goK{n^a3+袊((((((((((((((((ƺ|1c\[qrtY.%o3+?gzĻ=~WKYTI$׏Q^EQEQEQEQEQEQEQEQEQEQEQEW#LJv tQE}EQEQEQEQEQEQEQEQEQEQEWo՗ĽJonlⷺA I!ps?QZ)oiHY@ g9X(:((((((((((((((((((((((((((((((LkxgHb xE ?F𖇿Aufn (:(((6@ą FF(槧j\u@ܭ墊+ʆI1[QEx_jwvuQw(QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE|/=SMxgZ:e,g  v ,c(/*Zy2ZhJCq$JwHv4QEfO_N4:f"i>`?Tp߀ z+ [n%dG"(o o]&Z&Iۆ##%W5:kOTҡKb|pSþ'M3ıڨ ~nQ *IzcQEz*|B.-io"8YJ)K' Eh_oRKɠ#*E F((O Q_J|r~o7{",g r*Wf5#K-BU{ECYѭtt#yd7Q3C1QEexourCG֟-֢4Bp;+?)x+^*7זbݝ;@Š(<xgN4-g{7}=O (7Xe|o3[MdsGOW{ǿ6'Xma'Cn *&a[ƚCh- %AH#zࢊoHBQEv$ |>kKK8^{(vHQEx?o-x ՊEod G|~B(aZ>aR7S=?QEWӾ״6zƋpi7BA؊(((>+A~x]}N7CmkM!={{QExn7wmN/ XǤyjqJ4xFł[~koUKn ?/Q]_i>ֶ))E4QE||K}MIW*ldG}}QSi?oo^U-n$񰔑Gp+[na%ȇ*FA E-QA IQE|o|N H—f<.?6s׊(Wƿ"~5j"ӟ4i}XEVh=BOt3!Rat<(18zdh?>#xRӵtXYv^IcEQ_;x?toZA! RB],Emzu+(sQo>ijbC 2U}2\px4QEa+)dε[\Џ2h%[xu9㹢+ؾ S&r?cm[2۶磩ؒ+Ѩ(_~6t4-f." EW*r+?hj·f81rk+#w*>9sc)lK*0BrzZ(i_/,Q\wƿ\xo–)x Sjr>PF2;EW.GAhuWk`pQE{-QEQ\|aW:޻)Kh29;OEU5+0DqYJgye!3ER|_ݾ hPwI oe"P7EWmP:cc I0(|5s$O[v>EWxU|^FW}Ԣ0BxՎ'$+3|#[tlWN꼀AOz(O:gמB XnnAcI+>4_ሗ{-ٷ~>qj(W>"xMc}&o,.֯.eXcEGOǂ4X.Hd#LH~RIPz(nM7ŧ[3ZiG$yf#I[c+ xMW\X&nXv (_y{X. I 19钊+/o–knx@dӭQ^Ě|!iCJՒH$#J?eRۼA?Qڊ(o/~g%l6ucvEQ]_xᦍ_^ LAgAI=w+ξ0|y~(>^c Ȓ61᝹c<ࢊe e'cw$RM֊(ysj>!NvBR< F0܎ Q]QEQ_6uO>%Lt 2ޯ,&aA,HQEeNU}G~{ `xonh_^xh_lR܈ [1"t+ӠҊ(DWF 2=EQ^O?ox[߆R㍥hP nTNNh|A? 6k|gNFռYG"(cbvs[e\ۣ83ӂ0y$|4!-–CdC=+ᤵHiuX7Eb1' y=J(|wxO1,s7 ET_>#[RXYo&.Q?D(>aBxVmoO>!M"/rQ,ܑEW.+h )"q9EQEQEf\7jXZ',vw$ܑEW_ ^Na,p*4zhdE[_,w2ѠӋ-f1HQ^f/A{5Z܅A%88oc"(((/K_rc21'EWV?/|IօoeD=IHVn(4QE:~k?4s($ݑo(uq=bq "iVH܌A>QE|__񦿭|@Jܤ NyQ^?njAkc"n_+)|A~i]_t;yvֱy1zԷaHm+?1>I,DM=L~BTc>QE\ǏxSőx{B?-9 J:g=q(ˋ ZD=A~QEx/ğUi:lvF ,z$ hwƿtoj6^Wq!KL0_=QEw{zO !5[-O@x9° (/_Ǐҵpİ4[اvy,3EWէDmbԵm2cl``-|MEvT|6#ko#QEl|3wVxd>ֈr8+Z((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( ք&oYI) NBWv=(m-, qE¢(m/[]x3L Ƣ[4rezE:䚏[x厛$ֻ'b?`>( xAyv ױ4 00M(z|6QEh#_sImu< @ꪤ>QEzWM7"f01袊ÖEyP_ H7.~~QEt<7kkZ=K DRP Fဢ+OأJv`y?t4QE{c$OV5h?RoQ^qoCQE}C6_Yĩ,ֱ\(f$p=+{ks_6b#aCq=(7R# c(x:5Č-KLqEWVXigCm,QF EWϟnxbQat4r}pH+k=>-Q^CkcJ_3ic]QEE@V,QFP1+/kDsancGK}T24QEy/E-t)\gid.ܜ šƯ,ϖ\{`Q_&ƺΛSfx.?(O۟d}z('DQX_?ѩEW~ğ"kIEW|x;EW.((?<[ =N%Y&V@R;r;(U T`ڊ(ik˟})[.fǮ1QE}iZeipV,1FIOrI+{_+נZm\$K p f4QExC]W-nU+Q<'EVMoß-|ycMa#[ʳlܐOP`v);QE_ h x`f&Sb):`>Ɗ(b((+a_:(u֎cTV$`n+?b ڍZD+= vƊEQ_ |}Qj p^ӅV,Cdn:aҊ(h͠9vH #fΊ(3`U/I֖e|U} -O+((VgkmwZ;4(/ RҮm-䁁]2袊b & |l㕇J4QEw_me+?cq2E?]Ueln/Zg˓x>dD =qEWѿ ~5Gdžk[ ٽ>Š(M((+x;?j GEn|Evf\ti,E1G1iQDDUP0Q_1^|Kjkpt\dVVtcEW~Ot7,}#vEBEoNzͽ n3b@#QEy3X$Wԣf]H3? (sK/ױ_Ys(m1QEOlּSs Ky`v@@WН3+j(?CTILr3$=v(-r1EW]{8]0+ſeHw D0|@GʴQE}EQEW<G(\7Ru8e(K|/kᯄ,ĢSoeA> >(Gt]WM6hd: Q_ ~hlWZT?Kl?!袊((mrw;+m_:31E'+| Ko{[I&oHEdnƲD ЃEWϟoi7E_ެ<"N[dQ]쳢IaR]!_)&zcTƊ(>zž=Ӡ,&g%Bܣ8+RT)[n ?Q^Go˥x_YIie>²跢+gz_?-ZK;e![Š(--kYR;[geFGbEW߱G_h/H]jE%.*(/((Z(KoQ\_$h񏋛P bXZ BS _(~ 9dE!qEWw-hbBe`AQE_O( ;ښ60 =V.>F+>Q'eT9WF}A+ o&%̊si% O/$P댖)+a"a NEy6fa~EWj_|{cH4zHE m,|-[Ȳ,vC4QEuQEygw?f]/[pJZ"ts{Eo|XI;Iޛ6h_L+AET߶o]Xn#ʷI'!)}QE7Γgi系fEg+ ⢊*)O?*XoQExcÚOh1X27}(֢+?i|SgnTu>S%Q^3kzt^;ؐ]q!?(+#%m-u9 "h$'>QE}Oas}#eR+PӤ%n ]j(\2h;\mKTR,x(SF{Z(M|"EGV1좊+C~ ~i%-/uiM30f)d+QE{)O?*XoQE|-W{}SF&)PT'БEQEQEĭr&Ԭғ (5(5Oԭ^9`re:(~x xY>%o0!A8P}@Ɗ( =3>4X[@2~~ (MQvArQE|O3^{oTRDE\ M0G$d(ß,7⨢;.1eV QEW}EQEW5}Wi5! ̍ذ(mUZ^;df:pŠ((<7GY\% 3q{QE|}[Y6vr<do?(ۖk_|{(fs[:ǧl=%MQ\e[?/dE֫,VЦy!]]=3+?D%(Q쥾x Q^A:H.`${l#EWTQE|U&qF%Q_jE䍌O5aFQE}_ju=k4RtaGh7 Gyu"Kg% O/,Q@9EWD)"FIv } (y 9Jr(e`zQE3gY?&ėjsXPFs+<[k ԴVi.?&-N J{:EWQEQEGݯQ_@~ZLڷk^KFh8, (؟6c[HѺ=pŠ(ho4q5A!NCJ]HTEW.J+%imv(bYxSR̒-wd \09xQEQ\w~ Eim彩3؄ EWýcZ\)r74?3^(OxKþu t-IN8<sEW͟ pыEWMo '(`ᏥEWjua5iltaQE|JG %Xw,[$4lyc+?f?>.YmqY\=N-*VVc|dEWQEQE~k/\Gk#F8I$eŠ(##Q_3~zx{YtoQ.tEK͖E}6T*vE_>'_|l墳IY |͎6:r;qEWc~Ҭdqhv!wae*($0(#_@y,j6(m1QEJ? +ۼG'ڦ5?Q c+_–> 뚿}In^>Gbls@?(QE^hWK[heqE/uoHwb},*`@"(((of{_ ki+vV`6!C緑Z[e PaEWCik5ԩ (dG8TP2I=QE|ApiTo֨r?AE%QEQ_!~ۚDúmkB4n_$ Q^_ Q3Z1 (v>e?7Pr+cß,7⨢)mVxsNOS38g OeQ_*۟9w Q_Z{@o{E (74_U-~ѤދKc Xlr'(l|2:tӢUԌ()K(k}M.4;=>&1p1I?Q_)~ĿP5Q__*[GU& MQ_ Į73 { S?QEc6 i JZ(/u+VGKquu`e(z(m[f{ñȭvfkPQB~4QEzM͵ҔH^ die+袊(((((((((((((((((((((((((((((((((((((((((((((((((((((((((WjmGEԷThd(p8?Q^t?`:?.#״(~[Yv#F!̣QX#~.MkĖo*4 9Dc}1h 8-,Hmb4TE{(ov 7_Ll[uՇݐ`C#$4к x~MIkU?l}NMQ]ˆ~0;ռ~M R0B 'j({Ӽe{ XB֗irQE|a­r!c%FBHr8cEWk|8W~-9˥Fу;|%l3QE/~ j,tˋ9Aq hFbGʧEWоռ[Q<=iFYadHE' tQY߳?u;L5دY^jI@QꧽQ\WOŞ94+ i_nHo,v\EWj[/iV)x-"E;YP28(?hj,Uh^;cH@zE1C\W3?bQuΎL0Q꧌(4Yb٧)gyϩ+|1^ ] H[(HDx8(kx[Mo+;q2A23ᘪ d(Km߆J%د,W|(H{E?6_tHLz՞M\8;QExOl>;1'MPwL\}(mß5Y|pٚl'7"P䷻c?ޢ+_SMW,=2˷/+Y$ (袊(Okɴ;WLBqsn_lmoAb4Nr~y+~+5s(%VqztE_~,N ͵UA&1wSЎ (O|pNi:Gۘ U$:gϽQ[$`!y;bbQ_OqMi 8Q$lNO^hER2RR0AEW~? DhekRzBrF3pAJ(mh/[djGi.X2(xN4o$Z]ٖO#$J(+䟋">k Z[Q!|HE=(z((W /`+}oOfkW!$V؎ =Q^_~Y;k4KS!!A:EvcX׮#־ _S{Mw\<,r:(9s3[yKg3c:ESx^9km;]<[T˲ϥQ]P:Ϳٵ [rE_iRA(ZcsW .ۜq(W":n-SAsǵQ_F#w7vn.o6 &hw;QE%ߌ?ukVal6G@) MŠ(3d"KH~iv>EWBۤxV2h7R+h PFpWO{Eß>&[&k}7If "Cr ,0FGLEY57WܕI0e`EWwEQEW\ұ v5K{uG&_w p99'Q^_Us,Vh'c9 A=h9?iY!nTciN?Q^j_[?.PxωNJP0=(=!Gi+4l3|Lz#$QEx#h)Cf)Y4BH9'ݛ<)O4ZP?bqQEu5#L/au"s`:4QEtbRA+ɵ_&&ɫh5<#FrUGCQEs5|V*GcSз,͂qרɢ+O>'l1HiOnڊ(((-<1g?o]%!x̌>(?xh,T#˵UVT01QY /xxq$I2 t@;v p (.,4,%  0W8+~KY_Jhϗ,nFHULҊ(|7r.{o mTv @Vcϣ;* |GZ.m|0w'LCqg֊(YS_ 5@^r`=gbTOj(fk {˩p˘Q(9F#QEz1$U(H+[߃x]c}ɷ*mt.X܍#=(|iQE}%;[ ֚}J._|;n<''Q^R4o;/< ,Pj0?o\<W1k_#Mk72ط2G+;[s(?x|Y%ZA,(k:+Q:  azEr**"U (WƟ |{XiruKk0G=apxh(((((((((((((((((((((((((((((((((((((((((((((((((((((((((O'G@+Z(((((((((((((((((((((((((((((((((((((''Ym_oQ_lQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWï< jQ_jEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEH3g<EWGEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW9x5CB5PHA2ci϶>QEttQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEsş[]д7|mާsgh袊(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((RX$QEs I-~("-h]ϵQ]QEQEQLhMHqE. 4rcETQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE6Y(I*"b{֊(w^8׋幏ZZQ~@sCEWIEQEQEQEQEQEW) ωeqi2dQ[.m:;XRIQEr((((((((M4P&HEHet=NA)QEQE =4QEq?(x_חvkXĒ x}4QEvQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEf=AmiN w(sEVFHʈ3RMQX_|1gxF% Y' IQEnEQEQEQEQEQEQE嵅wZ»g}h|SvMwJn<Ɗ9W n!I dz(((((((((((((j~fך{$QPh!u1е};R6w)7vq(:(((((((((ckA}1EU((((((((((((((((((((((((((~(Z/^2,^Onό}EWoEQEQEQEQEQEQEQEQEQEQEQEQEW1h^mKq%DmM!/0(?Y%;Iey %OCȢ+&ǞDm#wv a*(j((((((((((((((((((((((((((((((((((φZUާgwy-pEo;#?J(grE{k%n Y U l }Q]QEQEQEQEQ_2>.4o XN[߬DR!g;(>| ԼCoR;"4qJ7dVQ_hEQEQE埴5|;]+ös|/bcJ wQEs1x-^H'xQEtQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQExWzğ[%bI'AEW]B6@䅕 :F(Ow:%rȉ t`I#Qhj((((((hZ} (7D%Q]]QEQEQEQEQEQEQ\WƳ]dAi $`c즊(~*7ž76SmpJ)!c@AEx,I-zkUz,UCJ( [OxGKV D ɍ!>Š((/tEA#G/ EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ_"~goW^ea‘F@I)=hkIs$ZC$OhӢ((((((+8x^x3Mѕ`&I,j(_X#oܧ=l5?~QEz׈^?_E%Aw?"J(((((((+$QEWO%'YK訢>((((((((((((jo(_i+Z(((((((((9j_5]rJgCw&3.vNQE}EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW~/4k[[rcc62~_Z(:ֻ꺃+^Cq3*84QEtTQEQEQEQEQEQE|{'EWTQEQEQEQEQEQEQEQEQEQEQEQEQE|mȁL觢+~!hѾhZOso}4Lл*& EtQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE|G&,'ûx(6v\88 IҊ(Xu@{.lm؂VFMQE}{궚wӬ6v ('V$>Ign2cRYwSLdEX[]pIum/{أEuV#"(|?[PjhP-4J QE"?_x,nt d`He=EW>&;<77xew\㺁袊|y&76誖q+@@`zhO2-4ya=0;16 WȒƒFee9QELum#zbyx mDe,{EW|MW; p,fؔNp@9(L1߉xKD[ Kf_!16x+߾:|Ye"/u~lͅP:hxɵN1 unq(|}uO_ O" (Bl˕$r (L]'j qEYx#e>!k$$ ǀ3QE|l? ^д"k}n@x#=I+##J,|=i!nL++8-8<Q^;:Em>kIu%7IHzf(_o#riǰtGEUolO[r`ičVM-l`L݄j=23EQEQEs_/u;Zτ-^Pk &*Xp1Q^/?j˿YY\0-RWqmO֊( ,CLM(yDJG~a8+((fχpj~6W&QI(8#ݨ+W_N2H>4:-XeO*/Jno1=yࢊCqm;ãڵǥDwv J6~](- gVmZwެ:QEOŶ>91Dn9)T/S'|qx/;XhA(.QQZoQEо>xMQx4Q4]yD{nQ\7ǿXѴ N~'.0w1:ad\q;p{c (>+oBQE_aǯQ<qinF_L Ƭ1 XeT14QEykמ%]_MLh2p Wר+O>9X. 4P)Ȏe=! (/HH廕UϘ˿j@U9,A%Ui1Ciz^(4doB(њ{Ԁ[f$7tQW(ێsȀuq/v&,4'D\}w+/m> 02n䷆=YĪ}QEs}? dbE"q?+hlEW?ox:Xúkj^!բ Ė`:;d{ Q^/tC{ rIF|f(O+Co5/sN ,j\D0qQ]?? |*u+{;yVv3{(H+.*ڶaá2127,({ ~\LB =~(|9XB7 b~9v E&__j]h:x5&#]wcqQEk|=tmoKqggOmUa g~:u?7h(`]TB-;vE:߂>>vRjpx=Fx֖ X*4af(lyI5=T]"pX080QZ??ʼn~h1iv\k:'Ɏ\nvrs|=Bj|:^e$%[96+# XJ؟Q^^|(q'u-ck|/<}(쨢(((CӨ׵QE}/EQ[QEQEQEC{s WR,VFUFI?@(şgMӾX[,v`;!EqiKMM THb]m8'+Zυ|05͍Mrc +oLoѬ`q<6$Bh<-Dx$g[3u8K[BQE}a\y;ۛY[yHz2}A+׊|o%N 2*%Oa(w˄ٍ4&FF-1~#nZ(c9xQ>JA-a]reg'J(CG{Ԛ8QnFp$4QE|њ "$K#ȚBq`+_Q4GQ`F訣$B(|eG^^X췆+dyGbŃ|@Nz)ןZ+"a&a*[\iiPe$c ފ(?g/+~?WDmaYe>wࢊwƟ7W3__fh"۽$&(4"=KAupG>(tFWu6tfT En(Md$;(.G ݜvɖXmaI$ Y\a 4QEGmoeKw5HɞZ)P`EW~֬GTmK4M#A+F(?xOw]Z&¢@hV$\)~ŽɱIYY0=QM{o xɡVHfsn`w088(k=|e(Jᥬ6vPG} "™Ǚ&9 QEg~:xu])lQ k#W-LEWG5$IJ[QEg7MhdHͬdFzw+/"'Z)F1"7hŸψt \k)$1鱈q!;^=EQ\}ڭƞq0GsEWӿ%^k)Dqŝu$3z+>5?ևEPϯG7%gH2s EZ/ƿՠRӡ$˝)3"Т+W_ϊ.'Đi5}Kuef dH(-ׂ4_T4yn%l"b {EOG:ƺWx>ld?sr(- (MK/$:[P(&' ' E7_t٢׭5ŪUGv +袊(h?mSKմy)%XvINq:+s7:Α\{2I=x$ފ( Nz:)&,m"3y4QE27?!S\Ѯ(}qsEWeZ0%'ԎEQ_6_mSLJ I1$WiT-ª彉$o|}}ݗ#yi1G$ȼQ^m?A/ڟHax#OɍV\)EW',<5_k:UFY[I"(> |W˯^CGBѭ !V0~)RŏýQR_? -Z55"6n#L ]A"X|Iq&nKd&3r(((2p֣!_ Ya/[j~_6@EA @Cg0K7]8+sOC^?Ƕk4p^lȝ802QE} EQEW|}OB֑Gq_KHd7Hr@?Z({Gǟx.opTeSEVW+xE2+b>QE_IAmn%2QE~0 4}J ?.}{8wK#USOB\~/iI٬`[dۅ`ˀ>Q^_?^F-Ly5$EK=߇`CoY[N71I?QE| 3hZ%f+q,'>ڊ(яZӴ--qi`sNOEW|%]袊?c#a E_xuȟd.X*QEzdrb<#$/0T8Q^P7z ~ʐs &(XTmߒP(ФiM>Y]f'*(EW:}i'k+@J{ʓƊ(d?O_ +Ϧ!s"A轅Q\ߏ3" %2O4P.`.ƌx+o-7~7]Pb#Zfn0<ϮGQE}0H EQEW;:|'{ Jz)*2;E&o n<#Դ_w'dlc8qES|}k|_{QX!d.L"s/r (-x>W.:=cg? ((4QE|gp]|@յ 4V#GэQ_fRR0AhLY|q-,n"(ٗS_|M4`OF@zW $Oʊ( }+LcZĐDQ^eQiVmqE2b>IUfQ\gMwf,ZEf?Q^Mo~"aLQ>AEWTQEyŏs*Y^ a:[c*BxP(H>3|J#G«jLe;%?Q^y4\KEk^Z}xLXYEW? /!h7 Ft v .#leA<AEW=uK&y ڄe.#Q#lo?h@tiڦwhC<yEVQEQEQEQ_~ֿZub("~^赢+b(((i_۞4'9wwB3EW⟂n uh*S(gjNm&BD8xfsU=h>(<%Kla!?'f(տk(ɋBG#]f*?EWk-zTЗHl;77ފ(>HO.}8ʊ(z|;j(Y3K,muME֚q^5F!a1+'~7h[HŬwweymGEWܿrz ('%tTQEaZ-%ba`% EW__|4텔jqM+(v?ROڊ( 4+Qgz8/ e+̉럡 }QE &.KY쌩&?j(֊(m]NkoELV;H?+Ⱦj>xfOo}yurg.=h *x?Ѣ*tg尼K'TLN+c{o>MJYjsA{)H#QEQE|mjOF"+LQE'QZCg]16a+"6rOQZ??,Cu 64Y';Jd4QEszO5Q^/_\EZhz5İDĀtUOQ_~+UcR>xQcq*Thτ:o=-2ؓcZ(ZKm{'Ymy.d1#QE}_SXyK]xդh'EƊ(4Kk:su`3G`EW}nBP}+[x(%i>jH"=^P dE/8]_G (??*(yt ]O-wt=+PP:( +O2+Mc$yaEWó:,r=8+~7M|m(Q6[UEQE~EYi:d+ K H`:RzܓEWl7wV"Hm.V;2vvQ_E|\'eK3jL,;#{Q^eh6-um ;Ra#Ɗ(MxƲZ^и#8ppA@+R>5xxD UWp} (A袊(#lzCoz~u@guRQھQEt:df>]oDn7xmI>QEr?,9>QE}EQEWEW|O赢+_y?Z%Q4fTQE}Y[}kK QEE~(+t}Gන4[#5vQ\엫5ep|ӷEWQA׵[[|8\)#EWQE|[kA~ ihj"(S&aai KJ5ĪŠ(aҭ @$]LrUQQE:oiWubK[^ PXGh,&fp:TP)+Z(j&LQ 'QEib}sY>u嵡dw\#EW4QE|_Nľ4cM;aIY3DQE}EQEW_&k֍ܳ o" HŏQ_eApC0jF0QE|oi>Wj:d݃)Z(w:/(~j_(.Ѽ˫[! +ݎIEP~О#9Ե+DmhvfB h_$F]~o^ HAݙT>sϡ'+j((((((((((((((((((((((~/|0Vqejv &`8 +㿌¼tRo;6ޝ{b(>*7UͣY kzUBF]8vȾ܊(glσѼuX5Ԣk{ED Q8R@s+-g_#s4qSQI(~:& MkZdZfE`H28EWȿ7n&@v8EOq}E hs m7䅹9;ǢTzmڊ(v%c?MV} cOEr8VQE~ۚ|xKú)0^I 23|(ٗ|WX̗oq y%Yx "({|{v巙lo>YЕ(ٓş/>izr3Hw-˷n>+hxi%Jl*W K3{Ҋ(|  c:E]BlyG '?QEWLJ4Z(?g#OΓ'}bcaDJʳFV4QEzo &=ʅ#ܚ(/U(;}(?{@~+?+j-q)EW>_G8EWɟwc: ib'V/|J(7ÝnVB8%ĩMD8x+o2/q[{BAxӍ>gQE~exoIa# (ڿǟx25 _+|7gQE}ڪB@QKEW,BC}п{J(u Z_h1T"Qp;QE|k5%ҭf >w3/!LQE}EQEWIm)(_7.ZV:bbb)=Hbz(?Vi[kZ i2dG]t'q(c \ho#hY^ ![f|{`+^n2( 3|>(?4orR.dZeĘUWO@94QE|&B/+ h#Q] o QE{O'>MZ(&R=F(=4/Oũ1+$r |qhSDZhUEbqފ(a x[RQEr?EEW_B-REEQEWȟΉ}#>L%2c.~Q_E773:R\pm'G (َxC@am0,G|+Ǿ y(?4q|-zGIHy$zc<`J(a|uQlO!`.7c>j(Y"3-6^@2X+EQ_2~x=u=SRiQ dBJ90yQEz ǂn7۶/5 4bzf-^KմAy eDUՏ*Fs(oWtO/MrfsT gc(fOG]ZM 3_ 4{ª;I"(W+ſk \{]i4:D𢌖iY0= SEW~~;VguOG9PY@Td(^}L+WQ^IԼ#bl5AI7++?k k li%.EāFOUJ Q^E-|Y<vn0\gX\qzEN__L֫*^ݬlPdFXqɢ+_?3Yj(߅*jh:}`88? хQ_L㗃A{[[[$ [Edٟ1QE|B/_Igӭc[+0bĖ $:8+/bO|]uoӀs]]g([Lץ׽j(x?:(S?QEv_ƒEIET߱G_h.aQ_\C|QQQ^'C4QE{o3$;Q^'Cj(_ړ>ll^Ɏ >?B=h?^ [IV[q;#nb1{E__xw#-^5 $ ('eiZ(k4kImǬƎE'ǎLLP[*̽pF27{QEώ^|#y>Yjz2Yi gQE|(J-uSgh) g'wMQ_uEQEKϊ9[YMf~Y&-$dc=6h߄GÿXxcs#y#v+wD{yQ_Y=𶉢I_pTޭ9 ,O`(:?i[-}NX6߯z()s⯅7_4d~:ep?.E~ɿukm5;( 0\cQEzgzG){q%%2k~+ XڳvPg>QE}MES&&wFU<(#U_u+ӥc4 p>q(ʗz$:I%BQO/o(uFٝ"9$(ąHŤ-n%EWtQEQE|exvO6+o+b"捋O|QEjT, ʹ=VB9+v0Ӽ9 g'tMq !P7CFuzQE$>t_ Q_:?ԿPrQEq ??1sQ_@|<|;/4٦ av:4QE|Rx>=:$KӢ6v4I7 zEWQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE|>{-WY.ŊE&(~~ w_{Rʊk8EWE>>BmBZ5ZCdWv=XFt(m;PS5Y&$bB<%$R0QeH]ghiht{7Kk hby.Q(,@8+F(5ou[=C]m浇E4RdF&(4 Nym,cy3y ߰QEIi>)Ѧҵ(lf:HF Q^^5RsH6`p\Euu=a5-GPK EHC@'${QE<A5 3$U.q+ sEVw¿:7KMBBnI  mE+:MοP\*+%,`" ֊(UR;x%,y!@>QE^;Oړjwuɕ| q`( zguHu&,&e)TGqQEFojwMw%̑.vE#Rx*_ 4_t֣n.r7(MFt.դ{{+xi,U($p=QWho<]\kiWNd[b9m8'ǵQ]ÿkxsOvYˌ`EV_¯;F}T{D^6E(|U]LM^mh"!%vo+"Ngh,KxB E 8QE[(+3ĺmI,㼰'#GPG"(U_SVԶ|b? E t o$G`@jQEvubKVC,DzES|!8x^ܥ35lCLEﭟҊ(NsKس_2kۦ&#3ފ(((aH=Q^sB.$b^K^hz(??j$ү5Yc9X0=TcQ]j}Ŏm՝U (;ǛH=2792".Rh j07?joa`ћҾR000OEQEy|Qoyac K?.|h( |E;Z+]N5/,$ Qz(~~ 5(ZY& ^: $j('д/ڇ,&/2$'j :q(K>$[\~TsZL8!)٢+ҿeZ],)ϒ"#{"(p4 KtHlmlPĸUܞEv((((?k_-:{[EW ?B?ZEEQEQEU]Z WJӮk^PcS( Suxhh>PTA]8v=v(WEZOt9~.f(Ă:2ʑ(&< ok9wşҊ(ğu#H#]CL<Jm3ost (A,?[xn[,m퍪I+) }(> %3jKi-H`,jsEi=bݛ?gY+2\E{~(Ґg177&(}} ǚ7o<"6!o#vt=+Ȭe_~%ue9 ƻ>+\Hͩi-6|awı.rs&(YR&v%g9b ~(~Ξ N6b&_)mj(;1aͯnLQj(/)߇Ưl֬ɰ1 ,jshsH*M-!]C*XC4QEx.*buOO| 2'ފ(j3-αD{Ҿ\l:2{8(((Ad(Kw|G-z%̤ 'j(/Q3jZu9~ EW{FeqV6qaFb('EVQM4'TWVF PGqEWb^wj:@5D? _qQ[Wi4tΦΠdSrU]\*TnQ^{+kO­ ާqym7۷j.>sڊ(Ѽ_Ix+7;C#veaʟqEWjgm9%#7| U>hv(W}袊}N=GMsg4QEywπ-"ZtT&R!cSE^3Inb ${fUmuq;(ot:ީq%kXQEiQwIѭtr krf[k.a1ES>ҾW:Nq}=-txUQ EW^ռes[C\[>4B0`8Ͼ}袊_x^ƞ-Vwlʲ 0XGcEW/B.$c^K1ފ(>o?KqQ#2kuQE|+C|4ЮK/cX$mE+OfzB̖*/Yn&9uLoQEwÝ"WjWq~񣽼E@$ը޽x{GHL2m.~ù1EWޞ:W9&+rG}QExGwj71Os%Ց WRc+?eCtʍ,~+)#z4ZWbcݙ,O$EEQEU+}'Nf"sV(]v6¬q(jaUF((+]]7\ᔃ{yQ^5~^A+ m~l}+޴]6 ->+kHG1(UEQV((~$1Kh.amF=`=EW'sG|a1QE>xw\%mLGM0Q]eQEQT5Os6^X\ap AQEx]o̰6 #l{)}rhu_>>Oc[EUsg=1Q]υt;o sNli-l!X"y.UFbEW6jM442K4P8:(SG.58hteaaϹ +!|d%9",QEu, iZ&KDz|̛w3F, 9+ը(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((4M/^gڇnYP0 'z(-&. ;8Aa9GhEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW?'^>/il#gmQuxwח" ϤG^'o.Gm] 'OkT'P`٣?OsW7٤*Nӵs׿gMQOEU ,,"g @՛?^18u6e~O,cZKenBtω.(&uq1-[_,X-k9FK}@u/o6$l ?O'Wuoy~?B ?j'Ԋ@)xU`[Vŷ/&_n^?JӲ$=5o$Z],Ŏ"E-ab>/[ zr?I|s{"~-(0Gkuēb_(g~9|/3^wzٺ(:ߺψ?5X;w8znm"Ժ_|qjcg:M L% QǸ8;/ș"ݏ XAޟڰ> x]ZXGo5|N؋Z_k P5jW nge^WDg*^v#sOSRzYW?t|ؓnGҞڍHW?tsR ]chIveޤ+IqTu ISr\gbS62~j*`"GNbCϯݬ kq+#}cSϯJǺ&2wҨ\\!U隯 ~~'M%Ո>_%4Lz7ׁR[[tY} IIa/rJ硍yW>+QJyIL[ĜWڳmkİ[%|lHwV P-֝zFWBGŖkw_* jWn4b;̷H56WQx-^6ۨu?4a(X9g#V'ޥ4ywȹ ĿYZOAm7}#jOG5o &>ګ|UZy.p7s|[[i&g@WTu*:.[_ 'Nګ.*Ob)4lEҤ>g0 _^U5nogtvw1?&kN~-~8vqOxW*&|ԙx 굫m;rL5հ季q|o3"?jZW)n3dg)qV1 QZS&ZHT)pv*}/Śݺ]O^g89# 'ݺݜOKyWQR\[ݘn94?Cqjʹ8|E1wD9ZsR$74oo#1&\[s?ʜ!V<1. $3&x\Ynm]i0x*UH7)\>V/cj@.SP'TRV^zW4.26_V[7`λ};<!_X'J4iyqy- | ^X6Y>UnץtT:4ŕYG+1*:-u';kўaԏ+䵾SZf@77]]a3ZK`wAw銷4i+4| mj=Vley%vڹucG^HMu QGPczr.-渵Zy>1תlOD>Epy*K?j3ٙDpFOP˫dgK,/ mfg['(56a`u-P^0h.W*\NjrD)",BCxoԝȌ%Ǟ)\pkuMAqs(>.>KsjE$z(_'TkX2Y/ץ GȤ\s*5)r{DC㨠3Zx7CkG;Z2Q _Gd!mju$o2G]i>-]Zx%gbMJ11:2ɸ k,)8rp"2OEd3[OiV zӮ#xLkmYn!p9nƺՅA `2J--njuQi`9 ZqI'Tݾ(ZD%y,_zUvzTқcИTJ:\"o1J̌R^LԭQfR#}mr#}Eۿ_A1Olu ~3Ivï8Q|BEd<*ӷѫ.?&YJߩSgV#uV'=?ƺ<4 &#uDz)iO1w|ƧUսbGoJo_vVS"):ԍ0S,9Y% QM.1+ScC)κ޺eWhj/AiRW_l*ϊ;u??&uv|GSgQߴ ud$jxOb?MFf*5c.qԈ*5to%R#Oua`{dH?­+̱H-RQ%E#僒p2*d+xʧb[ŚVlDJȓ;%6OWTAbGڥ 4lhPjp"aA4oo\\ 4_5{͕1]ֵt1r^+vDSa5w Y*?R+ __]j[O*l` ZgA}ileʧH#N\~1kČ:,~+םLIֈ XUW)i\GcO+o+ğMcyVJvo|KFﱴ,nT,p ~B. @: ~BS.evm'by!%#~"!e+FZph-vȧj&oqҒ}>}W4mO~EMjM[8*KMs\!Y*qϖʱ_^"J|571 SR;I1?֧ yhJfN_$'ME'N&+g<M_y%\*kr/;'/U?kܻ!8$BMt:?uZ3st@$Bi[,Td/Z𶫬^^/}p$ZO~U~)G i[*vG>)|PVal 6(bQ`] TކjIuݰoO)?wdmޛTrxcȏźx~R4?/$ l㤄{N9(o4wOOk#'Qz3*dqbzCJ'NGR|@+zX8jHYz'>8x\~NqSsUU?k[ϝ?4^0C2]AREYXt$zz`0k]7e:qwZ31Bn/[HL]U}aQc|N5;?1uMMP4*bSomNEO{Xokw-*bM$_~#y֦HPla!{[STPb^Jq;mj6׈?qs ] gY,ՊV:Z~"xg qn40??O;n5f'!S-U mD`xwjݿS4XZjG 38+5[KdyMk4;!S[xtkAcDH?J^Mk> yShRA7Cź6j#*UkjVM2T$ES{ֳe׈H]Vt.ֺ=IOxȠ]dTP,6{mG=EKcOǾ!ڱ;"$oO"l.LӏҠյ[8̲IqU;~(xWq MKĒ#}?U'Qiڎۘ1iQ*}v&mOP@Kyv(-oc R0jv^b {׏ҥf8=/\##׏Ҭ̽:T^?풏T|C"k6 D-?5V{BJ[?¤Ě`>Zg|O&eo#jz lWuM/T O&aU>#Ra!|붛x6̪Fmb)Դˈin |'8㊿oMRx3e_}[QxTu}E~Z5bv3eOz-u.-H9܊SW֭]] ovq*7^$ sj!O@kAqO[2%1d*VEPJ/uJ$Lju0cVDSe&ՎLw1cƇT/oJjD?e}Nq_x\K,NEwjG.Y/NEwdA˅}>SuM2k< d+>'s KoxYk>Ι?+W^Vy5lF/쑃/J/G0I݊zӠI-֤A'V@,Ew=ZXl?¯4ҭE=q>N=cOxH8~$=TSjQ]n$dtOudu vNy?_F*6FO#LnGUg-O)e5@ d%v@ixĪ͏D 2qRxU^~q\*d8I\ę?&B9q |}Y*K@7IiCRX(/$v$)^ҕL$AyCX]LwBzo&_)>2rC}/xHĢG+۪n#Mˌ0<}ɛUpt4]kv@w߶@) Z[32ZV#2/u7a/&Ok-a\Y~$|@/#, L¤Oc4źiIԩ셎'.-7_/TXx#j/LH~SfqݫJň02V\~DMH<](7O&?J_e\wK+cY_B'x?3֘|OMCqsa[դHa5弥<~$Ć?ڌ<ERC:5xJ5~/u}"5QY]0xR_|?+KqzاP??&B[?":Ϊυy/R>3d_v_e$^?5,܀>Ph50 % >$xh'UMߔj_>  ܜ?EJFZᾞR<|Hi&n/"x^ݏ7O&>0xKǚQ/4_EL!ڴk.y`dzƫ% 9rG~f}TF9m*;^Wc(?Z!PW<-cW2Gwu3'Ŀ=S'#"q|LjRm<ܦb|SC,?a'bO|߈a<}q^e{QĬIFubhhم'ף?Y"krB0ϛh$+Uo.m!;ǁ"$}+/R|MgnY=3F?Zs[ۇ:dj߈kmjۦM |͝yбDQę*uGU!䩻múĄ5|}.PRĶV]w}Ց񯈁Ě\#jV񖲃 z);R;t␲L~sU[xIGELup>=Cvu;ܑ&9PIm0QpJ*K9{A ` 1mhi%䘽Q|ץnxGž3uWhO7\]Svc@\CH\cSҺ!\A@sWgu]X 1\JsЉ S&o $uPԯܺ(__%:?_9,@,9oOoLtoSV51j#z촬rk>sWR:^~!'Efǫk2ݓH ?B+]w=A;KOЭPfBJDkb\xu&}GᬭKXl+palͼx/Da@Yŏo\_E i:bڲ~"xP>fqCk7Nּ>gBDHPi?|Rw? YcՉ oio|i1TԳ _C\3NqV#_Z6ivcv "@>I狯/?-m|ԚOEwxusc56*M`'uwR܆w!A|]N%Uo`wM57W%v5P [ȼ~j ckRZ6[zŵ}*O[nVl }*^ɩ,VlTpU]UIEQEQEQEQEQEQEQEQY"SYT_׼  8u#m/jƉwGA53tjr:ue~Fq]֭ޫ-L[w /ZҵyL #5HVúsںMcve=W8|;1K5wF9t(#Pp={֬Pǿt<޺)"vyQuq|tP\nFN0j ?kK?n-*gC~HR{_5+;qle QTd3FꯀO"osV4T66ͻO ^)+{˘{/׌9$ya|pkGmh v|s4֫yBE߂i3w(wB^@M7DmB36v]/,+Yu3]} ,tCrwi2H>Q5e$ӷ4eQ534E|kf-dD1 ӽaxZK+ B7귈55#~|@,z&pѸ[y5ve[ϚFk,]+ +quvۜ3^m'Zͼn\z{شSh[@P*l[ &vkto)cASK _[FN=k_ʶx8wZVcr~ʠٝfpB*:N7**ԈoLjkJuږ|3)ztv<?^%0v{-)cmʰ1nW蠭N+Ѷ(;t/I&"W;r1[+vU<qc1R[vyfE/ҳ'2ge6lzRFkvK&Qh{mkUh`|L,3`&qQ4oĐ:nX2#D<.ZTx !t~Zѯ .IܚlmaʊTT @TWAYP{L`lΉ o֎p&`[˱3X~*Eǁl_dtݏW,\1  }.pF NDޢt[QfP㡮gRi,Vȑʲ<=mgo"&UO89SV!bBKOf꺌q-Xʼn\ 1bx+bkK*yROlW9,Ls2'l/ s]썼1*Go$Vһ]ͥwqeqtX2*θ"Cd+OWZbu S|Oʋ~g@2l2XiKv aU˄Yj)a]ZmI5}Kv ?Ev6)T$4H*$+T$05xLyT%OgW1uKm>F j-,*=RGc],HX^՟.*;:hvhV;OU$T`1?g|?E[QK0Ԛٍ2{VĘfl!>z\vׁF~9rQ~Um;`6Ey?#pK~~eAOr[*|VWE!6@<`tkGG$FzɡRG,Iy rj(aND䎦KM[[Fc''ڳ6vBڪ175mt?PkK? ۢ1/UV%F%=ǥW:>58J]*]C]IIc\OûLGLf03&Di c֟akmݼlW ?7Jжҵ{;$05?7=+2W_0n*M k=[X?p}9mV{6x/.FO{r+~}BXx^+ 콹>w.9hn'VI+I\~{`GX-;TwIr 6(YnBt3Ca58zMp(8Oӭp>:70a!) +Vår^=Gn2ea;g|ElEZf=tڸBb bUs:}^0? /AeN0ʿASYBZi31_zJ';*wMWI%zu(PdQ]'\,"FGZAH~aQ@GWN TVulӊ0*#*$*acD"剐1Uhd|g5"d|fYbYg[OI4zWkͫڪ#ڼ_F${V2yQ K-xZGfsҽÐ:t o&M6T d&ջp`s^]<E@q֬d>ֻjnEnloW, nN vC<ƪ+mc>Z(jT|TzJ1n]#KـybHǿZdMP ?36G(ڃ:H 8"fǔ>nRܼrw+`}_f9+|YkrCiȪb9=񰶋T+}>)UEWx[x5WOH#Ua@EyAMad*I9Vk~&|#lq\]66g.G\\\3k=s8+GtKBiϕ"e>kU)%O-S !wY%QsEE4lɅV*~+/F. Hr9Zo pk[sZZ ]MjH 1ݑLOڱk=}-$5ks=2L1fkxL; @7o26[qk,nV 2sƺ+ĺE ,:o F`2B 2`f>]_l|-&2wGk溚mj4oũB]c(='+>xeOdE_}ۏ=5 #ѩ=<`d*5U(!Wңҡ8+{޴-dʶ@oz-ڔm@z{u>p:m(e;[8jX-Sa"AKrw0FZD4Kp&b(p9D*dgTV2+Vϱ[dxVts1>biG;;nqhlZ}3IJs޷,!1zִ0u5&m2kΨ,T|I+JE`_)uk`U5 Ӷ֫[dyX87JYݘӚwWK$9V9kdwfWbv=s.cn1ۊ w`1Fa3ں\9RXwDSTfۨ M,@Mf}.TҹeDW"$fq#zZ.eax^+u_I\kuY#pFR|)< g5oFa%{cdojiXYAnqŖ=0`EufM8b[z-l8h'ebwg-YRUlLѭf0W'vrޕB[w'b d˺gۊ?"zMA2qҴPg*Lϵz)SbpZ2 Dy"ҮY]%xt+2KֵaD;wAS޴-*qVthyywU-&&~yA%KNOKy@3z3¨xP,.V),*Xͫ_.,rWJ?ڻNH%ӣ@Wbq5hMZ˦@\ɭ+DrW>ՙYa{-gOhӻ`gkY%HyO J$0 |>A{zw!/q$k-2KpE{Wsbfb nPDGX7\ ,dֺ=6Q?S|[o:"#T g񯛼mSF6/ʧ?O"Hk Z 5 yʴ VAmQn7đ [v 38*1^[xoUn76U4 %XF Yu :n:TҠ+LUm_^tK'y*ԮުsF0+OF.59ݪc`WEvRmvx\fQ)<,@[a0$ʵZ=eCJ64s\7 bwi7¹]lmcƞu"W-WmU  y[GV #,:f[46EP;sN1U@˒$ ֭b )>[{=2#qU(2Ǹ㧵EvprGz<8#Tb1VKtE}9X:9-t޹y]Ev#. =נ>&h9qW#u!iՙܧ>uIvLqWle# BWf\\=܊_9`Y/l|nvᇱ+UHRzV4_e`zjvϖrsR,O94˛BIؿ/ſt\rjԧ A9G>b6us2 5iK|.E-Z1x5Bdդ.Gȣeɫq곢PGkA=*uhGNOq&ڕm=cjFU^*}hbNU\c*i$1n6tEri,Xw zU'4,ZfJ䇃t,pⲦ-Z:gt5lk#Qol$VNn/AH8<%ےu\: %#w:ֵk HKs]0rAYi0yV{j+/MpK~P?j{Z[3RM)w*tid$+>(DW 0m4+5")ROMkm١2=Oll-lLε44f\ 5Ζ^RQJNj2J[NUvSZ1b( Q}[Ign0*k[;FS{2d#Lya&?9wc?ݪ$㳇Z͊Kh?VK8^ %% ;(M'H;1 MZD8e;"جk݁5[oCQ2,j^wp{;wU.^i3\1A fr ) m]V ) +"${YH=VC*Eԃ/xV7 !XxVAj>UKiYA'ӽ@c$Oz!$gڔFx$S i igQ3|ӐMOCTB ;%lhPÿs/sNl5R1y\B l].iq >Altvh2+5'MVrA^Ҹ}VՆ6d}+欛@5\^Ia 2(kp2p9[]"X*`ϻڹۘ5k^)fH8\S+ax ֫h{;e!@'W5]J{[M9 *}A h-$;1ȭk}ܴLL0)vͯVg2rFܠ+.-K#9TzV{|%#8.Rˋo⧊ ٷx {Q0JкMW F7= XW7amK\)V<JXm͍X( Ӯ-Հjn.|€2 ӬΉ Ѳ zJ7OOM+8]zJcDWj7SQNHLY@I vV15.X;D=[iJ'pj]TqO$av1 wHP~,q#gr/URI+0Y|.yTRK=ʬHGE1^\Ja9ڣGV!*ybc_C\g-%H eUխx KNVY,1s,ӧ6K u8}كÌT b2f e,.n1{7YKfǦ3OHE4=ċ -%T 7ZTD7YKhx`9VVW6V9c޵"g8X䅑ȭkm8%Fl0"[i[g`qҫbOS}.B0V]8T`$q.kҴ eՄO$ɮEӒuMjZTf 5":1֯4P92h-։%ت4gU9}Fu8X<B`G2r+vflmǁҸfr;N)n%2T})99(w ON)4H7ni'T?7Ғ'h xn8*q[aZx* yQN*rF FjQ($Z7z㎕(j;nQ#1 ңG.p0rqNG9{ǽN֙|̡Qy*qnXrOjJsZii"y$P*cYx~P6ZxHB3(v{x4hRF&G5M#ILGzi6w9 ]"m\41Ko Ji5X4H5o$U뚱&olD\{W-a܇6YZ pF5GrlƸqj5䞒涴wyQ?(0 u!O( ?ݵL"j"?2 0k,)fiZ[9#\05/y's=JV6$'ҭ,卉ڮڦ$퐹!c1ܚ=BL=XTak-,T̳Ct#gt{>#2MʤDkn-<.E÷|]d!>7 y?0C}+OIMwB@aնHSZs[q[ n%L5h5QO* E9>ݔϱ;a0'r md"2XZа`V#4LbxX)9hqJ#K9.eȱb}dy渻=̙*)k_igo)'5L< DI?,zS"f*$PJO;YqO-HXf\SanK>yjkCk6v,6Amg-R!.NK]-!bsk#}[ı\/V*8VUD3:|k eg1 |q֣[X%vXZ\j4x L{s~'OZ?⹵|1Ϯkˢ^H-w? s_FW5QEQEQEQEQEQEQEQECԳ>kO!T+yU$9#Z:uA:O(tV,!p89:|Z$btLd2t  f;FF%]רxFN{G"a1z׍Q\Eǧz%UVE\wUU\zwnrN8gJq@IoV+;bY/"Xq}jI\ϕbHݞ*b;d$1+cB7m#V~5޺#v{=5-ݴWhkP w`.M+tZ\>_F3nǭE!nL sr:W#fhuܻ⹫2F wW#gyG Ƽ.mRaxǩ,-j`w5W-t[kuځrxMb-\.ܵ{Dmv,8~*jN@~ JvvNpN:WxF h!'i>knn#ּL"V&s>s\]18'ۭx<>)Z+gkȖN:.jSn8ʬԧ0p?y ?Je HP5hsY!Q.yvzdp'ۆQP5Z݅%B=kFy2 ,;;ƶR [T0PxJR!Aά7Hh.vm$77Mpy!xme W#{d XO#N4%Oj ,&;%Oj4$JҜ=EewurJ;n`HJ5.bd=YT[#{o .'/X9r>uH"݋[`9>I څ_LCZ3ӑʙ^`v"S G-swYwYYYd :})Vunc :zX:qӟy98[B_MȒS3i[Xi Mo!;PIeÓ--@p㡬C[HBILMinˊRVmB>Py4۾6-qegr̲࿾1vԦt6L]5 #̺O.ea]{%Ir%N w>gԴ"tp~kQPs}MP>6fnT:i6fܨe96/h++nl+{f]1$k RrOՍM,cꏐ~Wmp],I[#-v،JOɔQj`wM$qnjitNR6I`P|; =>lc_ytovH{π9yzn}J5$+aoȪ$?:%lGvك.6['W;_0['޵VXe ݀88U2[\$*]ERxBW j"MJYUpOj5)Jf\,!vP{kNT;26GֶidS!0;pq[֮59-HZblMBj) :kZXEa :w(1LAluձYxLs[p=@~kmV^mxJKmٜW9EI $Q=o6eq, \ƨϦ%r̎@V cxF{y,jRJ\}fkvD6)Sz 躨ү0DJQv\cVG/ү.`9.1Ebl緥ptzJ{4n$Feė2ʚ׭ x8z|zLw9"txPxrOB8e\ypzTimlEP8PRMzͲDuRcyHUD`9R095FO*J@i[Ihi}:TЃNzQKU[hK_p1T6NNcc8kLͻGJl!k1Vel3ƻl|3"qWRy!Bm*Ttbw0V!s Q\ gZJ;9['$pXkzY]_@Mv-lLmom"n3]}*)l?Ã$r˃Nf8?Cv[aqiv3"}11jcKE7 f8++quV)d}pW 4]+Qe!7Vdw?t^dA>nyg ǎ}* )g'Һ 4@3UۆH41:qVd”g+pjx[I\aZB3,:zU.9 ۵Oo1teKQ (FGOJ>$[Gs69i#(u/. /"K=ĩ Q'FKv\A t鱈A[aa~`Np+{A4|A[3ػxL(JQq} O>OZ4G.ظکˮC m:ձVmFV_W-VbKA"FP+dlI9! c'5CRVld9.ml)lgnsppc׊pdRϐǯ!s&xI7+tYimpq ZkZӴx cTk]yQ?gnRNdNGt d ҵ|~€=3FI"S{WDcf czїk3ɎBp}H#΍3Ɏ llId"ZChF&YUeF dU4_5Q&nBnB $*qLM#JҘ!d#8:{66B3ֳ5XsVFsES̫#Úst{͜sդ%[g9 ]A9fuiVHBnF$q\sQ4jrg"h4T9P5-cEC sY7f9fw s\T6;nu*T695xIX# ^<^38/"u H$85x[ Ƈ;7֭x+YD$bȪ7VqJOLV[n>k4d8u=FS{InTk,oQGl$CK!uɧY$Wo%+,YFD#޵dOzԵ9P{; `n!u8u&nQBc=FkkOEc\l#<ԑݵN3ҙ{ }*oZP<ՇeuvA ]/}#:̀ywF§uIk5>dWK'Ҝp~9]u1om$`.;y?ҽ}#fw^\q#P"?W Pﺼ??`V\T{W;}2q9;DڄMK1tdBnfYv +-fxK+i#1~5NKF;ȄsFSnH[;noʪCuuj%!noʫizE$2rC} ֮ikc33ݱ!&>QpilKnQpk Z #8l-Ie>1ֵ$\8]K9>sȭeUx_-Xc\09-η9C$[sUa$ bJ;2KNjgWi*!>Tinv5_ X\Ip@ q\ In c/ U1Qt;PF[H_q\P7>aLJt-sXca9x! `0>fxWO' I>NaSMRZ}%d\_zyK;U_λ ~wb"8kcsf'i8 X٬ gHZ#H KG)f푗 `^TƦ>"^ C ]Y_ ԢER Ip/Bd'~ ٲT@bqҤK֭m% H*hMJ^!@+~m[Uİ-3*$LWx@[qU u$P[qRJ2dn ;؞i,jܩD*2p}Ee IcPYʕB'ڢh"Y*FN**pUp2j 2TX>/IbUidd_Lg qHP LGZ6\K"xI$dc!K(RRLKm1+:?7n~U%<@s+_ZtY-@PU혁rȒwZxV]B9+NM,Ct>h2NGj;g[`sZpІϥv:mkyUnNjxl{'#楒hl'ҴW?ZwژgTM*֪7sޡy?x= Fgb~y==߻O#!ZV(@?K d5=vBq"|IInu9#djRF6M F-pTQYr޴<SoZ2mOJ<t}FN3tYt<5h "%m[\%P~e,`K"$''޳O+2O8\0['-;=Zӵ }?L-s 2! Pg5k}pt' Gu{}3M̠vzU;MNLL.PORPo+;U K!;6TR|ăN/+"ݒO޵z/j~S+uq:Ҵv[վ:~>&r`z;StM:ck?ĬR16GzUn|3ia2kmGz ,0s\aEˆ,9P4s8d|@$qÚYݭ`0Y@b̿.֭q*嵘D˶a wm*e}cFc3W~W6E\CF`c3ktxYFҼ2+T)ҩdC"8Z[ؤATIV$:?+GllrHW~qF3Vm%A5iV'y!ϥiGGbϥq~ 6ѕ>gBK$ T:W1n]e̽}+&;;^2犃E{HTg~`d&y~kY @K_gy PnMdC! T.G56c-қP .G5zS$|\jIأ#ۚ-ƒ%1zαd6+=j޹d61\Q[ Ќ6>dZOKH$ڹ&rH$q\LINXNW}fŔݠd})Uv j;K9Gs< V3|(b$o'׍fLoc s3z G)_5mP:T*#ܧ5 yLN#>@ϭqRI1 D8kRv+f˴._Vak_JI#˯=8*$ w~[pҠӃZ#Kr(q=kf 317N)(J 3D3NmrN3A JS I7 +S6*<|HTS`¢>yiRIj!)* SPΡGQZqŘpa$+ʂ0rԑҤ=FӜwv6kR:T1Nmu#-4p*^+?R28t֍R$j + ķڤpxG FR<ʲ 0-Xd >՗m8EdE<=;縿Cnu %`v!sRwM'$cV׺Ia$ReTK|9H,ז ݰc̘6(Fc-B ĎyF_x﹬y$ƒA&\;Jҋx]iS=ݽef3[ϥMAg|dV0'$W}xme;@T`]\* \2~Ub+W$ lп*Np.;SÞ ].'»]/ULA8Wx[Ztr2-O]wp,#:W *H`WAopUAVQP@gS рbI *;Ѓo=F)]JlW}Bp2O?3 3̽P0g )ZpNj9c5N2U!?Ê#"D"B{Vyʀ}jb$.;m3FR2+HyϏ!m5D9*㎽+\U+i!+iQ^Cm붬7v)ӯ!7X|8/au B~o!4>lO~Np)tOXjV0_8RΊ((((((((x@:{KMgEOe Vt &FHBѢǍVYTI^-(l}?WQ…u{Mn:|<AZ0pfI#5Cw+f ,q]ǥwZ@e8˔.ߥvV(̛ oJ,e$ֵDj}kv5 _Z(.wZwnI R G\*7p/ GY*Y,dd\b݃,ۀ4.Jϸ ugsU1;$@zcjh~q5$nJp ܥDjF,o3KȎe U=݆rGZ[i#yk]?8{gx/.Z >akYX|?Bf/$A$I$QJ)Ϡ^impCsZͳ^rBaA[>+ӟV͜Syr8'DYT&j2_\fdI;:B',cӁrD Ak$h600G^xG{62+E}yXq,He֫RVgL5ܖzM,>/,Cf6?: ༒h~ϸ6+TLoJ4z6RHdcɯYj8p~U\`2ҽMǵM~ɇ>&=UfSkr$zPs U;gssSid_t$r^eĵ~f0?2yj+v$MlUL\ZyqPڷpKud.%E}EtK\\l"種to\aXIð{HEy*T~WijD݅½H(~Iw%j İԯyKUcF[v,՘U"IV r}i;Sb#zlr/]= M c_[7)#p೮Wl 8#rEw}cߋE8EԼ=-61> ! ⤅pOa[]&EkwN-It,m53C2@{Qd n6-b !hۿJbD&clsҶl26zT1Ӡha-$1&[呖&[=jd(yltkI=h$y$;j[RʱX/8meoޜbv>EYOq"b7`*\ :mˬvcZ~-6p8]aze o *q{morfE 2&^E,aˈ\%cQ(<QYwMfeSu_sX~8[[ےMf59'ެ*D2POaxS[('q:o*\^*u͑_G+$@3#>{Yn1Zȋ=Jn*}+t_:zCmkyjߑwO]8G w0p+yf#ٔ⺽/ǺUXY m'=-7Ŗ1[mhJwǥwlu+YmCehvepSg[;&nd?A^ :Ôo՝mϖ߻5 vOݑ]zeULCɟPkʫ VGop&) o H9.R2zkB #s(%6' RH@9WVp 9'kz.B-rNkU6|c5tY!$uK!bgVRk#k iZI\ԚL3[7Sްe,vn-5kA|Zզj̮ H*kQrkV3E Ԕ ֫Oj!b_njՔ+ ֆbYw ˕$F7|8Knb" OB,x&$+ nRc5gpolaHRD ֡evO\Vnᐒ9zExa+R?5p:)xg* :2Ȅ96y|Y-"W|cjDNT)B&qVSreMWqz$-4{98pJyqDʆ!"2vz{֥B$GU늉{FZҥf[pJ۵ݸm#{)&B>GaU& ̒,ixXXXjPifi(=9<U]7G @AxT1 t5,H@xO yl7P=eޕ4ӳ%{tQHIcvJJY"v#d[HZBQqW1]^nb溯 _M4!ve~5^6][5m$kMm=OgkM{ тJul$ 4ªO@zSٺy 4*ښ"x~ҳUR{ ƞmyZ@2=kvS*J2('VNP}EEyI7(#}h"u %"1=ǭ4DREg%=jF`XF8=i|hM*c3h2ZDZӌ ғQ_gnzZi6yr5YA$d05kak+$x`kWR6xÊD-ס%P5) ՔP+yc5sODvQFx5hEc<})fQFx5[]F3/5}an:)1 Dk6Nq4q?s{k}#LҠ$M$tʃµ8f4߸m+G5qjDHa1y.MRN*#9#)8mN3\Z32O",Tx_O6Yiro<ۼ1zm9alg-}s[֞D4L]+^ K ɏlh|U^cN wO%֧p#6(=F+9Q$Miu;Fu)A1YknPY#T zgkRAqC17Rѱ=jR𱍏CTv.fy~ā';wpqIo\eg6Hy]T7Nef٠pIsUuuk.p28491 jwHOrs;7rNO>C1`1'J`⳼G;V9jKFsaah汮eUFgc-Hxֵt.iwN@TZn< HPH-:tV,cÙdWY|Xcͥ ¹ vB{\D>ۈLv5}YjIH_GPk27%wzUt4ۢH&GIme6D{r`>:*\V_"ᢰybahmr`ҦxCx`hRΕ*zf?VTzivKpNNڧtN ILǵiދč s[>ҼCiC n#<$V6mAu!Z%VCN20\?1.r+oT̷5Eu4{ I'R~S8,+B%8GZn<]mmríaK"";%[0`9HGTC,q&~UBEeId.D-KW"B+Xwu[yCn_v"Zj^|yϸ-/,1n['<֚,<܁R$mx. ֌i$)L[G\I$mޱlfRn!k5LZu>пļ{>)e_( Ӟ+kXgBjΑJP ÿZqɂ μL *##bGj}'Sҡ`Tڶ5;tOYGijl1=+Z5)qO2gV[I#VW k>HgaPOn;TZ,M,Q-D ؊{5B'j[sfkc {xb"59 f=n_iVz/񴞾Z֞QBYN6VM"d%׍֬\Cu,r1C=k5h%KIǵ_H7ֳ>Đ72\ͤp07֨6Z^ 8 JIÂޕTHZaT=^M[*VHUY隞A!ڣ-Kk0i6Ek:nigVDNHXeM3iOi3ZAN;T6y>X Um,+$/R[nLrֳNm嬓=j(4q I7 Af+x$iv_޵nHE "dt>l-"8avioZ4XE4ˏ,g5Gy f8˞ߕtI)=V#hO*9cڵl̮ u)trэ~mⳞFV,)$㢥ԍVsţI?eHݛ5嬗!9k5WaXבk6ovc5cG +)AyoJ8cHWCGymجp_5,+{>wf㸪6"L<w(8_2F`;X=Ē*^<5 r\;dj7R]ۘU5Kۖcihv.ZSPndzm,+6.>ux~ݭl aZۺAšciH%q:CSpC$Jld* dJ|)d.1Og]ijH3>GEV֜}jg:%O*ciTRf[Xٻҳ~a5g ҥ;YSeq & 8H#W7s@U~NqLw yIHi1QK"(nNqV!K qFe^qWlˡE ?h*Wj[سiFzf% tZawtlҼ͆c[5h^1ۙ. gYlu@svqv"Qbb9A|u>&hmET5{8UYՔ/rV4/|VG.63,h7hqV= !Y<-dJk#4}<-T 4G xSW1Cu%IJZmCsNvHcBV`rMZWXMlS\ .MjC˥!؏AY]] QM+`K5'UWh=PGu3*iR=`I Zc,$5%ݬ+$1RO7&n2Au.7&k= -ך-S$l.,"2ڳrMӣ3Yr110p0sAB0>t&BaTQ"mhdYt+{x.ﶼߩaYim )vFzJ4˫[K{2Ugr-:S֙e3K'ᴕ' 5k8EHbrJԮ!$rtǥRFm\ۭ%%fYG˷5.Ie n5-3` Wwx/"Q3ӶkGnt1j-]ԭp3 =;\^h8'kXj< niA GHnc2;UߘG%OVNy"0 $wҪ ޚ]HrGzCPy@ct^mBO:cқ52#H&eaAEwQ rVfـdSOLՈ6m_1NA>݊@$s}*em.3J2?t=L> >FL+qzb XBAANCQ0y.zz5vuf((((((((x@:_M_A7TAzX򜪷\f8sTԦ?>OW:y83$ȕ]Jksd$Gi1m5]h24j݌,͍&Z00kFu[vKn0s^BQ26 xҢm 11^g6b(F9+ؐGLT1 sV@0ZqߊZ7y$sqrI8IH%ڪo;cB -S%4jy8ImmzdpmN9*t;ŖVos .]1(7k46qܰm5Omf=k%@ó?sPpt'U#dd9?JM 2ouOҗF#H# ҽmLmʰҕ#+ohەl?J#SnwQVU0nA2[l3xQ Qsf yW!#nAm!= _ziy aC,#+U~o$F 28&Cx<aC%Λ93? MWR 3\&\I5Ι;:~{]$%%'zy."Fo0EsWm >F1U!]fidmeEqڭiY.^o(3(Rw]Ip{M1ԁk- <8ӭN #ҠVAy9">Y3Q ܀Gt*Aik{Dr2AmX,FNk֮!Y.=Eq^'ODK65 p$ˎ7{IQH̲4r6sڶJvJ!Rjw(1Z4kG+KtXڑ1 Xe_U` cM[]\;!C39דXC%ASA=s]UKVIvzwUńsE"#zڻMm!MԠE@5m‡9ƻh1A?vVpYyK9XΡLjl,Om+kk[+y|ޫ3`<.ĖPebFPyY'׬lb$9*TuOɏhۅU{l~L0U+U+'[ӭ~pI;N*Fy1V +(p@=3^5MkJ* >AktHn%v du sZIzW s=Yb2RՔZc>˛:Kml>Xֶmoloe6V*gZ˻t;Te>~>u䫡&ޞWvnBm{4Z[f/1~5x*k9#Ff|淼%^#V[g уjx>z?*2ࢷkS:Ƒ|%(![ feRKxF>^H?7A,=knk `漣ē$+"ysEjw$J1PLOTn[9o{ădjMr9&'=*#nAҵH/2?(5F 0'g12y`;]xwg$]|m˒(/y3ޙ#p@cͨgVYNTSjtJ$MTNBZՒ9 Tb/Y3qֹO%/2G~J=]mrARhe-3}*Qfi$#:֡QiP477}kwA<[(rx5_MBӳc U ^ey'24k0֙jfI/Zan =s޺w q=3]f3y62~hzՖ)ʛ^OevL2 $]]3ZM$82Ǧ?kC{A9CrEm},i;K*"z`:ڋR#b8, ʨji *Iܷ=g 4 CSBcyܷڪsyI${vn+-{*Z\-\Oy(g^?Z5MfSXmy FSO[K( !@|՝: n!4ys,;wW<?h H$9$H;EyncYWKs#@ݿ^k;R :5[P d{xp-"Fd%m>k]6O39fhsbZjj73,g#s\@$x*Ge) ajv q;~{JuVxԄ˂1f8au<`#9aHI2CoV$y 簯c%s ymfFUNi+) hJ5 ѥRHLҫ0lqW^͞EcZݱW]2Uwݎz$B9eY6|+t]R Qe[Le? qk{}gnsdh~"\I+F[iRx55-Tڍū_dYf?#pv/aUZlov9m9 ÷5iy0V56zr+I CAI9#}93$2313Dp{qO/ l V^k>%Ē b~l7ssܗi̓y-2Ġ5 Zd@۾}3TV^tB&ojȹJZI'uO5yd|L1VtC Hwqx*܌PI<`zf^Cou4ҩ;b!zg<ֵmh !Uk"V  ײԍv--J[H-04>ծmgmFevUɼ5(! sںᴛP*9Z-WvAQ__F.( k#UYn($~uBQA*ϥs#ԢP/MH,SR5'k63Q[ʷ_15oXo>s4jk1\hQj9sTH$xKޑgx729Ͻ]U>VB~Z+g"5?$wS4pV$8MJs#\O1?+*;}OT V9 oGSnl} l}%0XrH3*y|eǘy(&$(LO1*%l6:fenJ ~8&m!A1=կ-ve6.:M-d;Q`i7Ο$K*٥1𶕵"'' Bg8I8Xxjdi8rE(l?Zy+p[&;N^"&JbHdfV ,8DdGcCyy ݚm\Uch[:=7ʡOJbMA Z}~e}kEt;(\ĪX ^k;HI005$PH#P:-b(BmU$bEQ[*)&hUBT{S.%G 2sZ q¨ &@Ùe ܁M @\.@銵asPz֤HT;*!<<3RN."G=楾B_LE M"PsO::v D7Ȋm X(u l:zKu (3[yx#$g+fx9^XI023ڧ1\jn;NYsƠ;Nv1*dft}j1bMv]_+Jw`0OwM5ҝ-\Kyw;X(潜! $gH{;iK2$xoz*ͤRʓ}}妓q$)i\wU+YRP8ѵd`wFz05ҋVXؼm".U!tnO&O62ⷖxIn=°$@,#PijcUc H:' \bM ae덵N]"(-Zer@*'RL3rn0\n^ cwO-Uc屁Һ i 1Z:uCU- J 0nǿz;kYY 䰞BRb` TjVWʒ` 0a1]WRUx(l?ҏ9, *7 ݐAf^6<+`%oܤǦ=BXӼ1]ߏJ-c {/!&ǥux-+Ll,.7CnqWzlj'bi \Ox| 5q;g)L/)wVP$ ut#%֙EtqR}K=8ZD^KƯiedeG?1# f[H8JxMUSM6PK[-=ITvp-^YW坻ji̧uPsUWQK9OmdDXDD2g@V;.LW_cN$2dX uH4AȐ [L⬦co)jEs~)z.~aead;ckWn`b"^M* yggn"ڵ<\-RM-;|Lkv1bd~'EAt.O\$j5 K)ژ}VGu).p'X~"ԭqkY+ S5,tZ 3}PW;A\W=RL0ؚ;flvTyű3V`wPtFgڛc|6.Hk/VG[:xFk?S 6 GFԙ"ь:&ds۳p Yڭг#N}!\[1H<zU ծݶćշ'-hEgnju۴[V cxVf}iq,r_kFHir9rZ[kUQUxPIl wUx;qKd+{^794WGu \IvTѠݚ r۳A THw_l]KӚSgeqJL #zsaoooX7<FuEqֱWKҬ-&CꨬrO\pnjanߵ>谋1̦b35$j.۴tV奒ܢ@ (L 6M,Șۃ[޽ x"[)6>(ӒSw:dswxM)v2֤HmnypӤUY8jJGܼsTږ%7s8A@jNQEup$PB8i֐DPw֠hxzў9/*_Az~ib5&Q';nkrMu%-:s^I1m2&7Ö[3am@1{]W5)NEnIPc^ )ȩ ]Lk@R11T+3GatYV&Yxdg)Y_#e!߷}?1V! מ*s!6jrRG;`(D]IpI֠U1b|S'lu-K 8H29>rX/qM5jԭ*yjRc khj6{qNJ(((((((( A5WVUqoFE5_Ru:O|y$EYTg$zWȭQzeHwnaWͺ]E/ K{r"V$+6hϒH{_&dms\2OFD\/pO>x|Fvzo,q8>Y@,B*Z+ZFU\摸q~lWtT/͓[  dKQ^eBɰh%ѐ95HI@mQ5nWn$Wt;B5B@wn ^3-@Jfˆ9@sq%[2 s "o8JsAvVwG .8DWR! ql<$n=eLA H>^xòe[9`zU=۔7=N (bOz$y,vO>Vw1!-IJu-0ڄ[|\17F5KQ5y"5xrMhtx%kgEKj"`0]Kov_^/jo\ɑw!nj AFgWEhTVHUU(aSQDW-ʜϱU*w`&F,^3EdV'Wm%U#!A,l DV{I.aF.}bcuV T۴m}́`0V 8YX  ?ԦzVw'{7=w\VY}GrG5#uNe7[N[Θ=:0o>==0# .<*%YKZY^|HeOO46w B|g)!\үo%7?9'"}'sȩC>sri+ ds9JPX1\^Ugn^Z7)Z|aKJ}2JYWQi,+N=)ʮ`+dYlF1jc;~0h=9^+@Faqᴾ?.+3:$h0dm.=ojZK.m~Hqku0{c5E:W; N7Ҹ- '%8).˱n#ҹ 43BbD$ FqGJvs+y}kӼ5%Ş bϭ^m6.b`P7dOj~t5ؾo)kcU_O;51;񧥕q,Ut{[z!Lp~ }E(486}ՌbmnBAa#M:\E8z|^G4)+Y2('Opk{p 5x2+6YFꁉDRw{ȻT7Ȟx2;a:,ec؃? cOHb8S%ȳ]'i\O-"."5{Stx"-Kӭ|Gvtq潒ys&¶Oj3m\Z[qm&Ze9ܼ{rsYP6QPۯ2|DAC"FAp^Pe//\(/aIK̟w5vidRisFq+'2OiRiw ,JU?Pˢ&KlaץvX;IGzԴҔbT(]M1$DֳН>sι1sاzc+* \w'+oYa+Q6Dئ8Zg12(Ri0cURգE [Ub&EU1I/Zyrʨ{;3ʪu.,חLC|D;ԓmF(+KHYO9\9?u^YmWO*Mnr ؾֲI9W tF+wwZL XwCV<8/7{nݞ?bIyVh2n/XϮrW> 嵟9)ukO/!W5wsg']zՏ4 ev'Bq+X Wn+aEv `WfK"~@껻IQ)O"ubU"$G%P*cRGTlĨiZS]F=ŬJ{Ť<?Bj31?1UYV%Qz "."V\wSSڵO#UwK\QҴo &ҹHvTtmD6ytZ\Zmq`u>d`c:յ,3сs[61A6ņv:stv:V6Hmfy 9{V᥷_Ar["cP1389^Ia&0.ןaKmkDʭ\Eđ{wp3U[˒gG yc5jIr3ZPW+lBU/;P,m ASm HOz}r{sz@Sr{֒gڼՀ[f }i 5dgfZ!1sGJxe5'4krǚQsɫ/l0zgxw0 84C"WOyNڨ@lLvWll^BQ2G;Tv\l}B1㞘`03Jgf,I>y ErxlΩ$\jH !Iv#k|/'p梂yd /'p淴&70<^[p9. xr9HlaiL0ҽsM#ٗ TՇ[,WEw fI7[,wlOzAgY?tQ>FݶN9TcϽTo.cW*y;d -~͵$A[̝HMZ/2,9%|kB|3rD :Y7H]34^: e}jkKX$ mAہOVֲŭmlP6o/P>&6ks oc7e+|۽ n\ߋOŭ,p>QjvV༲ ~o]Z+?|ZޥmQ3 U:wdcq${#+v5h^mKQ{ˁ=|9&|cl@?şJ9m@^u__ XT-s}:WZ+hcGgnynD+in6"IH|;0?ƴAxLsZ#fb)f\՛w1s@7vaָд-z| F?ZuFs.)*&3Pn, w$ƇqTTS[Nrcc>U/Zo j,i9%.:U;?^$+vI 0h,W7($so-9$`Xxxobִ٭nP:ZM"n]a_#5%r} dT թE~8ڱl0XqT䲘L m28W;$Q/RiZ!V?/ST/aB ^B&d Mekp1TMֳ'rbKnUKYB'v|mG>浴3Ou0p[k9twX[;1C6gYe+#ޟ̞̃}h7줚fzqVkIi1ʟp*ƕ#jG@[@mPȪ sFd}UP`VM!25#$ad+=8$yib68G#U,<4km2TY"B{V֛imķą1 AFpItUPcUZ$QN.R y.CmUQ*ܩ smE^EB ~xҬ +5Ե %d15[U+$o%zH|#|z(4k<[yV $wo_]@U֑cRX1WHԪ4ReD1S.ʌ,, wdsNYa9Oo"ܣ קepy/4HWwT3Ͻ;VMFW 3Ͻe$;9SX"H~c8fI`r3=1HsXIpΧ)\+~J̻Eic9Fj[c4gjaer=8>[?wtƉDmܨ"dU7ӥ\0IR[O܈bpIn*6P]p oJ2_[ Lc}='QER+wNp܄^ lxMh>pqUu Hײ,| c޶tQHyA[\ʙy"HeW)ʴ:l\НѽATc.ymZ|;*1د5-k\1_}*X. \18FK}Ai$<$8X)Ϩ۞Otv76jf^n qBx+7s:NuƸm]ԊXmPԨo6RbO8Nc䰵JېRcmr6球hA% #>ˑnjޑ߇TA"DV;54x1Z^dQ`zt^5 xt$Ιy<ȸh叩Uaie\W]s4GU׬|:iV-Fs}&ٷeS^8PfY$LmV8Q#PѭxP͔I'ڬ0I'$P+3R֓fәPKtMԂEE5>cE MkLڮM q]=*;[;C͘€E>Օ݅t5eA̢ =5c6<| fה/޻8;Bޯ!96mϚʧ5rD):u-^iٙNA^-w` Xe#;F=h2>[oX;hʋ$g`ǭumgn:Ƨ7a+2c {#St\uMDvPP$T\֕[Us]NW֝-!kA*B1] +HpVݶC5"ڮCYo-C~ح0`-Il і2zZ*:зtWkEQEQEQEQEQEQEQEQEP״ ڧ/?&Rq\c?a_-ѼFXu|shp |-Lnуx4Y~ܮX}nYZ$Z+hGOIQkBKQI1ԮF޵@eʐ|hIErQ"KGGQ #>Ek[EZibֵb]zDwdumR>yqsYzb3k+Y/\p>cbz}:BЬx䁷)d,z9-Qr@ۏZFe,n=k }-#nqJk5V!XhCv1Ұ$_F3U@# sW$^q ∢\38QjL.㷥?QõU4.;^ym + ?#$^ $t6 b0p:W/m.Rθ?.1rrOc,NI'6,Ř9Elһov= ,%L$KMC?=|M{gbѼDR|AsNzm/L +ڴ A c>'tfo&p+/^;uYvc)QTu+|p88v%vF+ R,_+1L}ye=TWl%֣.Ȯ3@ +r+Qp ڢzCW'>:V?Ê°]}½.' >:Tz|(8ȫw݌|`r̶b [-Ϋ[ip*A ~j$r3X$Mڰ@3@3M SE\5z\}C΁P>bak]mژ0ec ULWFw+kt٦[n< a_@hS"i6L/ZIۂ齀^lqoHod`pzq\ň(be ӊ/"&8=8?"G85Ftz.mq<] bHkWS֚;XF; k'0 $ҷ%f2H1? 1~5=C!ct؇QcRWX\㊋1Pxu.N8X3,.YCqz62~5<ONKkc[hIV[_Z vNy'֥&Kkb,|\*>h^K 8V籫֋嗋[k4hlߍ_I#tg5RKS}c۸ƫAM|8ژ,6p}QmLdƑ,f)WorjU[ "Ƞ8WQ3/Uy>[E̐NFim$nl3XXftdthO}`ަq@hWV7c+Z3EsIvF 2úL{;Fnj}L|=9It-5ַ/ $$Tl"f{F'nyoК9mMwܳ@YW>Kwv})#klۀ:V)צ鸚H/-(}jZh#~@JK\ې1Y$ViO]9;Y6T٣0q،bD<` 1µu]S±[۠gsVm]1ҦPBXqZYOu r@e=[7V-w x˽([6x^]rBוf3qlnmEbUbqQ ]|N) *|qQL!g ]| <#&=+ `ᮟm$j OW#HK{.D%IEY[ٯ|.T4vF2ֿGcaKEOɵH"KW3><1ԨyͣB1U<^s7U^Frk"pDWm9>^6xcwmb*>PA#4ͱMpXs\& 9r!=FE8oA0r*oCpr*`]Jw ϵ H UIVGb1ڸ+N{t]H1ؓRH S A8[.": OsaG;T:[c K#|H sEeCLª9%3L:Мk;9ImvBOa+D>pXH"$Sܲy쥊2cu[#c쨡Uknm)Mܢ3[ZD!R590j#gkxZC$ ].֊fO/vHzFU0U Ft߅Ǖ dֶu Oco<0O}Nj6<g5ɨyc 6쬅s$V†Ld啀\~uai 8Vrⱓł'm,Md[h>0-Ȗ LciZWH9SxUD<EjqHZjwchxu}ߴȇhcێj+[ޠ|񓌌U{Z\(|aXqa62pMVHw߹pqY+1ZZ})#cֲ/}kai,vqe{i|giclٮ8>k]*Xt$y#:iJ^"U̷Ϫ|R/Y~]+U_n!h1I%}zsxxP o_\4i7w6zK| {cn=@ȩ[GEeX!}(d.j.m*-Rm:EO1(j~-&>)=q> 4-lArpny?9$݈n8#ny| Ky3GPINgyzq^ B.-]7 %bcɯLѦU1^m(.p8cƮ x`U7HL0SֹG%pc89*â2v5 k$>\u^m|$8na6\Aᚯ >3RPjϵuYBښۏ[O|${[MN-3tn[Mf>Kw!nzo@ӳ`늖Eac'y/MrdBNs_xsJM9aP\h:ex Nr$a5bۤx|O36?5v}Һhj> ;5{d2-B+>@C/o>B+6u7 Yz\YܘT~5v5D-" 87:҄`X8#^UKhb_3bz9bi6W3 sWt'f8^5\Er-s ܒ\[9>O[>3Vxc%qM]j%<1\Q۴ʬHcNb7"T!UsЀMz{iᔑ1SM,2R1IiA1MO(\c*i#nazb)_ q™6Msұ$2CUQcUI-HQOVo5ų$1Tr$$I*)z(J6bv8WKxҠًKϖۢwctQb6ֵLo fL|ܓSib7ԡM;'u,q1cAD-e$J%Buo?ɪ8xm0?ZpOը5<ΦGV.C?14o ?=N2OOJW\dBF+n rOj|5"8$sսs{U_#5]j0YGfزs\}7vfUk;"3*5]Bn,U]Mgfx`*) 08?S/;VJhg,u@ܢ0kռ:5Y>`#^CȮEQ-W ]zHX+@I ':io8E,Q$L̃2?т8'ir:1#`pN?ZjJFrqƺ%Ʒsjm43izTm1Mb1-gTqIPE%N$ $Okn1]nЉwl`.yjфM6 >,wXYds)eo/Nb(d`{˄QlaYpyVx(nw23VmݬK8:V:ăW?އ+j6VBAI!N,Pذ2&z u$`VsYFј.Fv'"3DuRĎSTu5IwT-rLY8IP=MH #ۿa+jezbj.\b>Йs"'Ik{e@m;P$*wKX r2&#69ebi9M l5n,GJ~RiʞSNyf?z5܅'D@mv3!%WpU2hǥ: ,.sN1MϕwF\/8SMOD^"8SS2$ask[(&"H.jԶҋ"- `do0қ;zm9XvT-B2;zm9݀f7i!Ojeɸ xǵiAlѓ(%RqjFleS.柳BUN+"mBUHK;۪Nw+]u`3]W316Zg1 j7urc#_ˎ'kƒ]WuGQ=i]+Tje<,|8N${qkpvuQYNŤTb;9wf~Oە5ҬbE9+ɤK6Vȭ9Y@mHZBJ`:Wg"2PN9c*s;g8hٴe$ck0$csS#nPnjCYkkQW7ۛ{B $ndG_RMpkVh.xY190oNjmM &K;ymGnej̵K|̃Mef[|d`ko2 m3"u Z|*u?iB7wiwL-MZ%>R9] 277QUN:wWLOg{=碪9yH+|pwZ#Fvyuqj^REی W73rdz5 d2 qkkڑ{"l JDs7\Xp7:mP"Np9'kO"#̥0_,1I.?Nգl܃}XIA #9pq}_YcINmAVdt !ϥ=a!}*yps}*`N;$SyK;9j>ȉ7ʠrX 񇑷;T(vԭ&p S^U8Ҫk3EI=zTM!l lxcZPifRu"߅!v95[I]HՋGbQ_uxN!f*ֺo+t=3T0',H\m]$Gi 6X7$vХ#m`~]VxXkM++UEm b)\ۗ>r ^)#;? k'9ܸ+F-J<' v`DFv\ji$Gm#%AEIY#2W=k?~>3ewi%B9qRX E we-@yGMH9nXKq1[w mjm0mˍZɾL.6 _KUH3jxe