,Photoshop 3.08BIM,,http://ns.adobe.com/xap/1.0/ image/jpeg Cartaz-Funzone15 2015-06-16T08:59:15+01:00 2015-06-16T07:59:18Z 2015-06-16T08:59:15+01:00 Adobe Illustrator CS6 (Windows) 184 256 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAC4AwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A7+XzZU6q1hYmnTImYC0S sJI8OmIyAoMSiIbinUjYDExZRmjob4K61IpUA/TlUsbfHLRVNRtmkQvFTmNyvj8sjilXNlmhYsMa nDEknZgTUZnxdZJQSU816dcp1WEHHL3FOHKRMe9GD407dDnN6Wfgz4g7jNHxI0hZlJjYd6fqzq4S Boh0k4miEuZzv06ZkgOGSiLUkxN02b+GVz5tuPkrODU/Z+17f50yIbClALu6qvAkufD8f8nL8kxC JkeQDhRBlIAVz/HwTW1QJHxXoNq5x2rkcszKXV6TTxEI8IQMrsSdx3zq8WGIAdDkyEkpaGmluKRB Xdh8CihJ36D/ACszKAG7r+KUpbbn8faz/Q9O+pwCa5IM/EFgPsoAP1+JzTajJxGhyem0uHgjcuf3 Jfc60HLtWgJqB7ZdHBTjz1VsZ1nVg1VUgkmgFR1zYYcNOn1eq6BjywXDsrfCCWr8VKV26+2ZMs8R s6qOnnLfbmhJ454wKhaCu+345djyRk4mXFOPNM/IzMfNulbrQue4r0br75V2h/cScnsW/wA3j/He 9ELZopbB7MLgc1GozU5WONtH5Zj4tTZbJ46UmJFSB2H0Zu8ErDg5BSnLJKAxAoNq+2ZIAapSLILG 7M1sjkUYfC48CNswskKLsMWTijaH1CwWb95GAJe47Nk8eStjyYZsXFuObGrhGhmAK037/qzMl6oH 3OsI4ZBExTKp+KgBB3OcrmMYR4pERA79nd4rkaAtSuL63XcfEe9Mw4e12jwAxMjOv5o/XQ+1yJdi 5shsAR96UO9SabDtt/blc/8Agh4B9OKZ95A/WxHsnkPOcR8D+xWtroQhgy8uRBFB0/HK/wDk4WEn fFIfEH9TbH2WnEbTB+H7Vd7+B0b4aE9Aa/dmx0vttoMhAkZY/wCtH/ibcbP7PaiIPCIy9x/XSFtI +K82QBmY037eHXNzm7Sw6oVhmJxHcXUYdFkwb5ImMj3plAP3INOtTmEYXKnOjL0pXcpMyiKFOcsv woo+mp+jOriRzPJ57KCRQG5ZBoWiwaeiyMoe7ZaNIK0Ff5a5hajOZ7fwuy0ekjiF/wASv5kvmttJ kCGkktIx8j9r8MhpcfFP3NmuzcGI1zOzzu/1S4QGNTQ7cj4V7fTm8x4Qd3k9Rq5DYKFir3ExZxUh qb129sr1U+COyNHA5JWU8itFKABB1/zGczn1lHm9Ph0oI5IO9swRTgG67eO2Zmk1RPVw9VpBXJD+ TYzH5y0kekAC7ENU7/aHLr26ZutXPi08t3T9mYuHWYxXf+lnvPfNRKNh6kHdcJBmm1OAlzMeRvmM 0k4T087G8JOdGUcka6hSkPt8jnUaDNHJGwXVaiBid1ppvse2Z7jo3Sn9NpYqEITyWvbsRlWYXRb9 OasJiJ1GzbeGY8qAsuVE2aSvV4Uu4/gAWVd1Y9/Y5oNf25OEDHT1xd55fj8UXYYeyoTIOXl3Bj8i yK5WQEMOoOeS63PmyZD4xJkO/wDH3PU4cUIRqAAC2mYjapFKHCztrjittqlT7YqSq5PFlnjlxQJj IdRs1TgJCiLDHtN84avdeZ20NIIWiWWSMOAwYJGpO5qR28M9h7KyzlgxzkeKUoxO9dfdTyWq00OO QA4Ruz6HT2taNJCySUozMD38KjpnQnWXzDrI6AR5FFQuoNSe344PGiWY08gxnzlfu0ixRK0hiXZV qfjbxA9s2WhlDrIOk7XjlraMjXcCd2CFZpZmTi3qE/Fy7fPbN4CAL6PHGMpSqjae6PYyGqqhCBt3 b9XTc5ou1dZDGNzv3PSdlaOR2A2vmncskVuqxJUs32j3+Wcjiwz1Ejkl9I5B6ic44gIjmUovrqMq KqzVr9nvQdtj0zf6PTkOn1WYEILyZIj+dtJYRuKyH4idiaNuNunbN7qgRp5B0XZshLWwNHr+lnZf NdT0duD5XLECyE6WGZlIPbvmPn0MckDFnj1BhK1X1B8wc5+EZQO2xDtJSEh3hdQFSVJPtm60+tva ex73ByYK3i2lzHbyCRmPENvXw7nMrUZYY8ZnMgRAu2GGBlMCO5JXajqsNjBPczI8sUMUkxRWCk8K UFSG6lhnLZNV+bJFkY49O96TBpfCI/ny+xhU/wCa8hr9W0qFPD1pZJP+IelmN4GIfw37yf2O3hpJ HnL5D+1GaN5r1jV9TtkktLdbduTSskBYBFUsd3L+GUflMOSYvHE/C/vXNhGPGTxG/exHzh+YHm3S /M+o6fZ3EVva2szRRILW2aqoePKrRsd6eOY+TDjhIxjCAAP82P6nc6Ds3HlwxlKySP50v1sw8z6z qGmW93dQCP63FpT3B5xxsvqr9Wjr6ZXh9uffamYej02KWqzylGJ4RADYV6hvty6dzqtPj8TLjx2e GUpdeg8+bDfy+/MfzFr2r3Nlqi2j20NjdXLNHbRxycooyUoYwtKNQ9MzsmgwTiR4cNweUYjptyDu u2OzIaXD4kDK+Ic5Ej7Udrn5mnSNZm06bR4J0gSEM6SyxSF2hRnqSZF2diPs5iajsfSCRiIctucr ++vscTR6CeXDHJxkGXkK/HxZJoGs2Wv6LHq1pC9snqvBcwO4lMboFb7QWOoKuKbZpNZ2D+8hHDdT JHq6fIONnJwExnvQvbqv0nTfLtt5pU6XdfWLyS6lF+rBlKvutKMq7VrShOd52ZCWOAxkgiAAFXe3 e8/q8ZB4qI4t3rebdwlJ7W2k+3Eje5UVxVKrzynoFxIWeIxyvViyuwJp1NCSNq+GAkBXmf5k2thp UYsbOeblOV5HnxccTyNGQKfAfTlH5k/wpOIH6hazRZpodHW4vJSagyVb9lKbb/LfBjxSyyA5yk4G pyQx2eUYhILjzF6s/Is6qX+IqNwu1KbjOyxdmxhARHQPEZe1zOd78/sQL6i8wQerIlOXMqPs1G1N +/fMqGnEejiT1ZnW5HNNPITJ/jHRh6jkiQgg9AaNsN+nfK9f/czcjsavzWPc9f0s9MlP6ZraekJc JQT1pjSiS7l79sCbXqvJSFO4HT2zUa3DUuLofvc7TzuNdym0zREmtCOozHjjtmZkIW8uWuDStF6n 3Oec+1HbMss/y8D+7gd/OX6h9+/c9Z2RohCPiyHql937UB5nuyPL17I37NhIhYdQzXVqn4hjm39n c/iaeZ6gRH3t2WH7+A9/3MG8m69YaRqzXd6JjEYJI1NuFMgdxRSORUCnjm2hl4TbsNRpJZYcMe9n emeZNL1ya4trVtUEwt5ZElmu5GUELxH7rk61JamSw5pTyAcUv9j+q/tdXq+zDgx8Zru6vOvOaxX3 mDU1p+8e8n9Nl7FpWpT2zW5t5k+Ze07NHh4oH+iPuZh+bDJDaa46kBorMwIR9oLJf2lRXwIgofHK tDD95qZd+SMf9LbzvYo4tXgHlI/7EvOPyvLCfzTdRgl4NAvHWm3xl4lAqdgd8z4bc++P2ziP0vSe 1prSxH9P/eyLfnCFtS/MjV7K2YAHUHtVdqgLwf0hXvtxyvPH94fefvbtBAY9Djkf9TB+y2cflYrQ 3l/5aKATSSwy8H/35bzqswP/ADzZj/sct0cQZgHob+I2/S8z2/AyxjKOXL4Hdd5AuTc+ey259S7L tXfqznfM3QG5F1fa8OGEB5fqZ7P5yk0zVL/Tnv6mxVZpWu43UMvJVlMbkUoHkAAJ6EUrQ5vxGMhd POeoJ7pvmpruV4liWdbeMPPPbyJOGI2IQRV3rvTr7Zi6kxxw4tz5AbtuIGUq5Mf8j65rWqXl+2u8 kvNHt4bWclDGjSsvKaRRRdn9JXpQUrTtmkJOTMZ36a9I5UDzBHfcXYzxCGGP84yN/ACq/wBMlWsi yvZpLm9ijkLMSvNQxAbsK5tsOD08nRajUESNHkxXzJqob07KKQIvJSwAOyj7PQfTnRdk6SryEeQe S7b1vFWMHrZ/H2pZb2sw9NpLj0wspdRQ1B2/edO9OnXNvKY6Do6nFgkKJlXqv9ruXARBbj0wvOmx +Co+X7WDnezIbV6q5/D+1MvIkv8AzuWir61aORwofh+0ePTv1yjXf3M9nK7JP+FY9+/9P9rOCxoN xvXw/HMF3hKiXyVNZLluXTwIp0OPDajIQire7jZtiA38p/hlGbDxRIcjFmALeouhi4kAk0pnG9u6 86PTSkNpn0x95/Vzeg7P0wz5QD9I3KXjPH3tUj83XPDQtTQ9DFAtfeS4DU+X7nO49mdtLkPfMfc4 lXqY/wBUsd/L3RbHVrvUfrUSXC21qJIYpTIE9Rpo0Bb0niY0Vm25Zu5Z4Y4SnMcQiOXxA/S52uyZ IQjwHhkTz+BLMvRPl+1mvxHYQRRen9Ye2t5Y2EAlRpSXmuJ+iKcxtB21jy54wjj4eI8+K/0Ol1fj SxnjmZAdKeVeZLyXT/NN8k6kPbXshdPELKTt7EdMunCpEeb6HosYyaeJH8UB9zIPzV88eW9T026j 0q+F7LqjwMY1jkQwxxSSyP6pdVHIsyABSehPhjp8XhjJvfHlM/geh8/dYdR2F2PnxakZMkeGMIcP Mbnyo8qQf5Q6a7aN5gvJVAt7z6rpcTP9l3mnVnX34jjX/WGZGMgTiD/FID5ev/eo9ssw4YQ6i5fD 6R95+SVabO15+bqKAT9Z16rbVNHvKsT9HXEDiyDzP6Xc5o8HZ1/zcP8AvGS6p5gXRfzGsvMsCela 33p35jG9BMDFdptSpWUSrk837vNxDlz+bz+hx/nOzuD+IXH4j6f0KP5SaisfnG1QqZJGDuiCgr6U byNudvsrXLNFljAm/wAU4PtBpJGIkOUf00A98Pmby7dEWd1IiPKK/VrgA8h32+JSM2WHUwyx4sch IeTyM8ZiakKS3U/y88h60BI+nW5ZBxjmtT6RWvcekQtfmMl4kh1RQSe98tp5VgubqHV9QvIruMwm yvJhMi0IflGeKleKqVA6fFgiPEkI0ObDLPgiZdwYm1xdXju9AaeGyjN2MQFB5g5JTsoZdOWKR5nK SXDSAtIQNjv9n/JzaiewiOQDrhpqkZGjInn+ryQl3cxwsgeSEEyGganXbc/5H4ZZEE97VlnGJFmP P8fBI5L+WQxcPRRf3lOfGvT9v/jXMngAvm6s5iarhHPn+n9Cafl7Ix86aGDwP7wgUA5ft/a9/wCG Y+v/ALmbl9jH/CsfLr+nn+OT0JTXiOIPXv1zXl34K0xBgNqVBNfGld8NseG1CS3mpVQGFPpyYkGu UChJWZCQy0IHQ5YHHkSF1pPLKhMhqA1E3rsBT9eePf8ABA1Qlqo4hyhGz75fsA+b6H7LYiNOZn+I 7e4fttEjOAemSLzF5f1PWY7+ytQYC406ZJzBdzBo43vBMo+rQzdOaED+zPQ/ZfTyloyOX7wnfu4Y uunq4YdRxS3HBW3faN8keUm8vR6oWvFu5Zo4lcKqoECyV3Vn9bftWMZkdtYvD0kzYP0/eG3LrvHl EcJiBe567JzqDafHp0s2qzwWumyBopZbpwkb8gQUFd3JH7KgnOS0Gh1GYieP0iJ2kdhY7u/4AsxA zPBGJnI9Bv8A2fF5jdx/l5qjrY3ev21+YgIrLUK3djdrCgokM8strNbzhFHFZG4NSlSc9DiYTiDk IGTrw3R+Y/He5+iw9q6KJEMfFj/myMT8uGV/jkiIPyh0dZkZ7XUJoTR43lurOKCVDuGWWBbtmUjw UfMZq9b2jpdKaySkZdwjz9xPpPzbT7T6yYIjjhE+d7fC+fvZi76LYabptjp13YL9Tn0+8i0q3ura GT0RPDdMypdSqSXi+Ms71bx6ZXi0+plrceXKI48UL9PFuOKPXvJ2vo6LURz58csnDPIZ/wAXCaNH pQoAdzEfL3kCDRfPOk6rc6mXBuTcqhs7gI7An4Vng+tW4IYjZpRmzyQjiHGZRqO/Pfbyd5q/aWOb TyweHOMpR4e/58lHzn5X1W856bYW/PUdPvppbay5Ks0lnqIFyWRHIZuF2JxRf5hmNoRPLpMcjEic RwyHX07D9fxcbsLtDFp8uSGSQjCdSB6X+PuQ/wCVWkavZeeKajY3FlLb2d1JxuIniIJiMf7YH+/M jqbhiyE7VCX+5Ln9r5cc8Q4JCQMo8jfW0V+eepw2mg6erUErXRdWp8QRI25UPzZc1nsjcsk5XsIj 7T+x5XtM1EDzTr8u7Gez8safdyzTm+vIUuJ2kllYqZhzCqrMQnEMBRQM1/a/tDqYaqccU6hE1VDp seY77b9LocZxgyG5ZJqEs+oRLDdzSSIuy1apG4J3O+9MzOx/avPLU445BGjKia79u/vILi9o9kwl hnV8r+W6X6lcWVhannxhiUjYdanoAOprnremxmRvmXhNVlhijvsGK6lr1zJI8dtbiNRMIyWYFqmv wbHYHx/HNpjwACyejoNRrpk1CNeqv2JJSaSVCbdZHedloWJLNt+7PxdB4/jmTYA59HXCMpEemzxf gc2ksrgohaBUA5VLFgW+YB/Z+jAZjvZx08qFxHX4/wBie/l9CieddHp1E1CfHZsxNdK8Mvc7DsjG BqYe/wDQWcrOneuYvCXaCYVY3RqUFdj0Pz3yJDOJBVV7fCelf7cizDcyRtEwdAwp0O+Rsjkz4QeY S2JEjAWMcUHQfPfPBvaXP4vaGaX9Kv8AS+n9D6V2ViGPTQiP5t/Pf9LAfM3mf817m9tbXyrb3AsX 0+yuZbmxtFKl7m3SdmNyUYqB6lPtgZ6Bh7OxYPTjgBVb1v8AE82rTzxzjxZTz7z+hgXm/wDx5Z3M Vv5pv7iW5uYhcLBLefWiIn+yzcJJFXkOg8O1MnlBB3d92ecMheMCvdT0T8loG0/QtV1fUD9Xsrzh Fbynq0dosk906jwRE28WHHxzD1Gljnh4cjQlue/hibNfYL7yGjtnPeSGOG8/0y2j+lht/qWufmH5 xtrbl6f1mX0LC2JPpW0Fa9B/Ko5O3VuuTA5AAAcgOgH6nrsGHD2dpTLnwi5HrI/tPJMfN/5f6dpV peGx+trPYRR3LNcvFIlzbvKIHkjWJVMTRSSR8kYts2zZDBnw58ZyYZcQiaO1Op7K9osubUjDmjGP EDw15dD+Am/5O+aLhbHWNAuXL20FpNqNhyP908VDKinsroeR9xXvmPq9HHURETzjIEfMX84/cGHt VpRGIzx5/TLzFGj8Dt8WI/mOnDzleQKP9547W3UDp+5tYohT2+DbNhqDeQ+923s5Hh0OP3H7SSzb 8ptUe88na3oJZvWt5Y5rYKaNwvCLeTiewD8D9OYk9GM2TGf9TyCXw6/bwvP+1+HgkMo/jiYn3jcf YSl0HnTzVefma2lfpOafS77XPRaxuD61v6Ut3x4iKUOqrxamw2zOjlkcmxO5dhn7K0o7P45Y48cc N3VGxHvHNkXmP8xV8nTW0Nnpy3FlfSX7zQfWLiMcYr2W3AUB2hX+5O3pmnamRyy8bAIT3jOIJ6Hf 3PI9mdlxzCU74ZRlQ6j8fFg3nrXfJn5g/o5ZdSuPLctn6itHdQfW7dhMUqRPARItPTpvBlfZOiw6 MSEOL1d+/L3Afcx7Q7NzyI5Sru2+/wDW9jspdOubBLnS7u2vbBaRLLayrIqkCoRgDyQ0HRgDnnna fZmowHjy0RI/UDzJ39/2OXiyRPpAII6FsmmayEzGQkOYbjEEUXn0ukarfXVwfq8zESBRcStRQBUH cjevanTPqXDqYDHEgjcXT4Ln0GXJlmOGW0qsn8fZyRyeU7eMs1xzP7zaNTQAb/AWIqT77ZE6snk5 UeyIDeV8/wABVNpaW44wQcPiINOpHhUitchxk8y5AwQhtEUltyNq0PffscuiXFyRR3kNl/xvpArv 642/2JyrW/3Mvc2dmD/CYe/9DJmkyIDIyUzLQ9SOvTJUw4m1vpU6SuNth1FfDfticYPRRnI6l0+v TRxNUBxQdRQ179DlctOCG2GuIPeioHEkSSDo4DCm+xFc+cO1wRrM18/En/ui+xaIg4IEfzI/ckur weVvLvlxr3Urf63p+lokdpbXcslyS4HG3t4fXaQpXh+zTigJH2aZ1PY2r1mtyceScvCh3emz0jtW 3U89ve4mXS441CAHFL40O/8AU8k8r6Rq/wCYPnGWa9kIjdvrOq3arRYYFIULGvQbUjiXp07DOlzZ IxBnM1Ebk/j7A7bxo6fGBEb8ojz/ABzes+eLhLTR7rTbOL0LSLRLv6rCn2Y1hubKEKK9T6U8lT16 k+OaLsbXHVTz5DsBwCI7o3Lb9J83C00a1WLiNkyJJ7zX4pgn5ICI+fIuf96LS8+r7Ann9Xfp/seX TM/U34U65+HP/cSet7eyE6SunFC/9MGd/mXwh0XUL8ndNOewUE7F769tJAKda8LKQ/Rmi9lYEYMs jylKAHvFk/e872Xj49fiA/h4pH5frecflnaSzX2uSx1HoaJqB5AVo00PoJt7tKNs6jT7TB/G+36X ova6YGjr+dIfZv8AoX+Yaah+cF7HQETa60IAOxAuvTG/vTI5RcyPM/e5mk/d9mxPdhv/AGNsj0Bb Xyl+eb2MnE6Ve3RhSo+AwXhWa136UVzHv02y6H7vNXS3Vav/AA7sgT5yjEH4w2l9lsZ/LZ2vvzQ0 mc1q961yamp+HlKak9em+Y+PYg936HP7bkIaKUf6NfoW/mzKDq2moD9myaTw/wB6L25uenymy2OP ghCH82ER8g832Kf3Ej/OnI/ci9B8qeTdc8saYkMcVzrhSX9Ix2+pR2l/6vryekI7a8T6vMvo8Psy IffMmAgQLu/x+NnX67VajHlNC4dNvLv/AFvQfy/8sQ+WvL95p4+uLcTXxmkiv7Q2cyKsKKqmjzRy Cpb4o5GX8c5P2uyREIYwd7v7Ka9JmOWZnVbUnrZwzsQll/ruj2wdJbtRIpoY1PI1FaghakUz6N7L wzlp8Zr+CP3B8t7R1mGGWYMhfEfvY/fecNP5MIFllHKoLUUEePUmv0ZtoaWXV0mXtXH/AAglJbnz Hcyn4AI1J325EDx3NMvjgAcGevlLlslst5PL/eSsa1qB0+4Uy0RA5OMZylzKfflsV/x1o25/v9/n xbMXXf3Mvc7Dskf4TD8dCzb0lYD4yOu3hldt3CD1aFnXpLTbw/tw8fkjwb6uOlzMPhmHSm9fux8U dyPy0jyKjc6JqDxSBZUIKhaVbcClB07UxOePco0eQ9QrpItlpnqTmq2sPKUrvtGtWp92fP3b2kMu 1MmOPOeTb/P3/S+u9l5K0cCf4Yf7nb9DxX85vNVxqXmefQ4yyadoM0tqEP8Auy5RuE8zD3ZOKf5I HcnO802lhp8YxQ5R+09T8W3TgkcZ+qW/w6BGeSvzY0nyr5cXS7LQPrN7LJ619fTXJUSyCoQemiVC xqaL8fcnvkdXpceeHBMExu+dX767ve2eBKc+Liru25fj3M7sPMt35u8mS69Lo8YWxvZrO6srL1DL cWE1rxuY42ld+UqessqAUqyKMxcQ0uhMYiIhHKeG9+fS7J/Zfc4urxTx5BKBMpQqW9d/l7nn36A8 zeXr+DXfLsj6hYwuZNP1yxjMsRpUUkWjek43V4pRUbggjMzJilAvU6XtPT6vFwyI9XOJP4+YRuq6 j+ZHnkw28llJLa25LiOCAW9sjcaGWWQhUG37TtQdqVzHw4QBwY4gDuAr7nN0p0WhufEAT1MrNdw/ Y9G8qeUrby15Ze19T6xqGq3FpFfXMO6kPOkaRQVHxKDIfj/aPT4QCcEa+J1uPTwNniufd6QSI/A7 nzAHQvK9udpHWXOqxx+kdTfOR9/Tyeb6GpvfzjtCeP7zXllYfskC75kd+tM2ePeY94+97LVZRDs0 j/aa/wBjSL/M+1m/0W+LEz6fc3OlXDjYhY3F5ZEnrU2t2i1/yDkY5xnxQzD+OP2jn+r4Og9mdVwQ yYD/AAyse4/j7UJ+TCB/zF09zQrBDeSkd/htJaU9+RGV5pcGOcu6Ej8oly+28t4CO8x/3QSb8yrl n1y0R6h4tK0sOCeVGexhlb4u/wAUhNcz80amfx0dP2VKtNHzv70zvvyptl0bSr4311ZvqVnBd+tc WM01kDOgan1i09eRAK9XhA/ysPoBETICR6Hb5d7gZe0iJSBieEHmHqvke1Wy8haHZ/XYL+SKO4aS 4tZhcREtdS8QrjwQKCvY5xHtdL99CHUR+8n9TPSTEzKQ5E/oCatnKQiZEAcy5t0Lee3PlzzDPLPI ycUncOQzrv1psCfs1pn1DgzY4QjH+aKfDtRoNRkyTlW0pXz/AByUX8r6tVi8sYJbkSWbc/zbA5b+ Zg1/yXl6kKR8vXSkFrhQQ1ajkadN+2PjjuSOz5DnJT/Q4TjW64/arRTtt8++HxfJRo6/iTv8v4BF 510Sk5bjLTjQgLXl8P09cxtZK8UtnM7Ox8OeG/43ZXHIaJ8SDdutNtu/8MJDVGXLkqI2y/Eu4P8A Hr74CGcSiY39x0yshuiUQJYwpDOo27kDKzG24TA5lJdRKXNne20AW6fiVMKOoLBh0rUAV3655l7T 6eOm7Tw6ifpxy5musf2U9r2JqPG0s8cTco+fQ/gsYv8A8u/Lt3q1/q97pytJfTy3U0t/fSSIJJnM jfubWOy4irf7/OQl7S6aU+HHDJkl5Dn+n7HaiGcRFmMAPx7kdaeWNAs0RYRYW8zAn1LDTreZh6Sm SQhr1dSdQEUknlsO/fKR2zrMsuDFpxGdXUz0+PAwlEAXLKSPL9lsn0eeJrRo4bqS5iRwf3nFQrNG riiKsarVGU7LnN9v6nVzlGOoEY+mwI8t/ie5v0kcdEwJPvQd7oflk3bX7gWV9Lu15aXEljPIU/ml t3hdqe5waLtDtKEeDEchA6cPFQ6cwaDHLhwE3KvnSnps+jN+8uGubiSJgy/Xbm71B0PqMgINy0vE 1A3XYVArXYbnXYe082KAjklkGSPEQAIVy2va+f7HFxSwRkbHDR96YXN5pOqQPZvJMByVmMRmgmja JwyuGThKhR1BLD7NN6ZqtL2N2jppePCFShfWJ7wdr3/FN09RhmOEnmqw6ZdQXEE0Ws6kfq7o6pPc tcg8CDxY3ImahpvQ1965OXtdrDEg8F1zrceY35/BI0EAdrSzXvK8uoXFxLDLatFdLD9Zsr+2N1A0 lt6gjlX05beRH4zspZX6U8MHZPtF+Ww+DOHHG7G9VfwbTimJ8eOXBKqS/QPKCaLq0l9Do1lHK1rP CtzaXd0gDyxlf95rkXOxrTafbN1P2m0k4kCM4k7dK32PUnYfNcstVkjwzkJR+3b5ME84eSRqt7+k p5bvRbqSKCF7e9spJ7VPQgSEcbrTmvqJSPbnGtM6DFrtNqDePJEk9Lo/I7/Y14dZPDjEJQNDqPx+ lI9Kb80PL/IeXNXe8sYvif8ARtyt7agLufUgq4WncSRinfMs4ZVRGyDqtPM2ef46vbPL97qt15Y0 +41r6sNVdpluJLURrG/F/gYel+7JI68e+cN7T6IRyQGOHq4TfCOgoDYdzbo8sTZB9PS29T1G20+0 e6uCVjUgfCKmrGgoMwPZfs+Wq1+OAGwPEfdHf76HxY9r6yOn00py93z2SaTzhoTr/flfmjfwBz3o aWY6Pm57TwHr9hQ0mv6TITxuk+1TcEfrHTJjDIdGJ1eI8pBCvqNkSpW5g+2aVZfbc17ZIQPcWs5o H+IICS8jIXjJGQvKn2T1Hf8Ahlgi0GYPUJh5EevnXRtwf34G1PfrlWr/ALqXubND/fwTZbi4pFRF apalTTlQb13HTMwxG7pRlltt3qJurnihpUFHI+IioFasfi6jtkuANJzT29x6/t6IaWa4ZRUCnpct 3O4r9r7XX2/DLBEfa0TnI/6Xv+3nz/FISTmK1UD4Vbr2NKHr1NcsFONIHu6L9GuntNYVuP7mekct Kmlfst18evhnJe2fZH53QyEf7yHqj7xzHxF/GnqvZHtE6bVgH6J+mX6D8/0sjExGvSxyMySNaf7j mUlX9b1k9QREb+q0HNV4/F2XcjPLPZYfusvh145j6ft/TT6n2l9UeL6L3Ug0sVzpyag8i3a3F7aF 7naZLO4gEcXrep8QAd5ePqdBU9KZ1ekyTjDFHP8A30uIdLqif0R+x1mWIJkYfRsgYY0NlaCIojXt g0MtxHGWNvdiaUxOyxKXHNVVX78X5HouVZc2njGGHMY8M4daq41+PeExhMkyjdg/emEX1iG7uGtI TbVuo7ixMouQjwKpWOGQW4JVk+HZhx3avuMHb2llKYM4x4ZdTsQNrHes9HkAG3MIWzW8srS3m1K2 MbW1vfW7spUIPrKMYvTrIW+CWU+9N9zlGDtzS5JgRJM/WABGR2JsdO4X5Mp6TJEbjbbuW6O6iWN4 I4Ip5o7hJFZ0DFLmMwRluCScOKtRVDcWNKd6zhrJaTCROGSXhj1SFEG97uREjz36De0HF4krBA4u X45J5YXWoXcvKO3nm+sS3IsjEpMYWzVDxegpWflIqkts6r2JzV9m+z2HLofVH97kBIl3d3w/WW/N rJRy7H0hAyeY7wWd1dERhLcqE4qXWQswbgrh/wBmH4mamxKinxLXCw+zulOn45SyRn9O9Vx8ttro S8/i2y1mQToAEc/guvNYa2vltJ7sI/1m1jcpxcSQzDlI8X7ukY40K82bZvbfdy9mNDHhuJ2I/iPq vbf4npX6HGGvym9/sdBdM1xZQzSS/FqD6ZcySScaLWIR3J9L00Ev701X+72+x3zIh2Zoo8IGGO8j DffkJG9751792B1GU36jytIbyw0rUtOFxJBBeXcsExvFf6vHcLdK8npSRTM3rhQnpMEjor06lq02 GlhjwYRDH9EbHPkRzu2nIZTlZ5lMoXtzc/VkRhZTWtmFMSyK8Li0HqolFYFHlLeqh41ahLDqIZO0 MESRLJCIr+cLZRwTI2iT8FfXtGOsWyQPMYPT+MhRyHOlB/LWm/35j+wmhGnjPUVfiHhjex4Aef8A nH7mj2mH5gRxXXDuff8As/SxG98lajCGMMkUqincq3foDUb/ADz0eOriebw2TsiceRBSq60zUrfm JbLjR6krVgOvw1Vj8P8AnXLhkieRcaWlyR5x6oAn4gOAB5Hap9tjv0yVtYj5KZOw2+nG2QiyT8tW /wCd80X/AJiB+o5i6z+6l7nP7NH7+PvTtGDcP3Lvu3Kh+1ttTbtmedurzYN1sSuisZZOFYSPgapL dTvRhQHZf4YJZAOrOGmlKtuh6/b8EZDoUDAepzP7up47b1+3uDtlMtSejl4+zYnnfL8FMrbRdKjq fqvIhV3kJbw3odt8xp6iZ6uxxaDDH+H57pobaIwNEkQjUU+EAAD7hmJM3zLtcURHkKSyRbC4mazu BHLNFuY2ozAdNx1zyL2q7GyaLN+Yw3HFkPT+GX6jzHy7nuex+0IaiHhSIOSPTyRcUECIqJGqqpqq gCgPjnGZM08h4pSMj3ku8EABQCsvECgFB4ZUtKgbAikv1bTp7wxNDIqlFkRlcEqVmjMTdCN+LGmb bsftT8nkM+HisV3fa4uq0/ixq6S79ABWha71BV9Bo5FK1jb1I44oySxfcOtunIHb5VOb/U+1c8+O UI4vrBHO+YrucXF2URIG7ryXFNDjtIIJtUDSWn+80ySKHipIZfg4d+bk1O/0AUxJdr6+RhwQMI4x sBxUf63e5ceydjcSSfJDvfeV1BWa9e4HOWXjxIHK4blLT00SgYgfCDQbUFMysnavamTkIw9wj+m2 yHYX9H5lSm1/y0bVbN47i7tI6mK3lJkiSvXgkj8VrU9BlEj2lkiIyyUB5/pA3+blQ7EAN1FQfzRo 6MWh0tSxpUtwU7dOgbK/yGpl9WaXO+ZO/fzcmPZEfL5ObzVfMxeDTVDH9qjMfwC5WOyMf8WQsjps MfqmB8g3b6t5ovHKxQRxEKTupUbDYfEW6nNl2b7PYNRlEASR1N8h8HC1+r02DFKUJCc+gvr0uuiQ /p/zRpM7xXgck/E0c45LUkVYMO2+1DTPacWkwiAjAARiKFdwfGZ67U45njsk77/rTGLznZzAi5he 3bb4vtqPnQA/hkTpiOW7kw7SjL6hwohruCdS0LB1rT4TWnsffI8JHNv4xLklt3HFJQSRh6mm4B+g bdcsiacfJEHmEmurK1pUIUJruDtlwkXDniCafl1b+n580Qgmn1gUBHahGU6s/upe5v0EKzxTeOUb VJ71zYEPNQKLhlG256GuUyDmYyifrkMK8pZOApTc/hlXATycrxYxFk0h5/NdrErCBXlag4s3wrXb 6aZIaUnm1T7VhH6QSlN/5ivLoSL9YkRCV4IlEBFPi5UNflvl+PTxj0DhZ+0J5L9RA8tvfbWm6BqV 3ci9sPUgMcnKK4loAU3rt+0T92YXaOPDlxHFlAlGQoj8cvvc/snFmjkGXETGpWCe79P3M1hkagWT aQD4h0r7jrngPb3s/k0M7HqwnlL9EvP7/sfZez+0I6iPdPqP0hR1ia4i0u4kt34TRpzVwAacTU9a 9s0+ijGWaIkLBLtsEQZgHkkujTrf2RlvdWkjn5yBoluobXiFQNHtIPi9V6pUbJ9pts7XB2Zpq3jH 7Phz7+XlzLk6kHHKow2ofwmXXfly4Rv/AEuQ3TJrfyb9WaJ7q4u76MOA7m4lgZyX4B2h/ZWqhmTq N1zYY9HgAqMfV5Db7P0ODLU54ys8EIf5oPS/q+NA8urUGneUEtnnjhWW7jhiMScbkxmdVdpqiccS rEKF5Dp1oatmXHQGtoG6HSXPrzcXJ2xRo5I8Nn+KF1tX0/G/7AjLK2srhknXQTJFJcSrGq29u9KM 7hgsbgkiF419MjgKcviOxujoJk7wr38PefP4Vy6uPk7XxiPpyk7dOPuFj6e+zxc962SXTdK0b9JK L2MLaPM5cnqsZY8a8VpUCleK5o9XpJ4dQI5DUDv8PgHB1PtDkyS/dTIjQ6VvW/n80/g0ryAiFnlc vuV4IVP2FFGrH3cMRSu1K5bj0eCQ+rJL3cXcPLvv7HBn2rlPPJL/AExXX115YgtJbWxt/Vm4yKly ymlWcFWBLA7JVfs+By6fZo4TGGKZO/qMT1O258tuTh5NZfOVpCkbOaKKnMTF7O6iRAMavvI/taY5 +LklOqy+YdCv2v1YXFhIAvpgfAu/Rt6qf8rv+Gej9k9mafBi8OAqXU9Sfx06fa6rW6jUYp8d8WPu 7vx3/sCOg1rSNdtzG6gvSr20oBIPiPH5jMw4pYyzhqMeojX2Fjuq+VUUtJYvt2hf+Df1zJhqO91+ fs8DeHyY7Ks9rMVbnDIp27GnzGZFgh15iYHuKvHrVytBIfUWu9RvT5jImAbo55dVx1K3lAqSjb1B 6ffg4SE+ICnv5dup89aJQ1rcLX7jlGr/ALqXucrQ/wB9FFLehKDmRStKdiR/HNoYW8lHLXVTfUp6 AI/AcSNuo67fTg8MKdRLoaQrzu27SsxK0NST3+zk6ajInmVW1sry8YiIniVAMjVC7U+H6KZCeSMe bfh008p25d7JdN0Szt/imY3MpIJ5/ZqOnw+3vmBlzyPLZ3+l0EIby9R8/wBSZ6j5istNj5TylpGN UiXdm/yqdvmcx8enlPk7DProYRcjv3dWITXmu+ZdSjW1laBYpOQ9OoWMfzu37Ry/PpMMcZjMCQkK IPXyp1WHXanUZh4ZMeE9OnmT1ZhGs8VskN6fXYrwll40VtqElR0rnkfbHsYYyOTSe/gJ5f1Zfr+b 6h2f20aEcx9X84fq/U3Da6aUPoRQhd1rGq7EdenhnHDLqNLqInLxiUJCVSvofN3uTIM+MgS4hIEc 7R+k3FrZW0Uc2mQXciOZGkkbc1p8NOB2HEfj456Nn9stEPpMz7o/rIeTwdh5wBYj8T+wpno+ta1q 0c8UaWQS3UeqbhWDFW5LuVO/wll+nLdL24NRxeHCuH+dKv8Aely8/ZJxVxyu+6P/AB4IqW310LFP NfW9jaijOFpJVwCC/GZQoB6L8XH7NNqZbLtDOBxSGOMffIn/AHgruPXboWA0OImgZmXuAH+++XT4 JI/lrSTOVbWoCWYbniD8QLE19Thtt+1/bi5e08hl/fY4/wCbH9MiPt/bZDsrCBZxTPxP6AD9iA1K 00WO3D6dLLLKJOLJIoPwcASwIUD7dR1zUaztvJIAYs0jMyqtu7pwxHV2Om7KwxPrxwArn8fMnoxs a5p41WPTvUPru3BiooqtTYMxpufbNloOw+0dTHjzTnDH5yPEfh0+PyLg6vtnQYJ+HijCWTyiKHx6 /D5oXzHBqejapDrVvM8kBHCSNiSq/wCRT+V6ffnd9m6TDjxeFEV958ye95DtXPnGYZ7sd3QeXu/S ntrq9pqtgJoyGjdeMsTb8T3Rhk5YzA05GPPHLCxyYfrvl97aRrzTWYKACYlJ5LSn2T4DMzFmvaTq NTojE8UFCy80sV9K9ct0CzAdf9YZKWHuY4tb0l80Zdtb3MfxMJYy3JW61/ygcrjYb51Id7H7vTij BoJTQMTxNajpuDl4n3uDPDXIpWxdCFZipFdt9qj+OTaapkv5Yuf8faCOZI+sDbfb7W2Y2s/upe5z ez/76Kuz5uHilSG0vJqGOFmUg0biSvTxplcpxHMt+PTzlyB+SY2ukOtGliZzT7JQ06/LrlE83cXY 4NFW8hfwTeJZlX+7KqAP2SBT7sxSQ7aESOiX6lrV8itFZQOW2BmMbUH+qKZZjwxO8i4up1eQCscT ffX3JVY6RqOo3TvcExxlw0s8i7k7/ZqN/l0y/JmjAbOHp9DlzTJlsL3JH3fimdaZDa2UAitVVUDf EQBUttu22anLIyNl6rT4Y4o8MRQSvzX5oFlB9StmH1yQfE/X01I69PtHt9+W6fS8Zs/S4vaPaXhD ggfWfsQnkry1JDbHUZZGjmuR+6jBp8FSeTjuW7V7Zi9q4MOceHOMZxHeLb+woZcUfE4iJS+7z77Q mredNQs9We1s0iuoYqIeQbm0laEKVNOu3TOby/8AA/0OWPEOPGf6J2/2Vuxye1+fHl4AIzA23538 P1MiNYoDNcWwUqnOajkgUFWArmgyexMiahmNecP02Puenj7QyEblH7f2JFpfnNNQ1GCwttL+KYkV LgkUUsSFCGuy+OXS/wCB5OMblqDQ/of8f/Q63F7ZDLMRjjO/9L9ideYX12z0qW4srfjMpUD92zmj MASBT+GZOh9h9HxjxZTn8aH2b/ay1/b2ojjJxgA+60q8mSa5fTXKaqJ5HHF4ucZUCmzbBQvcZ1ce ydJpAPAhGPu5/Pm6PR6/U5zIZjI917fsQHnny/exajDe2tvIRMtHKoxIkQUBNB3WlPlm00mUcPCX XdqaaXGJxHP70802a51fRgl5bOZCpiuY2RhUjvuO/UZjzAhLYuxwzOXFUxvyLERY67oGqOIreWW3 I6CNqSR126D7YzM4oZI7nd1Ix5MGTYEx+8frZGxuJYPWWJwjKD8SMDvTbcbEd8xdgXaWSLY7rXl+ Sf1JrdAs1QWUKQH+W23vl+POBsS4Wo0Upbgb+5JoYtYtJHVYzT1QrJ6bcSd/iHw/Zyw5cZ6j5tEN NnifpPPuP6kcgvJeBEZRhIdmjOx2+I/Duv8AnTKzlgOo+bkjS5j/AAS5/wA0/qS+YOpjSTghXn8M i7io/aqO/bLQQeTiSiQaO3vTb8tQR5+8v0dCPXFBQVAq2xNOv8Mp1f8AdSbtCP3sVyKWodt603A6 ZuCXiowt6DYecLa38oWVlZ6lFY6pGQGEgYhUWUlq0hmHxIOlO/XNJm0sjmJMbj+z3h7js/W4xpoj iEZD9fu7kI3nHUzPpBXzCiekZJNTkljoJIWnQpCEjjK+oIlPxBevRt8fygqXo93y5/Ntlr4Ax/eR 8/dfL5LNH8xeYkcyX3muwl9S6tZZh8dPq8aslwiK8KcTJ8BHGm9TtU1OTTx6Y5cj8+nVhi1wH1ZY cx16denXZkN/5i1e40yJtM1DTIrxo29aSRpmjEhZfT4Hh9nhzJqOtO1cxoYIiXqEq+DnT1VxuEof j8FWsdc1n9Iq17f6X9QrxkjhMvMLWUgryH2j+6rU0+1TtkJYY8Owlf8AZ+1nHUHi3lGv7f2fagfz E8z2VtZ2q2k0c92zHhFXoGAo7Vp8O2W6LTkk3ycPtTXRxxHCQZH8X7nnXl3S31S++tXYDwI5aVmO 8jnfid/pzaajLwRoc3nuz9Kc0+Oe4vfzLLPMettpunOEot1KGjhUmhBoeTf7EfjTMDBi45eTv9bq vCxmvqPL8eTEfJ9j9a1mOV1Bitl9ZjWvxA/B368t/ozN1U6hXe6bsrBx5QTyjv8AqZl5t1D0PL92 RQNKgiG/+/CFP/Ck5rtNC5h6DtDLw4Zee3zYp+XFxHbecrK4lKxxxeoXYGtA0DrtQmv2szNfvhId N2PH/CY/joWd+ZfNmszLqcdjfxwW7tZnTLoCUejxkDXDTKY15dDtyYEUFN2zlgJk7W+p6fHpICJy VtxcYuO+3prf9Vbm+TH7TzD5jj1K6lj822Zku7e0iiiYTyKt1GYBO6xGAKqyBZdkpXkOnVbjhyVf DL5FnLW9l1GHDGxKX8UASDxcIvjskenn3des3v8AzTdm2PoXFrFL9YehmjuqfVgjGM/3Y/ecuHId KVoemVjHk6AuviNMD6jtXfH6uvXlV115Me0/8wb1Lyx+ua3o7WajjqHprciRx6afElUC8vVD+A4k bVy38rm/mlGXWdmcMuGR4v4fVCuZ5791edozWvMOtXSW7aNrNpbvH9YM4kRyjhnpbbehK2y05UZf pyH5fJ3Nun1WhjfiAy+mq/2X8Q+HP4JdD5z1aPU7qO58wWHpNHaiG2jSUyRzoYvrK0+rVKvSWlak VHTtZ+TykcmGTtPswRAHFxgyvzG/D/FzHp+3mtHmvzFIkcp8yaag4RiUIrunP1+Tla2wYgwLx69S emxwfks3cz/lTsujQkef+52/i/nfjoh4/NPmlba4guPMun+vVltblFJ4uVNBKDaqCOXTivuTtRj+ TzdzOXanZXECBKuo3+z1fefv2OvL3nmyto5017XLe6leelu8KOAqkfZNIYh+v54Ros3UOu1naejk R4VxHW+/5l55+ZGrWGoeaBc6eY7iCWEfGQyEsq0IYMVOy0IObnSQMcdF5TXzE8tx3CF/LMsfP3l7 4EoZwQQdyKtud+uT1f8AdyatEP3sV0boBFygZ925EEjnsNhttxzbHru8ZCtvTfP4/wBitZavc2Mi yWiskxidWcGvIGvxUIOy0/DITxiWx73IwamWI3Ab0f7fh+hG6j538yalBPBeTtLHdIfXHCJeRLL8 dVQED92o28Mpho8cCCBy9/63Jy9p58sTGRsSG+w+fLyZ75Lhu08v2CLHewxAx3CPF9RNJKyhSOYM nFpKUVwe/QEZq9WQch+nu/i8npOzISGGIqQGx/g8/jue9Nre51qW6tr6VdRktLgoyf7wgszL6ElU BAFXdVFabZjyjAAxHDY/re9zYSyEiR46P9T3LLu51G2TUdSn+uCD6vLGsSfUvVLjlJcLxb7Uan4u S706YxjE1EVd/wBL4LOcoiUzxVX9G/Nilr58N8ptPrusLJcN6VI1tFCqsjyAqyojK61Tcb9f8nMy Wk4d6ht73W4+0PE9N5N9v4dvs934pP8AT/MdlbG39Ca7KwRPCJJo4GeRIQGgBIUjkGqWbr7+GLPC Tdgfb8XZ4s0YgAE7DrW9cmPXn5g6VNrMWoibVQUQRIEjtTGII5WdmjRgwqpRG360+LbMmOjkI8Pp +3m6+faMDk4v3nLujVXzH496npMOhQ6cl3p0dxHNeF3njuCrEAMfTKlQPh4n769MGUzMqlWzfpIY 4w4ogji33+xIfPF6Wgt7YAmpMre1AFBPz5HL9LHclxu1J3ER+KW+Txx1dn4sOERNfCtBvt3yzUn0 uP2bGsl+TPJvMutWFjIbGdopLZZGt/hVuLkE0oykHfxzXjDGR36u9yZZRieHmAwTQtX1TUfN2nXV 08stwGEIeEW8b8I4+IVTMFhBC9S2Z2WEY4yB+n+10WDLOeaMjZPw/Ts9mt59QWEfu9Qe3W2mEoP1 MsoC0mCqSdvUZT4ntXNOQPLn5vTAmuv2MU83f44hW3v9KS7D6bHd3jzXH6OaNIQySXDJxHJis6mo K/ZC0G5zJweEbEq3ofxfD7HX6vxh6oX6bP8ADy6/axjQvzF8ztapD9cZZbWNUiYJGD6SqyKRRP2Q 5Wv41zIyaWF8ubRptbMxoncITWvM/mB1lm9YS851vbmJo0AeUDiJCVVW2VqUBApkoYY/oRmzT5j3 pbpH5jea9Mit7aK9dLa0BS2QpGwiDrQgckNQQO/z65OemhKzXNx8WsyRAF7BMLHX/N96DYac0s/I OoijiR2CyLKjioQn7Nw/31yMsUBufx+KbRqMh9I3/H7U71pPzevIpHureZon5maKOKM19SH0HPEI TVo6ivau1MpgNOORHzbsktSdzE17g8y1eS6e9aS8h9OagRloVH7tQg2Nd/h3zNiKFOBKfEbKd/la f+QheX/hIrcrv4/a3yjV/wB1L3OToh+9i5mHEda718M3Dw9K1i2nesfr4mMPE09AqG5dvtgimQnx V6avzcjAMd/vLryr9Kb3n+BxFO2m/pP19/q31n0OPVKc+G/89ae3vmNE5rHFw15X+O5z5R0lHg8S +l8P472TeW/KWlalo0N3Lb6kZiC080cllHAFLOiFRPIj/aA6/wARmHqNVKMyAY1/nX9gdto9BCeM SInfvhX2m0wXylolsALiw1UyevLE1ZrFUCLIVXfmPjVStakLyr2yk6mZ5GHLuk5cdDCPOOTmesP1 tf8AKuNHutQjt7jTtajaScQyStPp59MFDIoAR22CHk3wnptvg/PSEbBhy7pIPZeOcqMcnPvht9qz RvINlDb+rHZ6lJI4e4MvqWqL9V5Sekw5kNUqErt/MfDHLrCTzj9vPZs03Z0YCwJX/m8t6/Qxjzk6 6VdS6dSWPmzFAzRs4gccoyWjLISykVoaZk6b1ji/FuLrp+H6N9/uYjaxC4uIYVLVb4WPhua09qZm SlQt1eLHxSAZskyIiouyqAFA7UzXkPQxIApiXmS7WbU3FSREiovz6n9ZzKwiouq1k+KfuVvKrot5 O4rURhR9JBP6sjn5NugoSJ8mbQzeVXt1S/8ArxZgVnEHo04nmPg5+3Hr75gkTvancXAijbALe28s 3mv2dtFcT2ulSFBdXF20aunw1kIKBlpWvHbM8ymIE85eTo4wxSyAAkR63T0m10Hyr+izw1UskEU/ 1JZLq3+MQTFQtQKfvFPw8e9a0zWyyz4uXv2LvcePGI7S2HLcIbWfKHkKW0ubu61fa2iM8EUF1bF2 WJgLiKjLu7gfuB375KGfKCAB9h+H7WvPpsMhZly7iPj+xgVjdeQ4Ht5X/SokG1yFNsVI9NK8K06y c+vbj3rmZIZT/N+112M4YkH1/Ynt1P5AaxheGTUXupYpHkC+l6SOQ3pJRgG68eZqdq0ykDLfSnLl LDW3Ew2HSJL7Vbeys1JkvJUihHYM5pvmUZ0LPRwDjs1Hq+if8GDRvI2o6R5eZ4NVlspo4L2HiJ2u TEwRgzlADzPw/EKeI65zWo1EskrPyep0umjiAiPiXzd5A8rX51zy1faUNV0u9m1FYru6MkBe2twV KySRegPT+tRl1RZKqf8AKBFcIZd6t2UsPpuiHvv5s+RLPWdDuNTtogmqWaGUuop6kairBvEgbg/R m30GpMZCB+k/Y6HtHSCUTMD1D7Q8X/KwkfmLoIPX62u30HNpq/7uXudZov72K8CMheTkVJ5bVp4d ++bYl46MR3tr6Q4n1SpKMWoDsdwF6/tfxyJJbIxHf0P9nxXLKoH9+w/d0pQ9a/3fXp3yJ9zbH39P wGQab5+8yaXDHHZ6mUjtouECmGNqBqFkqysaKen9uYuTSY5nePPzdjh7RzYxUZ7AbbD5fBRvvP3m a6tzbS6mZII1EUUZghFULrIanjWoeJT/AJnGOkxg3w7+8s59o5pCuOx/VH46K8HnXzJLDLBJqh+q ySSco1hiQOJgVkkbio3p08O1MgdNjBvh397dDXZTYM9r7h16oT68EHL12orlid9unx9epyXD5JE6 6/jvSC5vJZ5ebOw3PFf5QfD598uAAcOUjI2jdDADtOWPwqUT2ruaf598ryno5OlFG05+t0G7mgG/ 9Mo4XPE2IXNy0s8spckybn33Bp8hmUBQdVKVklM/L8pBuW5E14Dfv1/VlWUcnM0h5sts7vyvWI6g 9+xJrcmAxCrcn3TnX9nj171zEkJ9KdnGUOtsQgtvLd15jtrWO7uLTSmIFxc3RRXjcJV3BUMKcxtt WnvmSZTECaBk6yMMZyAAkR82daf5W8iQRz+lrLrAVM1ur3dqXZYW9OegChWMjf3NDQ0PKlMwpZsp /h+w/D9rtMWDFEbS294+P7Fafyx5FFpcPLrIdUs55FWO8ti7SxAL6SoU/bbkVFfiUj3yIzZL+nr3 FnLDio3Lp3h5/c/8q+j5xq2rmRUoC31YLy9bpQfsmH3+17ZmDxf6P2uuIwj+f9iS2l4QrRFydhx/ D4foy0hqjLoyb8vr2NPO+kmaQ8GuEXfoWYFVr9JyjUj93L3OTppfvY33tfmB/wA5MebrfzLq2g6B aWllBp9xLZi8etzcSNBKytLGWKwqGCr8LI1K9fDm6emZV5g8iaz5P0jWPMGjzQJe6QLa7gWKPhM4 MyPOktwXjMqemGHE7ydCD0bHhD1nyczJkHhgd/6FnkL/AJyNtfNM8ug61pJsdQktZmW6gkDW8npW 8k0pZH4vEOEfwgGTfqe5y8QJmAO9wMpAiSeVMJ/LGRX/ADL0JlYkG72HhUttnQav+7k89oh+8irR O1IaSxrQvTkoPHYfa+E1r265sz1eVgDtuOv4Oz0DTvMltH5HsLPT9VsdP1hKBvrTxqVQTNz5Bo5q 816bd+ozS6jGfGJIJD3fYvhnTxMh0KU2F9r1rdadGPNFjJHDNNLqFw84mSW3klhpABKrMJOCO1eI C1orAHAY2D6S7eWTT73X2Kuk3fm2O7tpLvzhpMyyXSSalEWQobeNY14Q8oF4M4V+QBUVoRQlsZQF bQk1z1WkA5xHduP1p/qmuatJbWTaZqnlyO8UOb+OectCzVAjCFQH48SxPQ8qdq5VHEd7jP5NUdXp d7kPnFAjXfNqOiPeeVZ/WL8pUnISEiNylVZlYqzhBtUip7brLwR3T+TP85pP54+YQ35qajpM9lpy afdWszLK5mW3kjkpVVoWCFttsv0MJAmwXQdsZoTjHhkDu815dNx36j+zNk6EJtbSelCiBhsprt3N a1265VLdy4Gg68uitrIQy7pT7zSnTrgA3Zyn6UhZ+u46Dt8um3XLXFTLSZeMUx5DdlGw8B22yqbl YDQLKLC48nejGdSe+M3NfrH1YQBaVk5GPmK04+nSvevtmNIZL2r7XPhLHXqv7GPQ23li781Wtsbm a20eRx9buLgxLIjcayMCFZeHL7IIPyy0ymIE16nFEMcsgF1Hzpm1r5R/LW0u0lXWGa1ZbmQGS7tP UaKNBGqxDgqvI85PDfjRcxDnzEct9uh/HJ2ENNgib4u/qPxzak8reRY7Np5dcSRobe5laKK6tebG LiAiKUJZ2JkKA05DjQrvR8bJdcPUdCk4cQF8XQ9Qxi/f8qgCyjWmZ1kUk/VPhoaw0p1b+ev0eOXD xv6P2uNLwP6X2IGKT8rhcz+r+mvQEgNs8ZtOfo/uvhdStPU/vKkGnTrvkj41fw/axHgWfq+xGfW/ ylR0kifX1dJQ3MfUgQocFSuwowSv+yp2yP77+j9rP9x/T+x5adDsbTzXFdQ2zX2izXa+rCxCypA0 ylgaMg3QEcgRSu/SuavUaKcd4i3baXX45GpGv0vTPMX5mabdeXJljsLvV21K5LXdhdK8Zi9MrIn7 y3CsfUMYp8b+5FPi1WPBkMutu6zarDwdAHmXl7T7jTZjfSyCO7YOscSNyVBInByxpuWUlQNxT6Kb /R6MxPFLm81rNYJDgjy6ln35UzMfzF8uqWWi3IAFBUA8jQ7dcytV/dycbSH95FERc6Q0jiapenIj fYV5bjp2zZk83l4RO2w6/gq2n3klpLHMLW1uP3b0S4VXVgCSSykj4hTbK5xvayG7DIxIPDE7HmjL zzC9zZvbnStMh5wn99FCqSgVT4gwf7f7v57t45XHFRvil83JlqDKNcGMbdB+3m9B8lWNsNI0x7zy vBqAuoD9UkEVjyllV3+008yswKn4qioNKeGa3UzPEamRR/pfoDutHij4cbxiVjuj+koq603S2udO gtvLcLLOkF2gMNikkkERSWUf3vEMVjj5c6KQZADuMrjklRJmeo/i/V+Nm6WGFgDGOh5R/X7vtXQW vl7UnmttK8pSueM7MjpYKeZgiSPczLRV9YPsdmNR4BMpx3lPu/nd58kiGOViOL/c9w8/NCa9oOn6 np8EA8ttZK100sclrHYQXDQRsbdY2cSN+89Z1Lg/DTcHoMliymJvjvbrxEd/3MM2njOIHBW/ThB7 q5/sSWy/LnRZrOKUadrBmnVPqrmfThG0jKiksOfMJ6sigeAPjtlstXIHnH/Zfjk0Q7PhX0z+cf1o hvImgRyyI1lrJSAT+pKJNP40R34MOTrWkcEpb3A8dx+an3x6fzvx1DP8lAHlPr/NSu4/LfWL+9uI rDSrprOK3+ANPZiVbji6r6hMoTh68bA034j3yY1cYgWRd+fL+xrloZSJAiarvjz+fe86vba4s7qe 1uUEc8B4SpyBoykA0IJB+jM2MgRYdZKBiSDzCb+VNGvNavl020aJJ5izK0jEL8Ccj9kOe3hlWbKI DiPJydNhOQ8I5stuPys8wReoZbzTk9NkMoMkvwczRQf3eyk+Oa2fbGnhfFLlV8tr5W7aHY+olyA3 9/TnWyVP+U+tz3BKajpe55jlNKoYcymxMQqOSkbfxGVx9oNIduL8WR8dwmXs9qhvw/f3X9yI/wCV G+cEZK3WnAk0Wssu5pWn917ZkHtXCO9pj2Pm8kWPyU83Vp9Y04kKQQZJv2q0O0XXwyP8q4vP8fFm Oysv9H7f1Kcv5G+bnShudNHw0qJJ67GvL+664/ypj7pfZ+tP8lZO+P2/qeXXETxSSRuE5IBWjA+G 4365sgXVmNGlF2IDbKNx0Pt23wrSxianZftU6in0b9MCaWlj8I2py2Fdu3v0xSApM3wjp3374ppl X5TN/wAhI8v/APMWv6jmPqv7uXucnSf3oRkaEiI/V2fkX6EjnQDYU/lzYk+bzkIctr5/H+xYAOMZ MBNUc1qfipy+L/Y/wwE+bIR5bdPx8lNqUFIyPh3NT4/a/hjaRHyT3S/P/m3SY4orG9MSW0RjgBji fgjkE7ujGhO+Y2TS458xzc3Hrs0AADyHcF8X5medrcKIr/h6cRgWsFuaRvQlTWM1rx74Do8R6faW Y7Qzjr9g/Ux2+vLu9upLm5LSTuyq7UA3A4haAAVouXxAAoONOUpmzzQxrUVjP2iKb79Ph+eFFeTU bHaikk16V3p/TAUgK6TSiJUKOYXVn4AkKzKGHqU6fDkS2C68vxuhjPNHKksXOOSMB0kUkMpB2cEd MTuosbhQdnYszKxYjkWNa7kfEfnimk68pa+2ga3a6oITJ9WLVQ16SRsh8P5qjMfVYjkxmI5ly9Hl GLIJEGg9WsfOuna4JDcG0sxeSQx3Ed3dfV6Mhl4ow4OR/dfEQe65yOfsKcuLj34qur34fh5vY4O2 sYEeE1w3V1tfx8ksn896FDq1tp4060Kuqot8L2U20auvNkd1VjUcqOoU7mm+Tj7M46uuQr+L9fVh L2ilxcN8+vpr7uaY3HnSO5t5He30mWFJJPibVJADI6SFwrCHj9mM0Ab9pae10+w8c9pX1PI9dj/F 5tUe2Mkd48PQfUOm/wDNUptatXh9NE0P6ukscDTJq0pj4ytG9SzQbJ8R5d/gen2TlMvZzTmPDUh8 PO6+rrTbHt7ODdwPx8qv6UQ35n3scht4/wBCMiQSSrKuouU4xOycamEHk3Cqg9QRmzj2dEAfV8nA lr5E/wAH+m/Y8Q8w2a2uqXiL6NwvFJRNaSNJCvqcWqGZUJ+1TcZuscrAdJlhUj+hK5kdfUrCycSv KtfhqNq/PJAtZj5KbA8mHpEUelN9uvw/PFNeSnuStEJqxAG+/T4fnitKbH4QaeO/Y4pplf5S/wDk yfL3/MWn6jlGq/u5e5yNJ/eBEVi4rXlyqee4pTtT+ObC3nREPYfJGq6Y3kazijuLVNShZkdJWjUg CZiOXqeKEfwzku3MuWEz4Zomq5fHm9V2dOJwi6sfrTiS6t/Wsq6lpqlC5vH9SII6GQFVVTU8uA8P pzSceslKFTG18XcRY2rvr+1zTKHeFKzubeJ+V3rOlOGljZwJYqemqkSKoIWhb4en+26aGvBuUwfV G/dRvpte345jjgOZiiP0vosLWok1PTZ1Bk+suJLZKjh8AoW68vD6cyox1gMRZlz4tq6bfavi4x1j 8wlUV7bLCjSa/pCzK0fHlcQkBVVgVYUoxPPc+3XMHHou1KHqPFt/O5C+e2/P7ObHxsf86PzCbQeY vLaQqs2raNJIF3c3EFS3M7HjxH2O9Bv2zZ48GtEakCT/AJ3f7h067b9GXj4v50fmFOPzPo/Bg2qa EZOPw0nQLzof8piV6eB65XHBr63iLrulz/Vy+1fHx/zo/MNv5q0YSNw1bQhFxf0qzpyrU8K0NKUp WneuMtNrrNRjW9fVz6X8KtfzGP8AnR+a3/FmiiWo1nRfR3PE3EZO5NBUcdht+OP5PW8X0xr4/q93 2p/MY/50fmwz86dX8tajoVk2m31pdXMVyAyW8kbuEZGqSFJPGo+/Og7NxTgSJAgOB2jkhKAogm3j xkAFBX2zbuoptpI6NQP9sUrT7O/X/KwMqCbeTbOG/wDM2m2j+kqzTlJHulEkAj47lkLR1oKn7Q7Z VmlUSW/TQBmB9/J6dL5OWeaKdINMSC3Ml1ckaVwAjgf6vcB4hcMW9JZRIEH2z9mpGYHjV3/6b9jt Dp/KP+l/a1J5OurG1lv/AKnpD2kUVzcyiTTVYRQ2csju4BnZmo0McZBLHjIeoBOPjAmrl8+/4fil OChdRr+r3fFilvfeS5dTuCL3SALu8rGj6VMsKKBNAnDnKojhdSkjBmqrEGvwnLyJ1yly7/c48ZY7 5x3P838bJT5g8waXaXkE9ha6VfJNYWyOsdkI40li+GUOjO55FqguCOWxHw0JnCBI3sb97HJkiDsI nbuQF/51iuLeaFdB0uAsaCWO0VXAYEGpqaEV+Gg7V675IYq6n5sZZwf4R8mpvOqu0wh8vaUoZ36W YJVZABTdjxI4VWnSpweF/SPzZeLd1EfJq88/NdXTTSeX9GjBNFhisljjRAGBVFDd+dSTU1A3xGGh zl80HUf0Y/JCzecPV02ax/Qulx+tBBbm6jtFE6C3QrzjkJPGSSvKRurHwyQxb3Z+bE5tq4Y/JGfl LT/lZHl2n/LWtfxyOq/u5e5Ok/vIqgkoF+MihPTt8t++Z7oAg/LOu3NvqFyZoIrgwsQI7hPVSjE/ DQ0/lyojisOYSMfDIAHbqn955qa6sXtW03T4mkQqbiG2EcoqY/slWCr/AHPZf2m8cjHDRu5fNEtT xRrhj8mQ+VvO35d22k2tlquktczRwul1dJbW0krOzuUIaVuwk4/ENuK5jZsGWUiYy+0udg1GCEBG cbNc6H4/AX6t5+8hnToWs9DBvIYVRo3s7b0mdKx/sycipjllYk7+oEPQUyI0+UE3Lb3n8d3wts/N 4JV6fsH47/jTrT8yvy++oTGLQUuL83VzdRm4s7b01MpkaGN1DszIDJx6/CoHHfB+XyE/VtQHMspa nDEH02bJ5Bj+o/mHp8rk/wCH9LtxDHMkAht6NSYovqSktSSRFX4SONG36bZcMBH8Uvm4/wCZEv4I /L8foWWXniBJrad9I0300ZJDEtrQViRlFasaiXkPVHeg6YZYLHOXz/HwWOpAIuMfl+OfVq38+CK6 klk0bTHhuGLSW4tgqxIRIDFCCzKq/vOXxA0YLsaUKdPtzl80x1VH6Y17mKySgkkEqCNlFaAV+zue mXuKpvKAGJcgcQN+/TY79MUhT9dJA3CQvuK/MDvv2wMiGQaZp3le5WAah5lex9dudwPqc03pMGkW rcWHJqKjfD/N4jKZymOUb+LkQhA8518GrDQ9M1DzDaaTZa2XgnDSLetC0SpMIfU48XdafGvDmSB+ 1WmMshESSEwxCUxES+xlC/lBcS20rtrUnGyt72ZVNsxAFo4DIg9XkObP/Lv2DZjnVi+XOvtcr8ia +rlfT9qmPyYu00xr661VrcQW89zOv1fmI4bYxrcNyWU8gjSSAhRU8KgHkMfzgugF/I0LMvs/axJt I8ofV4HHmc+rIk3rQmxmHpNG49JS3IhhKtWBHToaV2v4539P2uP4cP532KmoaP5Ii1CSCz81yT2T lVW4NjOBwLxD41LKxCK7sfh/Y2HxCkYznW8d/eyOPHe0tvctudH8pnTfWg82NcahKpY2BsrhKuki oiGUtw3RiwPalMeOd/Tt72yOKEiBx7nyLMNNHknSZrMXs0a3rusLLqlvztrlp5Y5Hmha4e3RvQgj cFkk+061DOURuGz5dTnmDfpMt6NUN9uR/X7huPQ9TlOkAxYT4cR3bE8tzLqe/fbklf5t6ZocVzpe qaZENPS+DGa0QFHQqEZZHgbg8TlXFVYA7eIOdB2DmyGMoT34eRu/h3/N5Pt3TiJjk/nda5+fv73n asRT4iKV6dqj5986B562W/lMf+Qk+XfiO10o+X2thlGq/u5e5v0n95FKv05aNdC3BqpICyDpyPY5 mcYt1H5eXDb0ry3+X3lKTymnme/ur0fW2InWBoSi8JWiJUMnRQvJt/HNLrO1TgmRWz03ZvYI1cIA GpEH8cisvvLvka2luLcNqD3NtJeRSKZbdU42aswfl6JP711CL8P2qippvgS9opA1wi9/sd3i9hRM CXGeGQh/syNvhzO/Ku/Yf5f/ACz/AC5voXurW91OCKa4WzRbgwoWlZFlUIPSPUNtk8fbpkLAHOvx u4+r9lDjPDIkkR4tiOV13eSofKH5VvLNB+m77mkixTDiAA9eKjl9Wp198j/L/wDV+UmR9jclXUqI vnBQs/y5/KuS8aOLUNS9WKRIT9koXeQRp8SQFfiLLvX9oVyI7dlI0K+RbT7KmEbkCQRf1C9hZ228 /klv5kflhomjNaSWFxKi3CTG5kuCJAohUSAqsaK1SA33Zl4u1SAePeXR1suxOMjw/TEfUdz+Cw5t NuY7a6W1uF+vaJK0Wp6XOiR3MJBCk8Q0iODtTix++uZGHtOMpVIcN+d/qcbN2HOMDOEuKulUR99p XLc28ESTXNxHbxMp4PJWp67BVVnb5gGntmbm1UMfPn3OqwaTJk5DZBrrOkSSKov0jUinKWKVVP0h G/HMT+U4X9Mvs/W5h7KnXMWqXltNGzs7KUdFaGRCGjkTbdHWqtT55mYs0MguJtxMmGWM1IUl8oa3 f1otkalV7GuWHZiN9iiGv53RArqnqSoxJAoG33O3QeGApiN3W9zIlzIWkUFJS4elVG/WlOm3SmKn mFz3TyQxH1OaoGWNDU8QTU0B2AJJO2EINqLy8E5E9ARt71xUBbLMVK0IbnQbDtiypZDIzIzMQO2/ gKbYEFW9RgCOaipUjbc0B3G3bFNlmNl5/wDqmhXOlzWtrcevcJJM7Rh1ndCCsskbAI5BjWnLpQbb CmjydjXk44yIB6d3u7nq8XtDilEfmIcco9YmuKhQJSXWfMWq6zeRXF7fGV0lPpmZmkKVIPLcH4fb 8M2Ol0cMESIjnz83Udp9pHVZAQIwjHkB9570njmDusXqKAoY1I2Feo2Fd6ZlurZJ+Vt26fmN5bKA Em/ij6fss1D9PxZRqf7uXub9KP3kWE5c1M58nfmJPpenLpOoz3B0qL1GtoYFjciU1kj2l+GgmoSe orUZgans+GU8R5/Y7LSdq5MA4Y1VHfrv8eTKvMn5n29rFJF5f1HV7eWQSyWqy/VChdnjblLwHVqz M1P2ivXc5XDsuMasD5lsl25LICRz6WI+4Jnoms+dbnyjY63d3WtTCZZXae0ksDERF6zNVGJlHFY1 NCoJAanbAdNhEqof7JMdVnMbJPwEP1Jvf3/mFbiKMSeYEt/Tju3lWfTfUaEqsj8F5U/uobgp1Jbi KdavhY+6P+y/HcgZcvfP/YfjvYV5686+bdD1+OysdT1W2X0gZYdRktZZBMrMkgBtgY2TktBtXMjB p8co7iPw/a42o1OWMtjL41+hVsfPd7q1lZTajdete2d5I8zycRS3EDsTtwUUUPmq7Q04hlFD0kO6 7O1s/wAnMxP72J+9imu+ZNE0vzC91p8Vu7an9bn1IQTCQsyiOeOQBCyRh5C6AbeNBmFkhY2bOzdb OIPHuK7qYXotwt/rSXF8omPIEIRVAqbhQvTiAOmXZpGib3YYYgECtnqN/q3kWbRhYlbYMI2kp9WP FaChIYIFJr/LmGIzdkZ4yK2+Tzry1d+nqkvl+STnY3kjR25YEenOdopFDAFeRorDwPsMz8eY4iMg 6c/Mdf2Omz4BkBifh72rm4LqsZXiUPxD3ApnS3bzghRZvoFn5YHly1e7h0uW6LNNPJcajNHMVVZm ETQJGxSojpVK/EybiuY85Sva/k5mOMKFiPzT660nyQLFL2HTdMhlvb0WMc/6Wma1jLWUcglDMtXV JZeUo4j0zRDXltVHJO+Z5d3m2yxY65R/0yn+iPJUzXNrDa6LbvaFbdpjrUpjmlSQK1yjun93Isw2 G3wltqEGQnMb+r/SsfDx90f9MlGsDyro5trk6fp+ox3cqlbe11F7holSkzK6tHsHWdIwTvWNvfJj iltZHwYHghvQPxtjPmK/0u8lhm03TBpixLxlhSV5lY82IK8xyWiFV6npWtTl8YkDc2405xkdhSVx Oh9QE/C52r75IMC0DuqH9lqD5YqrXMg9NxROXMMCtCQQegp23xW27qY8PTCoGZ2NV6jptXw8MCVG 0FKv81oRhCJFk35YuF/MXy5GxAI1O3K+4MgyjUkcEvc5GlB44liGXNKc+Uh5ffXbZPMIum0r4zKt l6Zm5cTx4+r8FOQFa5GXFXpq/NI4f4rry5pz5mufy+lWd9I/Swmj5CyW6+rcPtRU9X09919WtO/H 3wA5NuLhSI4QDw8XxpOPLPkaCTy1a6zcWGqyLdrN+/tJrL0SqJN6gKF/WHwoDRl3HL2yo5/Vw2Pj beNPcOKpfCkbcfl1pCyw00rWhCkMdyZXn04yNAVSRyqB6f3UNxwpUluII61gNQe+P2/jubDpY90v sQetaR+V+i6g2n6xbeYra5j9I0STT5CWWVkuNlqoA4EIeZqeoAyUcmSQscP2tcsWOBqQl9jz6HVZ 7e95WU7QzwCvqRsVPyqMsmYZCYnemmAnAcQ2tTF9Jq9pqTOoN68FXkCqpZY3E25UD9mM/TmtyQgc ZMY0QXZYpTjkAJ2N+ShoupwKltEIFS4t2JM3UOpbkAwNd9yPkBmsnF20JjZnba/ptvo1y9lbW0t6 0LRvZkzMBFISrtGq8vTUFy3w0q2/begRJO7leIBE0N3nmhos3mey9IcY1uY5CRvxSNg7tU+CqTl+ U1A+5wR9StcaglzeTSxikckjMK9fiYkZvsWbYB0WbFRJ71IPzuFI6DYZPiubDhqKIzJaFXpGtejt VvkMKGpZVcrx249sBIUArZ7g/aJPHYccjOdC0whajLMUC0FfEZCeSmyELVJpQioxG7knDPJVMYwu 1AXAIPLY9qZWMu27Ycbdvc8VUyMWP37UwYstDdOXHZ2VJb0W0TEGrMPgHvlmXMIDzYY8JmfJOvyj S4n/ADO8tTt8RGpWxLN7SCtNjmuIlISke52UTGJEQxn9I0J5LXYbDb4u+XjVnqHHOkHQqkuqoYw0 KcHQgd+vWu5OSlqxW3NhHR7+o2FVrteCSuf7wgEjoCcuOcAAnq1DAbIHRERSyxNyicoxBUspINGF CNvEHLmpC6hdCJIliYFiKsRvQZjajPQAiXI0+CyTIKyNVVYdSAcyAbFtEhRpKo2cesQdiCD71rmr iTu7OdbBVsLuW2EkkTFZF4lWG5BB2O/vjCXpkO8InG5RPci4tNgvYfXspUiuHJL2bsI6Ed4nYhSP YmvbfrmDLHKIurH45udDLE7ciqjTPMKRtbT2ipG25luOCBR0qruQo6dRlJlEN1lT9S002CW3tZlu L+5Uxz3SV9OOM/ajjJoWLftN0psPHLMeIzkDLaI6fraMuURBrdCQqIjtv8820BwurnIydHMPVoP2 e/68EMnqTLH6bRbzIVbgwJXY08cy5ZAQaLjDGQdw19bb6uI2rzB2J8CMh4pEa6p8McV9FltXmflv gw805OS+6+yPnk83Jji5qMjVag3CilcpkW2IRF2Vf0ACFQqPiPbsa0rlmU3TXiHNH2+g6TLFbSS+ ZNPtzPKscsLx35khQvxMjf6N6RAX4qCStPfbMScyOjl48YJ5pPepFbSyRRXEd4kbFEuYRII5KftK JUikAP8AlID7Y8dRXguVIHmSwL1YCmx8PDKr33b+HbZnP5Uqyef/ACz6bfCdVtCvspnSo/XmXIVh lXJxIG8w72Ck1NcwnNapv8+uCkr/AIfRO/xBuniCP4UyfRh1Rd7NMixPG1EI7dTmRqJyHCQejj6e APED3oJiSanMVykUlzKZYzyb0wQC3QV65kDLKxvs45xCjtuoyExySx+5X7jlRNEhtA4gCsR+JPuC D9ORBpMhaItmrEQT0O2X4js0ZhuqQDS5nla+uJ4CBSEQQJNyIRqci0sPH4go77EntQ1ZJWbbscaF IYiAT/u2Zoh0Z1CN08AW7++Rjz3ZS5bIkEEVHQ5lAuEQh495yR0qTlMfqcme0F0LVkk9zX8cOM7l jlGwXzSFFBHU5Ocqa8cLKIsyrtyrRQpP8MuwmzbTmBGyrcisdfA5dmGzVjO6HeOSMqJFKFlDqGBF VboRXscxbckxKn9Y5sEp9gUB+kn+OR8SzTLwqFvpv/nHj8vfLVx5AvNZ8w2mm6hbapI4RriNZJII 4S0Tq7ybR1I5DjQ0INelMTUTPFQczTQHDfe8B/Mfy1beW/N+q6RZyrPZW85aymVg4a3mAli+MbMV RwGPiDlgNwtrIqdMYXZhXv8AqO2AMiyz8pnk/wCVmeVkLHiNUtfh7f3owSJohMQLtiOKsq8sX3l7 9DSadqMds9zcXsLKZ4eB9AD94PrylpIASB0jbv0qawOQg8Ijt3/j8buTDBjOMzMwJg/RRs8t75dT 8vNOJbLyMhXjbaYyPFJ6jLqd4SrAIUpW3rzLVpswpUGh3x3aqChfjyq1pJKlpYMYYHURRalOxaTg eEiRmEHkvHoTStOWSM5S2JRwRjuAkx1vyeykr5aZTRqf6dKRU0p+z0GAWpI7m/035QEgK+XGCdg1 9MaHiBXZV/aq34YRfegkdyXeYbzS7zWLi50uz+oWUpDRWnqNNw+EcvjYKdzvk5c+dsI8uVJbkUq0 Lfu3HcCuWwOxacg9QZF5S0jSLjTtR1e91W60y50uezNvJZQC5kjEzSVunAmt3jjilSJDIvKjSKOP JlyglyAE71Dy/wCS5PKuvXdp5ln1qTRorRNIkuLSezpJNfzJJbxmSWaLhJEXuhHQSNXkOPCZSLNr QpiFqNLbT7t57iaO8iCfU4UhWSOQkn1PVlaWNouI+zxR69Ph65lCW2ziGG+6nHpV4k0cQe35zXLW an6zb8BIhUFmk9TgkR9QUlYiM70Y8WpVGVbt8og7Fmes2P5OSGCfS7vXdOeUO9zC8FhqEQJcqFi9 O8gkjVGRv7wszKVPQ1ZxcVozcNJDovlHVde1dLGxhlmtkmCXV1GqskUfLdy3L068QSBz+Ltk80qD HBGyXoEX5E2fD05NZuopPhLx/VISeic1B+tcSysSKVp0qa1UUeKapyfBF2oXX5faLo/lJ0U3uoef H4vaaS1qTD6YYNLLD6frxXXBetJCBvVdst8WXCB/C0+DDiJ/iY7+YUvmiHQfKdnrdg9hLBaXBVZ7 X6rMxNwyUI4R8kWKOPjXfc9iMrhKiaZzjYFsKtFDS0qATsCdhv3y3FzacvJ7bb+YNB0GzFh5c88C y0+FIIhMLeOe4Sd5mivJIDPCsyQ+nWYCNgeTcQDu2UzsncORCgKBSfzR5b8uancC41TzJqN1qwm9 Caa5s/Ud4471rc83jYvJJHCpbvX7O3GmHiIFLwAm0i88eU/J1hpj32kXsgnSQxizeJ1BLXVz8PMt L8cduIe4WhrUscAJTKICW/lJ/wCTP8rf9tO2/wCTgwnkWEebEsKHYq7FXIeL16b9MA5pLgKCmICl 2FDsVdiq5H4hh4imSBpjIXSvpupXum3sd7ZSelcRcgCVV1ZXUo6OjhkdHRirowKspKsCCRkWSK1D zHrV/a/U57jhYeos/wCj7dI7a19ZI/SE31eBY4fV4fCZOPI9zgpNpej8Qw7MKZOMqYSjdLQxClex wWmt7RNuP3Y98vxcnGzc1O5YFgB265XlO7bhFBSVeTAeOQAtsJpH2l7eWN5DPaXEkFxEeUU8TFJE YdCrKQR9GXcjRcfmCRsUFMW50JJC7KD2BNaD78qkKLfA2AtVmU1U0OAGkkA82y5NDX4hXf6a4k2o FJwPOvnECi67qCjm81Fupl/eSEmSTZvtuWPJupyNBlxFDXfmTzFeWYsrzVLu5sgeQtpp5XiB234M xX9kdu2NLZTz8pP/ACZ/lb/tp2v/ACdGJ5FY83//2Q== xmp.iid:CCC3C028F913E511ABDAEE4C70269EA5 xmp.did:CCC3C028F913E511ABDAEE4C70269EA5 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:5136a755-8621-41a5-9fb1-621c37bbd7f5 xmp.did:DF18EE9E0A11E511BF41C88864D9D95C uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:DF18EE9E0A11E511BF41C88864D9D95C 2015-06-12T16:07:52+01:00 Adobe Illustrator CS6 (Windows) / saved xmp.iid:CCC3C028F913E511ABDAEE4C70269EA5 2015-06-16T08:59:15+01:00 Adobe Illustrator CS6 (Windows) / EmbedByReference C:\Users\tani1104\Documents\CMOA\198-Funzone\INFO\10411144_898660663478329_1433103301818164818_n.png EmbedByReference C:\Users\tani1104\Documents\CMOA\198-Funzone\INFO\costa parques-branco.png EmbedByReference C:\Users\tani1104\Documents\CMOA\8-Fanzone 2014\Artistas\zumba-logo-vertical21.png EmbedByReference C:\Users\tani1104\Documents\CMOA\198-Funzone\Rouxinol Faduncho\Clip_Bigode_PrimeShot_0073.jpg EmbedByReference C:\Users\tani1104\Documents\CMOA\198-Funzone\Carlão\20141031GFSCarlao001.jpg EmbedByReference C:\Users\tani1104\Documents\CMOA\198-Funzone\PZ.jpg EmbedByReference C:\Users\tani1104\Documents\CMOA\Logo-FB-Site.png Print Adobe PDF library 10.01 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$DV""""\O؈2I戊[꟧hXuo",ȝ>B"-F3?J",H9:}j",hODEz*",О\GDEi6'rgFxzADEiLJ{e1_",wzvf1bosbvNzx'ToO^9DYM8AZ",I=""̎N\}Z"c}K^ uԈ%{;?S$}ֈ)wa舧l}5DS6_>DS }G(Hz uȈ2}um֊v8/:zQv4I:AA]4""X|+r\-d3}Cpk'F 'pд[RE$=M ,|Oi{OK{{$DX<8'""đx=Ȉd׀:r"->Wa(҈WӷQi^?wy"Wk? 8""Ði=hɝ 舴^8x̟)']xZLJ=OwDE@9~DZt~DZdwq:ٜI<}޴DZlKړ^$A@;{{{i.~DX#d>nKOD[f>)_Ñ#Ј$DN\J"(DEPH:V=QL@׿73{?2gÏwӵBxû֜kÏaQLs鹝>J,I}"QI4ٯgFvgZ\wqD::9(֟-8:ӿЋ!VQisSs}?*)Āi!iSwN_1<H@<֝%9:wj)w9; {hE3d<ՄaI֊VwUj:>ԊQ!O?Bo~ܰiQ]=zgb}3 5k(Ƿ:}c>zW}W^>(d-~gh٧JS˳"PS%ۯݢԣ%>nztrwTNꊾ7h~Ȩj@>=xqTfxFgיš;Ω}'lgH H]#`iJƎkMηϯ DV xvhWRH?*-l{UT{Wj+ 's!J4ϭEEN_d~jQZ\Ԯ}vDVh>DT^h>DVqԏgu_%GM:/hc"""_r"(ˉw}9"eDQQP~DQȈDDDEaxd̢""""""+KȈG{+}'.?_Q=?>{t 5={CwZ|ΟW%57=.-S*73{?2倍x}G.^;ܬʊ+,}7 nvH86&:!iEN]B9ĮyJ/Qu#}v~O@_hE ^=B"~?Dv8}gZH]h]pU}8(w[ۨ >p׈}f;:j;Ǵ,wEIUP:v8h ?kDcǏ'4x{:(;ƿ?W"Iqt~i$YozC=h#Z2*'p< w'rn$)0z:-<'MG8&nG]GO 4 tih)"?4wSp?2(;>*?=?1W?wV;SG8}>p?@P:==:v5RA?'QrK;~*fҍy{u"]~U9W-~yLp4ڊ?NZiG~§lQbĻ*zGY q4(.9zgbsu?re/i~'"|s}oӳ?Ze0zy܂eGs(]'wIWeop{{BOwӒ4_z͎YĒv@YrΊS>Zl.-ysQjqSwM9{A 7-FO+n>pi>޵zc>NjPӓĔX2rh)h4=ewZpt*,9 tvP +68'Bω9-ZC@#.'*%^+M}y6‡i]"P9DQˀQXxd ̃{xDZ/$:"-vܻ~""8xiĞ8jyt;DZgjZ"-jP9!""֡PӴTDZ3WQڈ\~Nc""b{篰"i's\~~Q܈\A}k44ӗ?""֢P8$C"֠B4:Or"-f u""=ꈋW^g1""֠QNDZrMQvc**L0ck uwY%=B=ꁯI 䈻OO$554QOOm!EL dqƀրȈ{ϵ'DDDU/Qu}2!%`Or _VLp5^xoapS'4vQL*DEÇODECTOi2"(0ՠ""{?3껏>J", js>ǘDE):ӿ"-6Yx"-*i˻~z"-2i@DEO?0=D@F}5ݯ:xY>pDEM4戋D~ߵ{=G^߿?QgxTDYxX\rz5zuDEwk=( }J",{x҈>7rhDEǰDY^^dO9",^}Z"d^>:DY^WDE4~=(7z;d2NIh(/>DYMN=lz;B")/qlpN~~(GDWr ͧ2̈6٩>Ј.DE=\)DE|>.x RӰO$э.=ntDDDDDDDDDDD\}`tyU9P5] 252u:=@ G٨""uΊW=ƞJJgt Z9V:""Ѥq#gr"-:Y5SDX2;~OM;t҈ON'"ǼDXr <W;Q`yDEL5o҈ @DEj"- IT0k5_i:A""%r""yDTDEB@QF^O.DEg.!hpfIXkp+j}uݯQrVu\%.n_–#-.jn#T-iRӑO^֢߫-#;}͐_hQziw}=ECe_Q"eCd5CQiGRb,Ӹr=6WӽXX;8}7r*+OG!W?oQ^{Fbc: gܩz}uEQ>FSOޕQÇ_ɪ*? a?ju'}qEpyMnN#D@y5*gaQ@dV5~i5u>G"u7{Bj}?oxȷ |{]U85_Jb4:uxkٮr5:tN_Cӯjϛ+G^[%b7jin^>twNt%>ҞE#c$n/hpȍx4Nj}jށ}JQGQD=:/A~QO2l-ƾTV~u3cR=?NoMtJdܚOfk(p*Ae9zN.o_wS66e7<5(.~d.GY {QaWSRRTʊZ$VI 1v8c# kֻ^ђc/vqwDW }DuT1.xt Ȃ /?3^ȫ-3xRjmuW;q!i- rh4tj 2Qx&@PoUXs? FefSe41F.3$6=T.48[)ڞ'fMQdP@5q9kIE0j~EG`{ZO>YSuw+\}N'ҥ-V8@}_EipDQDEnDEwI(t:HE"+QWByA(DDDDDE;L<+}hi^{%z4DEr"+QX_.?wDE$DEDDT$h/'"r~DQO4DTDD$h/DEb"""+K""WwӚ"+QF_DE>% DEq>܈DDDVˉFI<"*""լ2ov6獎?S\"}=$he>DV""""\O؈2I戊=GDQ{"sDDDEki?gDEN;GD}zΈ-}P~DQȈDDDEa~ߥdfx-˞4@tӇrꈋj4DQˀQX9q?b"('"*"" sDEwOj"+Z\EdDTDDDDDEB@QF^O.DEb"""*x?OaEk8׀3^#XSSxT\2CwY,NgN,)`8Ȏ?Q(zᥤZc xfi#b`sY$4P\Z $jI=䣶n544sGOIIGK ̊ zx#/{CZ֒N)mMnk\.9Sx}k٤TQH5ꦶB ?AYn27LzњyOέ,izf!DWu~pBקߪ+z`+} z>TWxuʞfʷohA~?(Vٯ ^OhDtO:?"xqD]CURL~Lw^ކc4kGz}nL||YM<8'G_Qw>:a$31z{)'":vOη./\|V9S?nEAH5=\ru~~GG`wGE{}$&` ;#Q>;uU~}QIb{OU?M'HS6irFoH*OhL~PSWM9,;J,WUTywCN̢/Wwbe8k9E =W}}.8<哧׷A>U6'Q(ƞo zu-F*^\4,gJO/>P (t0E:>C֤ ӟNWӚ,)9 US_GZlI}Hhij;~}>X/~I-ASZ,W=Ui<gCNI޾#O5/.jqv"sz)hwEm,=r v0=!"ڈ2I戈E"+:;jлӗDEˠqoO!:jyr4{kp?zuHkpGO1GѢ"-f_ODESPYN\kt?Nǧ܈ZM =]&PG/Ť }DEC&}ktQkϡWmx~ѯjM}GD]_/24"Qf*s%k;z:g f?gD]4 h@L׽H汌kh.sOց('dY-\ulש1i8Dxsh<}ATZ=Z},iOr5F_;iC 4ˎȈJ Oj"-yt׉'?Q.`F7S}Q1:=ZH*y%<uОQm""ەo<׷;$ˀ"j8`cڈj]fp:D[jM\{ñU'=~_Z"-S0mʙ $˰i܈o?/o $ I>ϵ۫}KODE_dzWֈmJәhTӳ=b"""""" sDEy<}般DDDEax2I戊HX_DE"""+K""WwӚ"+QF_DE>% DEq>DDDVˉFI<"*"" s(/'/QDI<Q "+ DDDEipDQDEj"""""*4DQp"zOr"(Ȉ}=$he>DV""""\O؈2I戊HD^O""r""yDTDEB@QF^O.DEb"""+KDQ؈DQ{QF=}NH.'܈DDDQ{QXI<Q "(DV""""\~DQO4DTDEB@戊2ypj"+Z\""~DTDE[-+ mPi:K+bDk؈uOD0`a٤69r q'ֈgKM#਎H&9"F=s""C_NDYl9ӷNDYy:}ڈ>'rQ=yCPn, idCQ8 G5^&k_;DEvKf[萓 DD t y pp\㦈cwGވ9}wDYywo}5戋27r= ",;#5Qj4527M3@G79Ć"-OTæ7!=|G"V:H% KZO$ktdZTDZs%ׇ!{e=x舳c~̈1vwq"d?XȈg ",K{Y\5#$kf#'0Q(VQҴ&^ckGFuGx'N"--}DS {x}h}Ȉ"+ľW@7QkJ$kitDQӯDEJT-sᑵ:L` 5ٮTD[aH#BATD\p녪G{P uƧ=E('".pQM/u~{ GxDEsd=ѡi""f9(-fB\ h-3ҼVH7=Ml>Kuš54;ABE39vjO^ĔDZ|R~DXR}(%x"Q[.ye2|ux4j܈T/LY4y1dD\]E$ST'950ui2S;> Mu㧳^DE#GވOkg:h8k{ioDS>Z\rE(pWz++AE%/>~HlwW$X2ROI>QaN9OJ'o/UXρݠ;wWO'Ci`,g8߻Q];AV.r}]ǫTp?ܡu3̊1>0V9~>TzǫF`ſw⊾/O4!v8*h;+~wa2Mpq}ܸ]QqYvR fL z$}kUyOq6EcwcS!R1kdsCZt:hў2lz?QXfwaӠ=pEo}oEQOˋޯTWaUqzx}HvÐ-Qw}4~mQX^{i=Jq{{N?uq,=E[lRL- GTJ\صkxH;ۢ1@=q_WТפlz_ Bٯ`:Ud62{4i-]IUA31E$VoӒΎ \gXX1,m7PT|EZ5$k Ԭ抨uhɇ=?' ]O"O/JDۼԖ,ڟRa`Ӕ5ꊗN\9hC1"Fp-,sIkЇ44\8x8_M({&8xc)"tR0 Q,'O3 RũM5E $Jj,`h}FR)j 8Y2xsoGZ+bh;8DE@DEpkGg"!p9DI<Q9" >DV{~"?O DDU@""\O؈2I戊=GzI舋mTF\9 vH!DE.{D\O?b"*""""ڈ4DDDT.Er"+QX_.?wDE$DEDDT$h/'"r~DQO4DTDD$h/DEb"""+K""̈DDDQ{QKI/WK6xU0Ii+]DD]DDDDDDDD^h;"*tq#(%∊>}"C}#DEi ^"+Ԉ>foYW7VE 5Oq 3Q5Ht=$kjMk"-mgT6*ipgE'9,mTOces} tDE興HF^O.DEb"""+j⥥JdP ]$! cƂ^8DE̶V@ɮJKS:8]p GY54 ~^ob"- '\ P%ChH8< ".+$hs8DQ;:":"߫Nz"+|7p'@4D\ÎGxQOafLoskcl p< xhDE=pRd bH}̇VkO 9DZDT.Er"+QX_.?wDEVyߢ.Ptr/t3>VeM7Glk"#QC 1EAXZ;a8(v \7A[qHݎ#\Uy T0P!p/B{xl?2H=hG)}`IM{;>b)['_AX;8AhE zGښƣc?WE(~\jtDr؊#wwzH@fPQ[㣥.ڎ}GF68,wSW#OOZXG.#ӏaGz؊&]Ux~DVOEoz{?2*uH;Au?z(M3~?&15]"ҽwˮ4r* ;~V0y}ߗ.bs?cjM\Q8GINEwc}Ir^|> ?A]u8HuqדơOPk ԯ:(c&{|8>X7AsMk?>.~j7;IB@TW87>=Rgp{?*((?~u^z(=~vt >3i;ӳ,WI>Wv{xAe&P;}d6zoϧ3uoxyX'.E/ӟԓ"ώO̢|9"ΎOCpRwlp]&49R%EM}_oE$v{;jPr}MQ`R~8 Ћu{u1ph wp=Jw|4iTZt8wZ;z(^-k)ue#5x(vs4z$DEDDT$h/" HI1{CZ5=#@"M_L*ٌ] =}.od:5DEOM4UC-=L/1x"{Z=Qjj{B"-nP4 ڍM7.=ݼ(dQO>kÇ iLJ;t:"֠P>:"-bG=cA/sZւ9:45RtәDE-7Z&>| 3P[k<$ k@鎭5݈ _wDYFDE""""""""./,cVI]%%=%|vLGZ9sDE!RG~Nz"":?^_gj")O`qDEw9_J"+MY<2"+ I4~}DpjJkDXRNxDZD<Yh$ΈAMz}?NtDE+'$Z=Tuq\}ߨ4q?]u|GW?OѧD_ne"""'.%eDQ""" pODEH*Y0dA \t: ЈX.v)cLa7HfӯޡpDDZ1 sDEwh.䈊2}]ȈDEcvEVjNㅂJz(uI=-N"]g;03O4Q:lfYıǨ8馺O4DTDEB@戊2}7,p%ϑhD]Yi( .kCCQR~p6zILZey='M8:""'DEoXDEjf,u4NLrChկu{Qi;ɳ--OM-K(nRK9(r5k=sNpծp fڈgЈXUgZDE;pDE$J",Jj$af81&EZ%ĉGGHn]pZ5g"q:Or",ioӸ""^~b29*g!$G cG(hQE0x,W#_G.DW=O""}Z {L)xG5%㸃D\s>DX2N]4 ""v}$M. i~NHSEO ,Ȣ\$pcrC#-L5 5a]@$DFDE7j :5>9:{aӁGG4#"-iq戋MQ7ZUE ~ eŦy894"燵cÚ渵p--sIiЇ4:DEb"! sDEwh.܈ηwEEYCgW>"h ;^W0AvAFYZ|~XTT2GW%c75k:9Pyu `25\V6B98E k5'OHk->Z^|5ȊrEIKAvw+ý>~i`>WX#O}ȯxݿZO,G=tȫt<TP:QQFi"!Q4أ0;S1?Topk:qh>TةugO'C{.V6\Iwj[UHD孩hfs\ؙ/~ u-Xbh8Lj8ն3kH}q$WN3|zI8^\pW@ۥ,i-w͠N7F:ZϫqkkH-wAЂ"U?b|6?Q^SOm{Rت YU^Low!'IǟԪ;u*V4>[zJHR}P_WE(@=$")k)ldcuӏ0*u8Yͧט}5A tO|8`c99$$U:^{~Od~G)ΨGA0 ~Cާ;H9kWphOiY ]4o"I/pM{P98,B{ע((OVK`:Ԣs ScӳA9a&sM--׉nl).cȮ-މZHh[Eh:GyӸ}~Zcal]\Ӗ`4,_px!e>1iHzZg܋䋘6:{TRR)eoT31Yb=:'QJֆC@44 @-p>Ԕ )2+<- wtZ ) xhs]D؈"}9'"""-fCmx&5ӺŮ01ڸi%ԫ)1 GA#",B=}NH.'܈DDDDDDDDDZd_ImW P! 9Zi$90 t䈋ku}YjMG[CQ%=E<Xݦc!9iDDDVˉFI<Q "(v*dlљ:yqQCFJ")/;?W7}EHت%HitsF\:HH.{D\O?b"*""""ڈ4DDDRSKK 556()4 28`.{Oj_#DZ+-kI3! 1csZөa!ô""ۨ/ӗ"y""*4DQˀQQtk=pc\9J"-tۼlb`ML&.ZV 'CDE $hAkx~@9"y舣:v =ثrK-4ORuK&<1i-Fq$""d{)C%]JzAzxl]\zIsڈn5Y&U8T7UR\ 7{u=.iБ$EQAD3{8wjv3dx5^QU_PAl.oQ(>.|99`tuqxqGѰEoE4LGO){`[3zk$ qZ[2XA=}_TDQB"*t05QwKMbd2C,}Ơp v? vy"J>߭3/N4!52G u,dqFc"668cZck4hDT/"믘5trq:1OQZ\eZ~msL׋ۺRx [-T宭 CckĭI4c#U+x1qlh2f2JE9_3ib^#(mݞbSjqHK4W{{Y_4B\\{`|f^AeygWIrȲ[][ KUW!yd1OIN#&i0h h 7WthRI<tI*}̶i4=EmG%&):A,$iapӲS d(HB-#_ C3нZc^ǴZAUC;#{'b(ħgv{~O_?j)'_A慀=_c: yڊf8kAs@'AUr?xP١hE~(o hhǐO|z~ұN8O>ͨUDt>DU]=NMJ&GX(M{}\>ZrIh'#䍣N-oQouo?J玣-5-s#K^ik8*>w; s{~ScEN}g.y2֪pMQjސf^  ;VFj۪[gmʫDҼדb1wK<:?`q׎[g@#3ŞWG nIp.鮅U^)ݧ`O܋JQ桯ST覌:ᮎiALtOx]7i}fҍW]}g"z)E^^}\PMAחnYKQĒAǥ}*:^OEHE^ҋZq[^m*7UY`݌>3nZ vykLec1W>yc4"ӐDE:k=dDZ3~DZ4ӸJ"-rGӁ"{"Fa ]$x𣢉Χ<SW+:DIԈ3#>D\e}-S|Y`}YUO; iih∋MѧzB"-b I!O.w}4#ԈY^{k5_ DE.}ߙ?""|_nr i@ZGnӊJ[KOOMQ#ר#PuDE,msxjvl뎦ߌ4xr*OK]#DE`NDRDE{F{QMˈDEY}>D@>DWDE|m|Awjuj>f.Ei#yYƺ1>t9P׷9DE֖T;^=}GDDYv{DD)j"!WQD9~Ӣ"(8O_TDWSvQ%Lצ8X\ hN""u_ZY4 Gs FIDEKS؈I};`KP8׿"&S;?0DE?2Oz"-*y>~ڈG]5$;"-)ϖfAO3qDI$qѱ縓jODQ^+cnmG_+_e XHpuD\5}h:C5Q9:yQhi˳DZ~ߪ{~xQmڹNSϳQmߩ>QhUrC"-S7wn{>DZv8Xߒz#c|*be@M1HN|}B"- >DZj"+ $heD\no֪v[$>{l4&b'G.x#DdAg.uk륾ceCCe@">9=psIi\""̈/"}[zME}ҶEeBy45'J"/O0]>OkoOtPrZdm k&c ў)noq"=Uc, cYVZk}4fJEDS$^ ZzK5"/>X_.?wDE$DEDDT$h/'"yndv L=sS]k 4Q5\.50kZ:'0^8Ew_9|ث-+]4կKWSpSSgJ*+FHD]/""y""*4DQoӒ"+k8?yʯv ~kڽe5$ :I%YȠ\kZ5%Kp S"jeduM?H:`H HZb2h\΢"$DDDQ{QGωDDDDDDDElDV""""IDE[$NX |vBo i >Iֈ(k_9hDMBzAR"(DDDDDDDEF܂dv@~..xthOj'"*""21@o@j@l\#2K}z̈.'k>fF{;k$29 !gs[su|}#"2{:zQvC/DE0x:zڝuDE܌7˹f?>;~XHR",HO=z""cDE;DY̗Nx{bkht,u%3GaanDZ~DY-'{QqfY6t#E8vkn&?=Qf1ϻ""lpR>DEuxsK$N?_DEx܀٨?nwO.unQJ=%t_x64Ra zDEaۧ(R=TDW?=-}h0koV^J4$T xt٧"nZ_D[c*&=8qØ:"" $TD]ȻSеڍN:5O:7xQoBu"",]:=DE2cB"-kF[kw2z#!TuڊYH=t ""s]{\m&SVӡ#]|*$dG4ĈG",9ϳ_~R\¥UӖޮ^+N?3ztDEؙ^戋4Oʫe#U:8)>V""IO؈Op䈋Wk"" DEq>܈X,bv?,CslVSDV""""Db b+`#p<xn-0J{>2vpV+oo֋6F F|C](9:<{RtzEomM/vhC,b+tQBS!QZgqB(M'v~!pCCx?OB+H8p~fӸ?>2| K`$sYS}Dբ*6A4 AQH$9tF4P:5UƮ/k5qxt_"+cy&CC[UFd,tey!/1<\YNNZ\{7]f<3]TZG#g[.A=?"z~Pv>x`hQoW{pEB?2ޯUwC_OFuRO95źtf֮ߝ^">E_]>pr V~ҋ^}Ԏu>߄ѮVO&?@KgSl.Q%Wh \OCck{5={[ﶪ=!5%};pf:9$٠{ ɧ[oVc;ɥTоX媲ݠ& ZmktFtq$m{&6}9wt',ȹ5dzO_TD[7pQLGOBփΫlqDź""Ka\}؈I""""""".؝G--inp:DB0{pЍ4ջR/qۨ v+qKaJ"*ӧڈCGy>_Z"+9q(/"MHfK~.+ϭnPy5'tQޔD]V6vS(٩,Pet@w=of\eZsDE$DEDD]=$Zk|ž#袒UGti!/>r"-O5M &+*gw;S#çD]XDDDEaxȈ$heD\SCD%H\$cMⱿ.HDE ,D*k-1x ft#]uef=:v"p܈"yQeDQ"""޻sQAMcܝi[tKcD@cYZΧS""NG5>?zcZ4KCM#$GQ \HDE"""""! sDE٫ k@ZC);DZ@?Oz~̈Q}aVD65C=(6\O]wv6,^ZKH}FE.p:"($hE".のǬ.i ַEٚ 8tDEDEj".;9?Y7S8k|1" s(s>8"rvvd -.kNaW8ws~r:"*h0uh^ε:qvZ".{QF=}NH.'܈:{h#m7H4:! =""B5:Ԉw[{u:x(K8~Nȭ͇R>-%k N<e>DV""""?#mq GsI<QB;ˌlMnO<59DEB9;QD\O""uhcZ7Oˍ /L6#'St=MQԲIQQmL5 vB39hypX:IMw H I<'^tm".Z)ㆲDxAcc̳i[\+j:uCT;!}̐-v9xoSUlOF|/;KLIwSia=$ E,?Q *),sE;nTB3zx6M ױXAЎ]]/EO6"s42eS:14 AxSR5{⡮,W/bt~E'*=#B5Ӓ)xi~v?Bh :+z?*7"}`sbs%NSFiǤN{I[i#B%w<¯URyfFu2XItC~4t"'L=E =>/#>}QGz;va(%+`Wwբ~`RJ5wsYiTW苌7L9մxibX~ξ]賢z7j#k)ctm~!I:z4DEȈ/"&H#|Ek54)}P{):}tnTDZdcX!h1y~-`^J"/) @4~|kIvrDESɨ~"")MONj"-fhӳfwXe$O3iomw@xgLkuDE4DEhg>s^<K+A0Qy 8pk4?OHDE6h}ߴ~DDZ~DZ@҈ZqOvF;l{}ASt]*cdy @kZ\!D^۶AtGfQ%>KGch4k N5BhKȋ.妡iuisӧ؈L#܈f?NDYLvy"+h#DEz"+KDV""׭C$=퍱3CC#kOƵhQyuҪuOR$|T4gH4ӡDE-v;!?Z")pDRODE_ PՃt~mF~"z="}n{S4GGXKXI:d@= f"sjL1~Se#tÑDErT}aDDX2w?2"-.ZN]ܑiq"-2Zux=Hu{~ ׸r∋tM$9u!s䧫@X`k{[QrUŇ\T &:&:Tڨ-x6IKi mkKkYch$}` `hð""52H^}Ȉw""}=$hmF itfjA28DapY#Iկi( 殪>豔&#QMZxZug`j-sSw(/""y""*4D\3`:[}dT 5/`iv"/XQcM %TqS%[fFNA@zx\""~DTDDDEwh&%tnӺJa1 p""pc Ih@xv},[ZBcӴIBGiDE"N\~҈2I戊HF^O.DE?'س5:bFKGqI#YKF7@"vmڬWBgh!,7*WōH|> "/ $hE".yU6'zd)\!'eu*i#Wj9eQi1>QS]%IFtxFӆ$DEDDT$h/'"'53u1k #kTDEgЈ}]ȈDDDEwk/Lql>+c@D[y~F\ODEj"""(Ģ"""mWY {?:6h:ekOáB".hqվO<F8dt: ".:2_(h#-H%|*h-aVB΢@:)\8vs/ӗ"-!I(y^ sdpd8Z""؝DYpi˿P$HNpDYqDEz8WhDEtдZGgh:vg~C8{~.&2:uO#1"lw#DE{mVLRHꞡlhRQu$.|sy..ËDE{G?OQgDO;f6@8sאQN ;h6aW-̷*[Oiu@9h5戋|6]yq#z(A1qkOk_]SXg^68荠kۢ"*2A∊vODYl}ֈ)iJ",;8X∋bf7+Keq<Cǀ'ӯn }GDE!isk@..$HĔD\]z{߱`AsI/HDDZXDR_H?anu "*ޓ:Gh_:)AR2Vḓ4}z""_v~Z"*x""㜢ښRKGNuD[Ez}"=n ,;8wMQ$k󥦐"DEDUn=Qõrvx~DZ A D""", FN_x"ӑZiDE6̚ShSAK _M uk !wvϊWbͶ@IìRֆz3KȆI'w~? DE&|2G3$R2XpW{up8x`=8q=:iSx"sڈs*j` 5JsM9>m:CR"_o>^B"->GC'DZtyZ A܈O㷷iϨ{F8:7湤8=ZGnn~JQO ,yH@KS4#y,Hy:8Oz"-2Ws"w3DXN:DEi sDEwOj"+9J");i5Q %m],s⦩nt4rg<{@H@8Z".Y|H9{Is=I:DQ;E>]cNڊ>FX{8){G?oԊC4]1?Z)C=?NX<ӟ܊gqtXϥ#p(7Wky})ׇSÇh/4VJӝO1Wx*x~=Z9~uN2?nEGA*t;V8oxa~uO7a~tQo+pk0٦e[%E1L`@ɺCmE1eJw\,ځQ,mM ~׸'N 㚝Q; :i[}׸qς9ݫLc(ups: 1GܩȖ3d -\̕{BEi=SQ==ZO. ( Mrw[<*cJ#Ӹzji: >Aǀ GEiy+~}CI~@xdw&}gԵN2:k8ӧSbZp(MU3㑠da:zz퇧NZΧ}9_mL-E(`0 .';SMy"ᇷދ վՎ'J`&J^`JbLю'ZՖgd:A9ɒc܏{_/_2#h7Q^ ʮ3TYKNlt.KZ{xe9mhq]ګpCV#2shy馫{/]mqV˭Ԥk N@8w/:;%O j YW<`xI${ӃAqp sDEy<{>DT>ֈpZL;mڪs9b q:Oh)di$i,ҽK,sG#KI:2@戊"}י'DUhz",Zڻ|j*)KK O!a 8rDE|{tTM#" $uDE興.QD\O?gb"*""rQF_DE}=ME$OMSHgG,nlvMA]W[YpUu5RlZߧ.{v_wӒ"(ˉw""戊2I戊75qcC44 Ut7ܮUBWVTU($8 DZj"""+ DE$DEDDT$h/ח""[7(˭ejviIxz{٢"-r~DQO28t.3h~Nya_G""ܤ̢"\>DYmKuKD:AdHG\SFD\R|2* 7Cu7?G{gDfcIC:q".o5֢qsLtF a1T5űx\IJ"-4؈CG0=eð^]-J"'C{vh{<~Vl1î] M~D940"}]Ȉn7 KU MƾfSRB駕Z#ݣZѫy-\sM mCnИika $s D[x٧DEk_:]܈4戊j4ԄD]L SSL*sYjB=9ǃGs ""(e8X${ltI##{1ROtrxjgۨ"{ |Aŧ1DEǾDEB;Gdj8Y{舭wDEʛK_J!ޙ485dOq!qx4"S)jdhy1cspDE舺Y-I'lV '}|)iK =DEbj"(Z\eom?s2e@Q5ϤKoo;wLoSPEWGW'HADZAd"7\ޖE;d#s\)h`xMzj*XCulqFi$EӲrDEb"""+K""WwӚ"+Qz;C)(*fKjY&;8qx`.c@iaqrwQn5l lQtQpJguS#II#I&_ cuh".""p.'v{.,S 1V)#fCt)4p {Kj&14׻M_̕]tFư&éO##.:`pXj]G]Q[:Ξoj(:Ξoj(ҫ}OH =*_mmEU5$Xd{ZH5W~`O$>i|JI,%$ĹqN^O<'=i7)[LHOB(Lޟ`4S>FOx{;d2}R3/HK:7N:O3>Y>"’BS_N}I?g[J,ebe]SnzY X:$88pi=Ւw;MyvCV_[GT+o:KYߨ2u,CeHcZ ^>+6:`;>pmxzlMo򢈀|QJ"=!n$r;QDI<QkyR"-鶻Ac3yQJimON/s䥪 )9t62(aok=t? AGKYMYuE HNv"UpȮ Q5U%UKg\ݎ&jz!1v""$he==+ުy(M’q=/fL#NqB"/TqL՘ب/y-%l@>ZUMiz\;FHuG C~R".&ލ¤q*|U 7{}<4,|'jc"LZqOhk 8dDZi'"`Qkrxm#rh){y%O K=I^C"9E om!go"]j UV+kpo{-.ǂg*:<>mĻM[D]bh8~US:QkT<:"-byWwzjՠ:"-b&w[lRUxܤ覣hZ-MD-0],9ѫKKj~ knQ1ia[Rדݖ:@ֆEvYtޠtrDE8..:թ8s戋,8HC50k2RoCPI9kďs\ޛ\-DEQG:Iy/s\.s2u(mW ")Hէ} "+)ݚiQ>(z"DEcӢ",wUkQw QBa37uG,r9{:\=UʢGOSQ=LӪj_,NAH<|tjATDXT뮮0iϧ`=}h٪uDE>,kj"-&Z PH! :DXW+uyatMTQ3{pȈD-9ODZD '?)DETQ.WnOh5m*ڣ+·DZD5kZHmW[EOzڙi 4AM$-t""U}CDETI:'""*e^A˻"-Q)q:ORBN]ȈoIy$5h%Enyc'WfUE8|ĸ\'D[2zʹJq|O6589".""""\O؈2I戊HF_.DEڍ%&hכyV[]N뭺)B*概y1,oy-an OG`ǰkU˵4 fuJ裒'7SOKC{HEzOr"(DEDDDDQ{QF2sWRuVi)n>)s^á "-ϕv{Se95EK' zQ7Ikgxgq {48FR"؈HX_DE""",:e]5‚z:)⩤STB$SC,d>9#xu7v/9!Jښu%Ʈ9*T7p~ """"ڈ2I戈E".ZKUQ_ 2jZQ#2C5UY-WU@\Cdtf qw.QDI<Q "(}DDDEaxd "(z{QX=}Ȉ.'""eDQQP~DQȈDDDEaxdP9"\>DV""""IDE$DEDDB@戊2j"(Z\eZeDV""""IDE--]]$쨣v~HyK]xD[l%# yi㗈NJ"-I$ĒI$$$̒?C'Ԉ%s>dNׇڈ-HDE{G""-JUCj*_M0 \A,088DE#ܻ[ޟPD[bpT|E¦J@!68NFn^DH=O>}R",Hup=?S?b",;xQe(;"iA+╎HXAiB8zQoz|6gX$K3Eiۅ518Xp4FvSj",VK"dDY^Q"lzGo"dv}]&}K%- AC0Gxv"T}*F {r}.$" [+Y h i㯿#$}:zDE(;:O>m{Gw/"+ĀQ }=(fDEg2oDEd:L9hьi s\:@DU.u)^A"ۦA۩"5z"-G>}ݘ] l2Ϧ.誈k-3߭{"9h"7ױc{CADEoXOȈy"ӫ#mgQvN_J"+K2"((뭮|ZPVD LsHC+9".n\*Wb@zd;`׃%G/NQp{T:|=L.=V=jE$f3p{ώ94ӎl@t(ELGG=/{N$N﯐ן;=h~s'@;J"-2Gs'W"ӥ?O", ""wz`~"/DE( 'GwQX^O.DEb"""-J*c.(òFh=舶$DEDDDDDDT$h/'Z9qFI<"*"Ew[5M5t ~DToڬ,>ՈQݧEx_O+ =>o-yrEpxFG6N/OoWӽ.#8zA"q箝Q:@EpGE ?~+}PC~VfG܊#I?2*x}gQ][('ȭ3{<Sq2(NDA~̊ߧ։[sU8'[Nt?i#ByB㋌G4kQ+k.|'{inna_9k]< `FaG_fpP=#?"+zOJ?JR}N?wܞ*I`(sdzbts:qR f}cT=f{O!'SG!^"#t=oWIH_=>B,}ki |Riˮ7G; K3}4N;Z乵FHHeo 5=}m!HzO?C9~EDRz_4g8h0|UȠ$gWO ~Qˇ\{x"zQ]`DV~upa>_EB9F^OԭѯEM-}7 z,%nVkUCVĈpp,:Sד=|4>=_{f1LϸsMGmKQ(uVC,J/w6#hEkZ]EwhOaDEpa:}o=""s[qpDE$DEDDB@戊_ӂ"+z Q];I{QC{5=H.';"+Q>DVu$YDE3!WWW5)^E"+QX^.?r"('DEDDT$ee>DV""""IDEq<ˉDEwh.䈊2}]ȈDDDEwZ\eZ{8`VEC"""*ڈ"}/""yDTDEB@QF^O.z")i*hj!!GE,oX$t䈋70J={5tSgiEYGD[/$/Ci] ;DQ;M:-Đ@{ 8""DF@!hC9{0iծG&Z2ӶIh.cCcO4b4i uQhe9D[bx*Z{--RbSHOMVؘHў'C@$?Eg9ŒjYfa9 pDEÄ̢""*22ypXb;aL4{dkGt9F\ɩ\Iwڝ4"-u \i_KO- p!W\#hpFyjjwYG4<%B$J"(QP9"\ڈDDDVˉVyZyxH^Ƿ"-UfԮW2XeW93}fv8s.AU"8Uih={,>VsQZZٯ*G%BExq(}}֋a5Pj$^tDѯvzwآt,=}ȷf״};Pvj=G_RM>N9(r?OWO@{Bup G>N 3>4wڝ<=JkQP1?gV|+=NCA{Dz[VwTO1O•oXO?"/-wnܼN3>Z~vr\loMvikWGymxxf-?_GiկV]qɨӼPY˰;Bz>w"~'dQ:ndYHNկ}OqOW؊q]8wi7?:)[HuEi}}ȥm''IxtY MGg3QNߵӗ~߭;]Gr8"gE\;0U@=*f >ht=VK)yj;I4u×WسLfϷ_b,W?SU;BZG-#"IDEq<'Cm܎ui,:%c9p"*؈"}/ӗ"y""*4D[ϲxZ!1ixmEhfP@x D\/ŚA.1E++)maNWH_] Equf^knW uMSU'[tc ""ƃC-;wIvDZ2i%xk""4ok0K__ڈZOo(>SJ(^h 8̦ ЀˑDEs:Ǽ"֩N<"֠h?_q""aӀj;QjM__ӸD\wSCan556h1oFPSu\6G1"/wa1=ErzcY=;cH)_):^y>"=]ȈB"+ q_c4:ꈊ@OݞDW""""""#ÍesAY[ c$8m3]QuIvtDSAP>")߬"j&xx"- yyx"Ъ]O"uVw""SkQ&h52jH*x:s3۪HwiDEe$NdDZ-C;8}}DXDE"+QX^.?r"('"*"" s(/'"zOr"(DEDDN\J"(DDDEip$DQDEj"""+ {DI<P9"\ڈDDDVˉFI<Q "(DDDDDDDEaxȈ$eP9DQˇވDDDV($hDQ"""+K"_rtxz>k:? 'Ox?5=ݿgEoY?:.'V"""""""ڈ4DDDT.""@DEj"""+ ($he>DV""""\O؈2I戊E==DDDEip܈22"+QF_DE"""*؈"}5^H/h}z"{x}34}?6:ih5ϧGOx=H5y=>' Z8q"O Z܉"wU^߷T?gEw~Q:aE@?O }^'izE>v?>:]}(i}ȨAuEB@戊2ypj"*5LX^.?r"('"*""7Y!G܈%oDEz>Qf@;uӈDEדHdoDEGtӟӸ"ΎQ=(^:Gox{ ")~dDYl"dQds>=tr[&ox&qȈ*9/zQeQSv""l~DY ^|~DE4ӎ4DY ""lyϩl] ")QtDR6_OڈA z?DWxv~tDUyӻ@]~DU#QS~p7@DEDdݩt}\".mU^[-E @J{"n#"""4' "+"Wr"+QXt奔Nh/'e%–z*h+(t5412h'G,R1p!Bf'잻G>h|6{ԻW>k{9dK".=O];y"" }(voDE#ԓdzi`J˳܈Oړ7ԈWhi"-:Gkÿe?`vDZty\}( ';Ho(/" h3":%xdii׍{X!IGwG"9"ڈ4DDDVDEq>DV"""ڈI戊\ۡQZXrEiLJgӷNTA&o}=:wR=TR } ~eo~ju'^̈gAU}N?4VxTЎ`OiQT8vȨ18ipD2H>dV]j ݑY~dO dNw"xmw"GnȞ{?Ƚ߉\RBJ5#OOM{tl;,T@=cԾf%psĄ+a:ݠzuzth @]T_EoHܩS~߫_(0w8=_UOn`]mӡhFӸI׷bIztNw}E;1~T[Zi]͟kq@*GWxZiOnn.ڮ ~^G؊'p}|>Q[WҪoEMIJ* Q5]<(WR*2/=>x~V?by(>V*+@Z m,UJ4=ujuGGS *(c>='Ga]rnCn.>K%W-f-zjTNs^!drFyuW5F O}舩=(pވ2{O"+:xDEB?DV}舩=(s@""Y,V"|0D>_҈H/"y"""""""IDEq<2j"(P~DQȈDDDEa~ߥdP9"W~XNux 䴭n۱K^ ZO= lz\U/FOhG'N\=z/>bc?ѻ7ח}q%E4}c)_%0k9!8AV^fEr+EixR+ gDiWz}MTf/G"\=2D$jVtr(z{UUPpRId9V}ȹzj=v;);pZX}4T?b*ϏUکOԊ}zLzÀ6D_h7S;?+uE4=z'Kx~(/_GwzUoo%g ~Dw؞ ?Y>Ϋ}oOM?:/$3ʯ*Y @wSY ,pש;\H4xral[F4KLr-\G6zB/ dT=oDavEaCS"xmw"sDU}h>Q\#}c QD?'WNOx";zUz]~^ yX@Wt@R B\;I?b^:;̓媸4Œ`;Ӛ(9iT&Oڋ}g"y""*4DQˀQBX܈=#Er~DQO4DTDEyƮ:pßDAwQlbypB"+Z\""~DTDDDEwh\DEMt""izGֈ]N}؈Z~?N!] Ԏ^GhyӏDE9$i戋Xq} $qyz "-b6 džO""](DE[)pc'LqtO{UV Uxe f !i{-lv+9RxU" rQ|U[ ž:jH1$DUDE+]DEz")#zN^DYMp>$DW""J"*~(AUYMEMQYU+aZni^y >Ō-.]+S4;y- dcЈAmG1<~DW9DW|QHA"kߨ?z"(QouKh]QBktDE5ԍG>:ȈZ<-Qu~B",'Oo`DE%CGoQiUk,]PDEM>@ysDEUiDE?I~DZLןDE0:N]UQ(YeRO~RAt>4q""sԒ{xyC'RNxDZ:"*&O@Qh55:jzNDEj%.<h3soDDZjI'o:?S8hDZ h zhK㧷(DDDEipDQDEj"""(ǰ|>Thr*@EagXfn{;:xM@?9D:̣~dU;_Sb~295٢XYcfabuOy:+ =^T4oo9:̫CȠsO`pOAUڤ(|yqUW 1EN(4ڷ]_>P؊ˉDEwh.䈊2}]ȈDDDE`9"y"""""""_r"(ˉw}9"eDQQP~DQDDDEaxd̢""" s(H(Ey<}Eb""Yr""y""*4DQˇX='E"""""(DDDEB?2"(DV"""dP9"\ڈDDDVˉFI<QO_$VˇN^ߦ:i%'=-E _DT.{(E}ܑ:OB(vߗ'Gy";Ϸj?^EO2+zGnIEktV@}ȝ }=(m@:Ȯ}":N;~D\Ep߳"޿oOۧފ4Q÷n\O(q"QDYi?OP7Wiw͝$7wgӒ)C{}MF\OȭDDDEw]O""̍es<TDSSgvDY?~QDE}czfF!Qf1( ǏQqDE;$^DY ӯB",9a}??""v""HH%ӴDOo/j"+㖺}d}舯w}"/gDEcӓ}Ff׎a2OOnNDXnӏ {~D\_;HNxp|(<dv>ΈI戈TDSQZ\DD'w4DBIsDE$J"+ /'C4QOsA4ohecdXiddAitDE}?aOb$rQf]-U#}jju8:"sΧ׼zbH?)DE(.QiJN;"{{O/B",_=}舰dw""i򿞾", ^x}.}h <@TDQω DE$DEDDT$hZ>T??j"*"""\m{'ݓl9q?b"('DEDDT$h/'/QDI<Q9"ڈ4DDDVDEq>M5Ej+K{>r*_oEaEiqi5i#=SA=[~dON}4} soN}揳OfiOb OOgE߽~ɽW{[ѯok.2ȝ&>cPZ~-b<~^0|>]{ $Wь58T[tГa:an; w'}It$ՓN,T\>b/؜{+ŖPUbcbθ[Xh֗8۴DDV2"*tJ"+DEB=}Ȉ.'戊DU}|"*""""""p.';SBy=e_u8Yiӥb:>3tjD[8\>DV""""IDE$DEDDB@戊2j"(Z\eZ2j"+ '"*""p.'Z2j"(P~DQȈDDDES3]MzLs-C;:e "(}DDDEaxdZ@}z"h舩ȈW""vx""NsSA=:[DQR~ϹE~Јq}-#DE GӼ""Y:1ZQ)~˳[KDQO4DTDDDDDEB@戊2ypj"+X^.'DE$DEDDT$h/ח""zOr"(DEDDDDQ{Qsv탷0^b+-[˨DMH-Z]ڻaڶ!?ҺyG<{1Y*ff0Me),A;|uXuk$TcX5cưhѭkFh9-x={WԾ$I,>I{I\$8{KIԒQ]gj\"M5:+ 2aΈZdO( a#xzB+h?Obr$+LzX-JjnTqsfk+E^w>a~n(YǗ/AhXcX(zh?T=~tD֩}OWaʝGDcTo2K-GQ[=^o25N>B4GޝmTלmo +zIz{{xL=>q"S~ZS;3܏/q;k*5a!ƨMZ4p.O68ۦ,kt4YEǭ^eo蛤σ锷FӌwU OZ揳O1 OOgEqqtQ~tQJKGgͦ^{?J+zϣ{œz>R+K~ꪫ5s6ϧբ+׿ڊ;FX{8+BЈFiDQtt( ~DTDEip$DQDEh>ވ2=]NH꣣Ny=.wi" *&K<糪G5ѮvDP"" sDEy</""y""*4DQˇXXtzQjqӡSQji#z{Goz"-n]4 huOjTqkLJjK舵%?W҈Xp>ߧqDE9p]4>p?"-jn@;".yvyͮ1\rʸ}W Wުb0R/.{s}na=MQ[ifsf]ڰ27U56618sDE J")C~ڈNJ8h \"Y}CDZKjЈh3Gb{Ow +S<'KyMv=-=F7Zi:VD^O2zG׷Ј%8=N(Dp^tj"'8qѧR"+Q<DE_ӛOQSЈT}z8"jzp""}P{;? DE>舱?{Ao, 9h8O5V?w>>DZ|$=}%ӷ=舴٪tkKrg4kj"-ju̢"Ҧ?=Aq:4\u;%WRÜ]q=Ow؈gUպW;=C~TDZshNGӳhUUC^{DZD"P=~Vw~O>OO3;~D}H3;~E:~tWpj1EǙ:'{O+|'} Ί77N`}ʊCX`#N{ګ{ʐN{O}FnHڢ8}##wh?Y vޟUԃE~U89W"@QUe>DV""""IDEq<e"r~DQO4DTDEB@戊2rDEb"""+K""WwӚ"+QeQ{QGωE>%},Y =}NH.'܈DDDQ{QXI<Q "(DV""""\~DQO4DTDEB@戊2ypj"+Z\""~DTDDĢ"ڈ4DDDT.""Wr"+QP9WE hDC=>ϳ,wZz}IEpkftÏ3P:wEB;s;=DTwPpEE^CQ@곧>O":"|9TVE{d"xg~Ί3~Zꡧ3ꊾ?Egŏj+\9E#j@E ?cB?1m^EN}Hm_?{_aEr5E3jΟBA<ϷQNڱݡEio{~?*)T?[os%Cg8?x"L~"k舲/OADE0:]qsDEx^d_"J{"K^""oDDG_XDDGf""oDEiw~tDQ:^D_B~Ԉ#/jxL~iůUAѳ\r"/F *ahdoC8TDDDTlNߧ;QXv{9""̈"}]NhDEaxȈ$eׁj".M:0!ketqsHw\XZz)HрI,u=}Ȉ(^}C(?;`",=',v'舋M]NOz"-:gt~ߡ(9x""{ƾ@}8j}]ȈDDDEn;QT 8=w"""""""+K"":K\4!D\iqu\;R׉q;^iDX(/"sv"@DEj"""+ $eP9"\>DV""""IDE$DEDDB@戊2j"(Z\x<Ժl JlUFqg׳ԭJSF[h~+y11߲fu˥@x4k@\>Ҵ>{*;EN}nDow:*O4N}'C{P~N"6:k\iN|wgtUw`E"*j;ǵt=؊zyWx}.=Z"3Ȋ֎}M=zk5rG>E0>VWQIrcdV:9#{C$oik湧BA-!A8x+*yk(!ST٠h_湤8a 5_Wiڑ㬴R?԰NW `G]  O>ok0)y e&؟Wآ gEGK41 "ԗEv "+ s"a:} \_G($hSۧw""@YDE]"*DEq?k'Aӯa?wD\ED~p^3;xO""p.';Z9q?b"('"*"" sDEy<}般DDDEix"I戊eDQ"""""""\O؈2I戊HF_.DEb"""+KDQ؈v@+o0JZYtן,קOfD\{""SZ~dDQȈDEM2"+ 9~hqDE.<zir~DQO4DTDD$h/DEb"""*a>DQ8V%݃"̃DEDDT$~D\]tLBt\w(DQ{QF=}NH.'܈DDDQoӚ"('"""*4DQˀQX9q?b"('",eq[iWpUAEEMsء5OpHq$ddL|!cK5RV_,vmep.h>w5?Ê2CZ z۵m v;MXk?T5>q   mԞ>}mCv#=g'zo[7ڜ1;4\fh*(g]PVj9TV;-[ HQYOQ[}VTTslt|3EoK"計DNEiẘ OEa/tTw?2'C{Pyt7?W`Z* %=:_z䍚kNZ8 5ᦺc/X"//pЈDT$h~b"(KHDEj"+\t'ڈ"y;lDZ< ֈZpӉ?\/ԈXN_N_A4Ͽ"-ZκGDZ2iR>ЈXWr"b]q|Z|\akEc!2Ά flϲc,No[_$8"/lŶm 5d> u|HKy$D[˨뮥y ",AHoDEt܉=]ֈ$Јt'Ԉm􏧣TDUEQy;7\ӇKլkHD5rKI+:NHh~DEp=V}舦mHӿDE(h;uDCPzy"4?>$v8{ODECT?.^#NQ@DEO.#Dw>#;=%4vz%I:üDXLu@O>""ׇވBO?9DETTh  'o?J"-POD[zp {}}i"-U9:AO4uJ"-)ԒOވ"j"(( 'ȬsR4NB9;t=?r+2ypX_>~8QH9 OVO2~}×)COvEEtj=<{QDyzI:ȯH"C~o^dPETW >5Bj?)ï&>~P_oDfy:*9Sy:*'(5cS?*( ='X~Ȋ/=?:)>,w󢡃@u?!E_tPctߙBaP'~R;B({[%PHOЦl;sE$GG~xxY,AEξ Q^"PnOE aWUY {]ڊ@QDDDDDDDEwh\?b"(DV"""N\~҈2I戊HF^O.DEb""""\O؊9q?b('('*"""""*4DVu;~ΈY.QD\O?gb"*""4DQ{QF=}NH.'܈DDDQ{QXI<Q "(DV"""\~DQO4DTDEB@戊2ypj"+Pe|rEvo.'؋EoW؋z)Wҋz+ tojQb>wEMuPO:}QӇǙEoI>#חS>5Xϫ!z( SOEi>;gQ4C=G_h_܉҈Heǰ;Eot׏NE+F8"xqiEipWqEQ#HEgKOgE NOG/"wR dDQk'Y s|~Qd8z8EgqEʯN|B+ß@},U9<8"w~TYlwc؊=>Y-}-9N\P/{dE$(HuETY,xӉ^^DY,_Ga"̏=}DZo>ވ5Ù_z",HOoie=DYx~DE;eoЈ*95DYLdQ~GDDR ڈvK""l""~DE ӧDE(~"IvtDE?b"*A""}>DU}.DV?DȈ3z~Έ)r"(0]@DE?WoDE'{G")e뫱-лCǠPȖrx""y""+8]mi"=}Ȉ.'戊DDDQ{QFNIDE_3/ij(+ϻ%]Et.> $$"/?*DXR?޴DZlDEK!=/A̞QiNpDE';}]DDDDDEB@戊2_T3؈DDZVR"Uf$~zFܒy""! sDEwOj"+Z\edDV"""ڈ>|J"""*؈"}/""y""*4DQˇވD]?V7SvE|}z$PA4tn}R+ p퀷,9n5t=> vE_PStk]/Vw=+NG*t;SinNw}C{:̝.z'C{:̝GN}:Ν OEF]*GxrKgDWi%wA?" s?OR+~~ J#Ӹz*+K"0J+x;*"0G""0|Q5Ӛ+l|1m1Uj~kcics`i1V,uk['ɚ?x;\cڻ}.>lbYeͭpuI\љac%$hԴ+.SI<Ե1>idxd/hc71 W 5{Z湡pZFX_L6lm5\-Wj*[Zj SIUᨂFPz*h;o4DUDEB?2"(DV"""""""""""{t'hQ]舭/""y""-ъjA<:z<~Tz".p"zOr"(ˉȈDDDEwh\?b"(DV"""\O؈2I戊.䈊2}]ȈDDDEa`9"y""*4DQˀQX~ u5x`w.D]!GDENw}"iXz-pDEgAoDD>""{DE <"CP9DTDDDDDEB?2"(DVh;""k{""+S(`""C{ZZ=rDDDDDEc=DE:HDoӂ"(ADEuO+gM?` y<"""\~DQO2H"(}DDDEip"y;Q2j"(Z\eZ>VC&N|Y=/ ÀA_yh:u<'$wڑE4|wdW3zW11?QuRIIujiNմ2͊::ڠ Zi.^H*4T$eڈ<+#ETV0q N^?j(^gERz"#QQS=:"N¶sΦȀgG+z[>[k}*%S>̩T%t; -ENw'CӡiIDZ3A'wȈyk&5DZR}cD]!2ܭ wihg{gF.-35ڪG8KqBk1{M ej)iiZ5t]$.Y^9$DExOj")DE+}GGӹ!>Wj",Q vz4؈#;L;Q5׏z""",[ʚoWzmU¶AIG*fq1xfYY5쨿nGFxUԾX)Z@[cX"- 'QDE;j=Q\jZZۡ}!P?OX^*A}Hϰɢ"(]Pà:tDV8{5DEa>QBꆎ{ƿjJyp:䈋 s:kDX^ }~Z",*^ I~DE-@@~QirOq'ԈL]xb"-2Z`ODEK?""xyk=Z"*OΈo\+zzM5"J"-QP>=I>}#ֈD "更Q?>>O""f]I:WwDEUU=<{zh3Mq^DZ-L DEMӫu"U$vq'"ixq(9'"g@:~DXd\O>z(#[jvtNy8+K;$ v9)Z=>˖2B}CY䢐4cw%~ǒ,wN}9QN! χ}WʊAoo5aݝ9zL}+~RZ9_kj23x>OWx|X}n^*m=*T}BO@VDj~]Q_xu3pE_ Ǩ}[a}ߗ( xړ`ʞ8wj ^BS+]POTCGoӚu;z6=_n~-q>r[8wj(٠Nw~?~N(ث{NuoEq UG;׀@n+jH#Qc?WPyUǞԢsսeW.=ҋ=B,Uw;1eW.?Ac:9j"lw=ǗE[O-?z,~"Ò0z=~ޮ#;C*5NDza>c_H x>zΎߧ?QEXG.?zeFDDEaxdP9"^\>ЈDDDV=Ȉ.'F_DE""""p\?b(QȭEj""""! sDEwhH[;?󯺅"T.E"+QX^.?r"('DEDDT$ee"zJ"('"*""4DQ{QF=}NH.'܈DDDQ{QXI< *0I'O؊yހz~߼0wkhaPnOo$Ry>_Y($=\'s%\:oI}ȰT{WZ,gJ"{(\~ϴ}%ǐ zx&vZOT=dP*J(Txz[~Q:0E]p"<~QP@:"FC0}?>̊(oDT:`>(8}d}GTOgE{J*}?o-E x'_f՝GJ(78Q_GgS6vo܊vqB)3Ǐq2(L`{|,w"'F~~~Yrn(pݨgUSȱ:>o$YۯQBXG܋1ۯQDχ\s~EG.#"dXx("b?9DYx5]舦l? "ˍADESfOhDE^~DYlo""lxv""d5>R pS*")OCf35dn;J",?QdQxzy舦z}NDE}>Ө(/g/ADS@x5m{tDS6];ttDSc(l>Q/_9w""'R?1DEpѨOdDVQh(DEo>^O@'O =FCχ2]"((OR".~ @!(JfpBj:OR8Ǝ<4".ꗴz}H=?gDEBDEa$DE+]>cDER@戊2ypX=%DFk}ehIGUpGκ@詨F8w82:{H94 0ٸ[*QV-5e-Loh DZ<Ù"%x׀=DXq:B",g$=""owi?=R",N|J"*sDEM wQ\2Ə""ߧڈ@䈊~dDQr>Ϭ"0Oӹ߭X\MQ$Zrc_ ZB"-N\~҈2I戊HF^O.DEb"""+ $hHD_ڈDDDV=Ȉ.'""eDQ"""p_厧,Λ2Xfh$m7Z [[$o7q'ib#:kv{rnn Qip}MRp<|;Qvm!?2"*x_r~T1} +zϣzSޯD^ s?`ȫ[T渇4 xG{9/@t\CRH*(\d~WCW?OzJ+zDI" Ȉ.';Z xꠞQucD]LJ4i`w>'7DE sDEy</""y""! sDEwOj"+Z\""̈DDDDDT$ee>DV""""IDEq<ˉDEwh.䈊2}]Ȉ .ZoJ".͢"{~FI<QXDEgKSC}pDE܈Ģ"z~Z"+ugq舚3>DT!բ"+ uJ"+za?Ob"*tz~҈#fDEKSb"*""{~>"+: HDEj"( (wDEMq""Y,5)OϭMn:J"..܈2}]ȈDDDEwd "(DV"""\~DQO2H"(}DDDEipo'0+U>o{D.B4>kV62r&HGGZ82nM0Tdl..G"CO,ζڣkj80 zEGKo*Z**xi))hd4 c69s\8OiQ2+|/~ҊMz'oۯQWQ>Z+|/CR+ ijzD^7kpEwoۧQSaȞoEǛT)6x/xƟV\&upnfۛ_H?ni]l1+l,vImU%i3ujι }C4DPDDDEO!sDE"+ DEO>]舠sqowG;cFN DE ghΈ2戊8O"YE=T=3L>CguEs(eDQO4DDDT$h.'Z9qFI<"*"" s(/'!Cr"-N)H= ;=H&N߻_ C}"`wӏQkP8xQz{xen^WX `dw=p]*m%"/6]Cf[m],6e }4mACX5hSDE a^?z")Z~:ZN؈ <Av"DE^HDETDUH>v+m4͎VAS%mfIW{PLg@Է?_oi⡿ӿBQRGQ\jO1 _`hJ"+~)""|K"(TZ5qwk 8"u`qDE`w]GuKkAǏ ",gDX2TwJHDX2Uk~= =iDES#~"f]t$w"-*Z5c5O1J"-.jIDZ=e[ qzAq"U5'W80i:=G>>r"-"i#"*9=(I/DETFΈC]I$"*g^ ~A}hEG=9ZDZ L~hUs$_DE]O{H:΄kDXO{[ڋ!h;\UzOrĖó˗j)XC_R̴}gq}Ռ9Ow`:,@O4$ pvz4Y,=hd:k~";`IU8S2h;y{,7ԓ{{;?:)=PXΜ1S+ +swۧݪ+d?BuP~'ЊUG~ OE{}`}ڢxnF_ЊU>>B qQkϳu(aEoŏj*H 'ŏj(D-Eoÿ(>u;4j+V5P.tfgFJ(Nhu#󢙵|~~BnzkSG/]Nڠu3׳@{8P;Jm@<=?+DZd6s߯X?GW4hYRGi谤NC_O/_du_OWEI>:N~AxgGR }gsE?NE[dit= ]ha\GY,Sÿ]G{9–>?/r8AZU =N|a~UrkQ}=$hHF^O.DEb"""+ $hHP9^\>Њ2ypB+X9qFI<"*"ڈ4DEH_Z-AF=}Ȉ.'戊DDDQ{QGωDDDEB9;QD\O""r""yDTDEB@QF^O.z"+Z\"y"O$V:@I{QHrE$D'}*q׉=kOJ)}{~ZtG}\_ZlC~<W^|p|w-OEPcN}@Ȋ}PO{9}QzOTڋ=緷Epc֋CJ+;ϱ3=<]ë}K[5Ph9Eaq?;߱T.;߱.:(J*?mY׉?_Rx`@;:)Y_rEQdp O8yeO"/ggEa`(zQF[MQeϿnPˇދ!kEh>ދ%oϱna"Ύ=?o?΋ zxҋQX\gڋQptE iR,KzB'Ev]Q)NZwYxwKxQ^5huQN:N#TDY,]DYˏ_c/wgo戋%dd7NOwkdhx'C=]8K$ӟe6<:")):~v""dDE{}]舥ldzw""a(l_DE3d:z""IDWǻ__gcDR ~~Q\j~bT=`U|q~dDV?Of叧fwDE4㧴"uK.ߥ.ǛDEcɱMf\)kCz|VA3_,?̞ ;(IVSUO+H- ,R7"ڈj"+5=ڈZzDDS5cQP~DQȈDEip܈78@DEj"(x"".o~[76[SڳJH6*k"g..ѡTq|CZD^Y߭lv[ePT.+()4hӋ_9isZA$E<?9DE9rDE):{} ?`DEjuO.T?/QX^.?r"*t]}9DW$DB@戊 䈊~DW"IDEʎHFr KO"5sZ渵#B4ADQ{QF~dDQȈDDDEawOb"('"*"" sDEy</""y""! sDE~}7嚤2SZgC~Ho:Gqԅ21gwJ*i6P$ҋ+ˁo?RԆ:K̮'Ёvл^=ki/zΊ22'KaV "& ((E^w~Ohv1ZfyxGk=h}oE U?gEj*7~DWtU2>My"h0Exa>U ~WϏ܊9hP.'܊V'؊S&7>%u-Ž&IYǷz] K^4ӨZ9b>Mn.TwkUt:xPׇFHS ZA!Ds,fe| hU w/#@,r4ОBme;&ovF2AvA_K+snGnOiě6KG_Q\id26zgK馌Gu4י'( QDETDVˏ܈2I戊HX\OB"*t8TDU"*Ov=_MQQZCC\F1Ft S/C^e"""pEr"+QX_؈2I戊HF^O.DEb"""""""($hE"+QX^.?r"('DEDDT$ee>DV""""8D-*Eۧ 5u&DD] c"C{:Z8DQ5"*""""_wӒ"(ˉw""}h-qΈ.ZGx8"y7ADV""""{>DQ$z2"+zΈ"<""zOr"(DEDDDDDDT$e]l<;_u ԞZfzJ"('"*"" sDEawh.܈2}]ȈDDDEwd "(DWEfFEQIe IT$I:5$̨jji竫*jZXeF=< tO4-dqEK@jQzmRTÐݼ;A8qeK k$nTȝ4s]#6Ҹԗ4=Yy?f'ͮTV\&`ȞDŽѻcddߦ=LbSS2 $0G"է5Ӱ̢4GTE kEpq-K"Q9Wj*"u=Ȉ.'OR&EmutlMd/gd`ȹSv"4EoA#Eah>NzXX{8CXxs*tEMGxMqMGxMqT='b(ocߢ*;oj2׍I|4:T-FIh+;zTl?NBثrjLbQɫ:z_%0hv HЗ.X_IhDEi`>WDEFTDQi4DDDQ{QGωDEi`>WDEO>>~DPȈDDDEO.'Nn""9"9"׆>DV4D\=\mѻXcCTDn"=%DP9"ڈ4DDDVDEq>4DV"""ڈ2I戈e糇ӵ\2~ogDE/ O/O1DZkO>qӸDEGQ;{wFbF復Z\SV{q( 4׬ sRcR8 +ԑtK4OOOpSm!CQ8cCZրh1Ӛ")>܈f~DS"ӗP}Έh\G!{ֈQ""]y""DXT٩䈋JO(jisTuk_,Swuiն0\h$8xOʯuDz[`h'DZ$Ok""g?R"-*ixh:k}hWQP4  "fRx>҈FhR"-ruwh}CwJ"- p5:TD[~Iӻ;|QhKB@汤4aj!kx /'%A'AÒ+svO=;>ҋ!zh;?(%].}E:~?"ӥ:lc}?_!! sZtGOH z˗gX_Ұ9Z,C48v(ˉ~ň~WA ?X{Qb>z~\R6"U#SJ,)*tAW9qE3`'o/Z,gtWdi֎Ogg֋C}^R*$Fǐ>>WqzP9nwx?z*-oO5S7TR+L``5:̭x ߷[{?'oSarnN'Q:2yqM=W6XbcmCpFbARnz,wǮ?Wj)[T8q#8cO%D]ObA~Y,ƒ _ӴpEWs·Ȣ’'cßp'֋5]sxt>oU#['|yXw}_gHҲ9Z,GgfT{1HwEUuߣEuij1ԃ'~GEuoo֋1NH>>aWs>Ai_GX27馎)c8 NijēLJUd$V"rQF_DE"""+K}9""Wr"+Q}=/E$E$EDTDDDDEipDQsDEj+ $hc/ "(DEb"""+KDQO4DTDD$h/"zF\O/"sv"@DEj'.%i<<.G%$D 'DXRMo$Z%k*88RSMQO1QiT>jwja [{u1=-W>:?g";~EP;,W~ȯ =bIU9};>WjSE%O=ON~4sNX2U̢0J,'뮄Wq+q z@yIHҊ#0\yswۧ܊Dj[”Q|XOQ.Eaf ?:'şr*xcйD.EZ?9Y柵}:QPE"~"T_GtzE+jWފu|MQL&}ߡli#ECnzQd6w{8~PO)}翟E k~YӧwQgGSovçEH<9Xq>GE6uΊ2}TsC=s;Qǵe[w΋Tsu9}9"ԣ}:"cE~o4U |ss?O֋xc%˜]+\4>LyN j5)r{Yk]s3^N؋%FzQlLceJPHbk:EQ.0J5o5݄@"-ɀADEuǼ~P27:",o}""l ~J-S1ީy-u nA%EQF>&W$ Lz˦A3QpDE/uuVS,#zfDkxs D[ArǿKdәӗdDS6~QJ y>DY ?oDY-̈P7OivFSp,CK}҈FZgtp?ŮH"DEM{?:".mnmYm]6oۣYm=N%8P^Ɍpn;ۧܨHeDWDEr"+ "DEz"*4DQDEP 䈋`eV7XD?:;dDE'"*"" sDEy<.{D\O?b"*""""ڈ4DDDT.""Wr"+QX_؈2I戊Hs ʌf$y^A[NjG(?nݿ6#dE[JI"e=H_T\=]Ev:̶jzx"\O؈2I戊ED[.5RS#.WFO45 .H49FullM}PjȌR:F@7a#(>XHWЈ'\ٯ+B++K;u}4E OIsEay<}lD\EtMS+ I8^5:4x z;n^'v&/:s1ݨ 'ڋkUQNj$G4{ª<(/hz.78e':0ͬISn#iTZ -VYsG`lѪדo0o͆ cԶ|.0k-3h͜֎itk.A $FA[}1쑍75{1pk5:8DDDDEip$DQDENwDEwA ""{=YDETDT$h/'Xw~OӴR"*""ס7&mWi*)ƾQp sDEy<.{D\O?b"*""rQF_DE"""""""+KDQO4DTDD$h/"zF\O/"y""*4DQ|voA{ƖqZZ2~̈""n?J"+Y=(~dDVO~dDV""""qv\n!sM!,5L`<ǃA<s.[ EmZS tɛR{ID[1ګ9O-΂swB*89f={5.kZ DE.䈊2}]ȈDDDEw]_x[䫭 1}舩;"*x}"oK0FEQ5ϒYdpdqj DVd^_#[-2n!~޲S$ x3X35y38=k̟oO\n=zo}j:wRW9 #3P0].'涡`>W^+t@?2O]]ρ}+ăZX{8dEa}EZ(L=z}^;x}08r!aȪ\}EGwz(ˉV0VGڊȔVn:/48$BlsSðr.QAEj*u∉4 I?TDQAOJ"+uPhDEhp?XDEj""".R֦guVڟppv+Y n ?͊Szܗy~]&?8?f1Wu7I-/z#[} 'S!ki1l;N_rDE{$#DE׏QDE0?*")qDE x ;QL(XCX98vB")\Gi"YwڈOFDXW vl~RYW)i-çlj|mncdY]+P lOUSFxtLh4DEÚ",8߯(:Ȉ=`""tDEas>=fwk?w""Ԏ{ %NqSOMbvjOg`>aT"tS(wM KO~w""%^:""ru$<;J"-PG!;}h9Ԟ>"-}"-^B"-}uԓǷDZ4Iڊ84qEx%cĬ 4׏Ԋ$ZssH"8K-}=,9'kFQfN٪yz/2-vrsEKSH{:(hs*:fA>XRUwːE?{"uIXah?2j;Ǵ'?{twhO2+~`MGx}"ȦbttO huגN;ˡEQG-~o^Y̜'dNOjYT~â,b_OgʋSGO/wZsC,' a>PH)ouhڋ XKyGhR5< aN?R,'\}=$eȨ̢"\ڈDDDEip=%Ev"~TEEs1{1s kZ.sĔD[m&q ``kq-C\ kV""ʄe"zF\O/ߧ4EYF\e-.`_Y!/ž3G׾?ycH& EP U^?~~ It~x{"}N{V1Fs""@DEj"""+ ($he"r~DQO4D\kz+C,"w1537@%NƻꬵPVb!$,oL'84A!_=NHDDEB@Q_oq=ߝwЉ>Z|nR5~ROɢ-YPB:J[ͦkCNG8B-*jzޞ;J.SSA%O zc&%$Iu(jIJ-#S_eF3X:u5jaZqP?yu渵%i:Ga CIEKSOOԉ<(j˽@EG{UE{>ù@'EtQb_OXoѾi)! =C١/8ٮE4Qb}8(p)‚yj2vO'pdr9񵌖2tkH$}E{I Oݢ-Vz(MC_Xq⊺i<>"y?<7VFzS50y"x,chήY_b @t9MHI%D^OP^`uJOVSNbk8:>$pEx٠s]b+iJ(>E wGxwݦmV#רEEʯOp3_N>ދ!ȑ[ Vj\M.4uxTy081 \u.nG-9E5{wT:G'NAQPp4/8},ӏQukrUhfFd88Qj1TDZ{ށER~qqEǞm:;y +rEIϣ@= O-AE 4=R-V)ӏ",$28q%nl,Ku85heMfHKvrEE0~Z]EJ*k USzૅ7{i<sOc(5EWSG65%Di㎇QMq?DYDE5"dzQePû~tD]­lTkzj+euC3>GP@@wQDEÃ{QFǀ湥ks^ \Өs\8xD]nȨgWP3_ 9D ٢iq$Oij"--GwwԈv}Ced6M}?DE0A(o(Y[Ւ>\85*r8}aO5DE9vǍ aFjthѭ- f>DW{DEi[^DOZDEț}BnS~ #ǜ;Nz8Ј ODEp?IDECf8""{QF8IsDEXg8:9]?=D[hDETDXu6jw7"-HD_}=/D\G[EͅGySc!:Ptu3MZXׂ"pLmrs&t9Ϥ=jMe]ns'iݫ^ּ"~=>|m)OuU e%җ=:11qaAEFc&S#lφ0b?#Ixǚ"..!7_Umxq%L]&HKjI;5$Eā̢"G>?wDEz"+KDV~܈rmkn RYY-KZHؠÍŧB`tQl{%]SRb7K\4 Z=948""DD""@?X"":;(jba&ai:ZyLpzB".jiBwͯ% ADE_DE3 >!֊V )kffS: ^󬒖!5Qh{=_5LZŮkb9DZY sDEy>DDDVˏ܈2I戊9wɫK34s0B֙fBֱN.'(q+U-DfJyAPt<)XKKssNnDDDEip܈"yQ2j"-׆7 v i|t8HÚ馕0$hvj*qL+nPsJAO3a6<푑>kkb?oOV+|ݪ mYn'^n"ӡᣉE.wlﴢY}:ȝgtN?2'}Oz~̊1xtOFdq:Ȳ(宬ҮvHÏWiEEGSoiRI(跭'Wz}=}Him*LtcaO>U@P% 4v>Wtt=*u~ΊpOEo[_ONwY"RyQH+zr+IEMI4asjۄ{mF=5cyq?NHq> P\>[S.qO0`S {8\6Wx}H5dzO_TW@{Uz}JfyaEA{GuI'Luзm"4=Oz|Z/qy9|L)[sxܮe4+sep.ZEЈIz4DE˖]\jUgu+etOoTOsgS xugǮUj 0C4O`DZj"-?WJ#t~;ꦒDD]d$hE"+Qk3zd5UY\^ؠMQ<2&@q:4V#jQS)Y=-CCd𦌐_z\AB "-I<Q DEq>܈DZp\)mvY++${KKZ㍍.{CXI Qn\o:Ci*$[WK!Uos<4lDT'NDEO^ΈDDDDD]; VLVNhˠxoI:j+4yq(k^1ks\4s\Өs\hKXَ[d Vڊ>KWj#dA,DE؈}Ȉ=S?%'Ȉ?gDE٭ॴd2:HVp:Ѵ?ì22C|i4DTir"(ٮH-״==}=dqkn \a4A/TS@28D[4#K#]xR@]a!DE2x?XD]DDDEaxdP9"#6qm+]]+xx??(Exy a:ZyD/= i/$5NsuI8IEa#h`|[x}E 5omJ5hpY ,ӋAzf=`̋j# h^ _xVU3Hvkt.vZb7S4,!=䇆zD[B@m^q|27ĉ h:G9 Q`""ӟwh?OHDE0xj")Z#m3CO#b"-H8HDEZ06;^kPhG2 V A$gG#h hDEo>j"*∊{QUMnpݕSs6;NHەqO ~D^$s#ڈQSy}Ȉ~/_,Ծ$t>=L2 hK"}\- q: ",+ͮ\%ݠ4půd?S@8yL5=}\~ADEgœפ#DEQT'}}=""՚p'uN~]Q@jHQ}TDZwɫžLꚎK!/C- :iydqF uq IrlrMy|K%4ɩ hqAB "-\hӟ""}Fv(#~tDXUwѠDEy{Oߧ.(e N]x>CO"{SZtUS[#\=169!h$( zkoq6_eU-Lu1C35{a-.. uRjgS=Hy]OO7֋ חN~OӒ&:_E#>ӊ-:Zz}d$tӤSY B@ᇷMڰP.}ۧ4RIV3y;' *J4PK,828oĕMt汝8׳ىVƢ@쾺S|W=GΥ2G8 EN;@_UV!mK[rYhdlcji*.ҳ{K[NzzV3?x uSS zGR*sr.Ӟ}o?z>?[Ko_+\xht Oۑc"_)">~tۑn(6m]pQAOGK,KZت>&&AU8R8tF]>ϹHڗi_ax".sOSZZkG]OR5"|N>4}OGRchk Udtz ( =ثCgvw;s=ob$r+%q,wAxx,T>9E uvˎszwwT\;=|:UCj['UԹ.pc UWzfY[ͱ T)_C=%[#U6(kὲtb2.5ESˈ#{9"J$rZs!,)y?z"8]Q`Ix?WJ\t>DZ|ц>B-ZȢӤk{?:-AN]+8jΆOZ-k}썖 !˝ʯ-y|ҾI"x9jl;֋7;k.EOIj)]j}jV6T%tn&{ T]O$h (QEj""""Sʮwz'jZCQJǃVܦBeo -@p-pAj< D^jyf~T\Um`d41e=-žNuG&4'Hꚱe>DV"""IDEqq"&Ek8B,f_DW5iK~S9pI"'QE{8'=O1>E;q##:TCGk(]"$׏u;ibI3YSǏ @E(n̞I(j5׏؋򶢺hlSU?g$s4IEMU~x~X%C>ϩQaP;u94@E%@gg$Wϊ,*ЎA{谟S}=}'DTמ8.cv q(>0͒fkP:P9=s) d#:Z@ހ{Bu4?DP: }G4EM (]V5Uwr(_yP?7ӂ(Tu> (IOҊߋ=~҉g}~O=#mj`K! N]wJe %Ӟ(mQ}=Zzjk[B;|`'W9=^{H*.JڱǏEa:s؊vԃN=ݚGSp}?((1=\9zQ=@E;fpupE 1/eIq#P9xtu__4mT7;jܺRB#asZνQfP#~+ce2^t_Y*CcӌH팻2:d/go$[ FX5QjpG>V(8jtӏX=<9ڋQVB=Xw"̎g0E˰9" Џ}aM͂jGʅqʨ}@jW]8_NhviJ-N)vȊF -F9tӎzNhE B.>G|#uЍ4v4YpފHx }^_\r};GDEyqDY ^.4N񹼵QjЈ]uup 5c!kX~D[=i]ȈY7",9~{Jub0jIۺ=:W}hwoS8DOO{DE;DxdwLk8ODD\f&"*zO""ɢ"';ƽD\-u={;$ k=xDEȽc~tDNqղ;,\K}@i1ӸDE_."""",7ڜziѼUGq^I7 -p:ADE~5sRRܨ\ I8( G< DEpDDws.r$"ڽmDEC=|ֈoӒ"(DEo|dC}&7i<nb@戊2ypF\O J"-i(.'Nq>4D\w[g=-%'Ět5ktSFV }-6!} SO5J? R5x=X q~Ǽ^TCߩu }Q!O#SxDE(gyjmKnOfzYc.v""i<\OHHY?>DWrDEr"+ DE,RIrlѽJwGᖝ$#1 ".=u,8hK%%-s_>"-Q:4o^]l2˔-%HʄrM3?="&]ǧ M_SS-;K<"ʘƈ#]nE{yzxPm*!p{~ TLič% OsO@".DDDEip$DQDEj"""(c/:ݺhin,=6Zf9Z\5j"-O}n`0UYP׾_ /vzD]p$h/'Z9qFI<Qb66罌m\,:MOMQLZy}C5ވx}=MSR~ xV :̓=Ҵz<52t疁+{lEѺV,85dc^ ДZ[OFa/ xϪ'Y}<w?2'Y}g{"~O̊;g{"qYAg{΍#6 }dMvWEp#mU&8M'q\GA>Q\"ܗRȭw'UOA'hwwZ\U =O=JWg4Ny~ :9E^p`^{8" _?\y\`Y-Nf xΜG\Q);_Ji=tNj,+_#ΌeK}%X^;8fǧpsEb}]Nj24hZl~}'-&hm7kI[ yx"u C^pSSi3p#֟Cg{;pţձG$LA1t AtZeǮն֟9pꂢ-xû]W!TGU sukۮk\}*7Wdzn^mk-ѓ YѠv8є~""" ~nD]߶sQWQJh0~馎 kjuw*x|ijzs {ӂ".. hPC҈2IQQ DEaqK+6_^Qv|oVl5M;7iJzjɪ`ӹ&7_{DD]'DEw|DDDT.Er"+QoMPٳlrs{#7&O4RӲBA e<$7^D]ʯ>5uWI{ + =SSzf5jկ-J"/5'"*"" sDEy<}般DET=?OqӚ",8 G3}hoeꠋ'W5Z'][⨦|M.csL=Ȉ@{UL,54Եr.ULp=IDEð^N"(Q:wh~׎:)Ig$8thڷ#N({{Qu'y%Ai͒qqggԈFBDVhG0QQ"%ϧՑJN?Z".Fo}=:"@'Ȉ X9mdn@b".D\Ow""r~D]ة-h'-Dsұkۧ];DE_­H6.s"-9"فR2*B5=]L!:]"""""+ $hZ&6IO n/ pNzj{ ".p"nD4s>TSPZn}3t"X_r"(Ȉ2j"(}kęmv!t.ZgWib2+ak^b{IHՋd^k* 7kir{ r࿝w ئ=[`8 UU?Z{Bi9TRj'05Ұ9 ;їH]mᩅƚoiYh4f@AEֵxytW=jBzGӂ+p~UaI4抡KZ{4}4W8vjVwj}=E}*KvS('o_ 5+}ZdEMq"Px_"""oiv5WcڞSY%41Q 8eTMqQ~]".,߻ݲP[憪[Uk sdaI7P1ڻBC]!oD\tDE?"" ~DTDEipewƊ\RkF ;Up4Ԭӛ=qkq˕DmM֪KCоIi4 2:jG;.Ԉ_.?wDEϏe=W8wT): 9-i,""%>DV"" tpgwCtu3IӌՔuTtG;["\O؈2I戋~h`ogM;4AAs| $juxDE@戊2DV""""IDEW6b;7T\OsHj;DE"""(*h&8iiw(_# cIDE s(/'"ܶi1M} ,{eA,~^h7ra78묛wORoH::̊H\YYqkւ)tĖ6kGֈvbsF.21-3y-|r-'DE!㷟ӵʪXd19džta ""̐DYMpp~DUkQHG>?z")K H%#YO$=,<{Oau:D[hkV?U^&:8Z=2&cx0oSjnvꊚyn7Pnl|R>0 \Z}D]ԓDZLD~"Ҧ׆/"-2j5$~E,\y;"-.zc;"԰ 37t]edO ȤasDD^mZ;oY*[xX sTj(MZhQ""ѧ@9=(iË`򜸕 4OЋē:% O.i%<{O="_W*է(`:?tq}EQϏf2>GϏwgքiT?'F E:K#B?2o;pzQd"y?)Qw'v7E;cr{U ȧd$'ԭ~bIRnK }j깁Epڪ;V]ܫm#WV6KQP\=MIV+y;' ֦#Zs潤9iv8{8Pz4tv~.4MbnQPS >1;g٠mu@qw)x2t{{U:9 }?Pq"Ӏ<;Ni@j~8 ~WTf}]EwTo~eŞ~tT0v;W=x?:,wDyk5w>,O/8j\*u#TOil-$A㡺jKjj?2|YgE)wU{ :WyE dM{1{LlcAsִ INv_B|?HQxztU{dXjU0j:O=T'õSONqSj8^"L.z{}~*fr(?8 O viбݚOpTʲYP9XAwЪGS*<E$=]zOQU>}k5~߽pݽAyt]r,Q8Է.&\UUHhg6#DNw&.kw~ew]ܫHE?t^*gp!Vؚ4.w UP8ӳE5:4Q{QF_E(X^.'D^em%~`SQ+5:6(kZOt״*@>r"X\^3S[}c^s2>:HHD\O""jDT%\ m5#$ƓX^.?rQ9ҲHI<ʧ[}<[O?EEwObԑj 2I戊HF^O.DEb"""+ $heDV""""IDEq&G lH#:5:ZL$Qq ,Ru>\OdzR?NHjz=~؊4~`@'}9H_(:O^;xȱPoOw$^=(mh۪]NK$@8k5:5(Txӗxx^jQ]5,&'=_T8'Bxvצ3?B*?>uQ5Ea=ȣ5'Q}"tWtV{נD"Gfq1~"eW/{Nߡڊ7]yv"eQ׀}!knHT;zGQ=c'ק(,֋!="ʶ]LZѸfQ ,_h=mE*:=;{zMP|t4.'Qx"_"GI$%ΑqsKI(XEO=Qf2]8?;G!Ӂ:z5}H#Z5?OEEPv~QE9EG{5jPTEٜ'&!]hdU9I05էQZ<{ sEC0<#x[G.ʠ-HpHBJGH{x x8eqG0s\8ĝK㫜I\IkK_}QU 4w"""dzeP9>DEΛsASFTTt5 L'Oi,5Xbvj)k% 6Zt=ӡt>tYU]9=TϘŬ>Mh ""Z}#˿DE3j.g舤lĝ=DE;er(i(3oxfW+bKK,FGT@c㐒:;ZcsP~?g1DElISU,p KkzĞ8""G~7u nRF㣙O==.sDExڈ3O8;OGDEiuY]~D[cyUl$N4"ktDEF6Hd|os^湯i B"(>sZKpĒO`7bW$4FQ;o`458D[9>.DXwQBz2"()>"kPM'Un'[-`]mv[:3oSh`c{89>A"X(+k\;"!^#Y"-pDEn%?kGr",GDEj"+7H#j"- C*X$i9X֝>kb0,GQWÆȈ="ڈ4DT$h.';m 7 r۪{#`pRZRӗAi-xs"q1CT ت;5Q])]۔m?wDtd- $KS郟i 0CT/Nw#krk,-4diÜt/y.%<\4@戊2N_Ӓ"*v'(DEipDQsDEj",gl5AI[4k:q-@^}Y#+Fk1> ".Q:]-73_O{Kt>H$eP9DQˇވDDDV($hHF_DE"""+K""Wr"+QF_DE5%meLU5SUji|3F%FZA:K ̲Kyw+,Q!T#$lp.QrTC8uU08EֳW7p Fqb.q gGbthD=jx~}O?OaUaN;٤c;s^7P湤N}~N(d_w"^4i6t CuUww?:~ԋru;JA}>gwG0UYmO!knO'BOxxoĝ+~Ҟ'{_N*OѢ[_ON@zդ̟USMy"j+}Tܓ]9~EUax(N>ҋ}Y$ 6ۄ:wDVOڈr"*"""~R =DEixUew1սu|[;N_ztDEP9DQˇވDDDDDDDVˏQFI<Q "(}DDDEaxd "(z{QX='EdDWi^Fdtqn{kϡDE"(DDDEB9w#WVzutIГDEEYUnth&Na-sO" \ HDEQub),+:~/ũd.p^+Fq[z\SYR$vk#m5@DEx~"`~DV""""""IDE ̩(ȫi#fGIeu3 ji24DEHkݎ[*.9PBGS1MNAiH@jI "=_vO_S$OLP 7_""QZ\eZv2TX.s2 z: GU[PD]DEYYKoxi)2< 67si'@9tJ".gyA2ms(kh̐hB=Ԇ<:B?էf_K{҈";u=Ȉ hHzuDE[kG߼Z8ZQ@.4U=gKx$8h ":+7 Y ,3E5DG$20FH!sֵ{kZ֍\8Zy""}h,h㩌}rWS )lM'qGF\Ow""r~D[ʪ0ܢՐJ9k)@54 t5!GXO{zOe[2e%WedMp:jTR^Hu6Rʏ 9D/ꉒkX{udG1͡D]NDDDEaxdvڌ%׎3;#Oq &6yh $Z=&k#z >џ<h9:H,xn~ RR?=fYz߷ۅ#fxdtLk4NMFSI!'vAs^9B CR7Qth&@ˈv計ew&> }# 3/k\d^Z'j!h %Bl;QXc(<(LzvUWڢt~}#\=# "8GB"~DVQg6re#pe m]CiIwU8Bu'^jTt殮s(}BG@i}ߧދ6}44NOث{@{QS×~[{{Uz>⊝N:zSV>>Nw~4a}d}} )} *'?J+\Ov~O~XΕЪO Jt4s?h>󦇸 thEO4%i n4qyޗVŸR"oohz%( F ƢHDP8;HB؈9QZ:xY*]iF [=N~nsqkiy޲^u9ވW;0K!cD,$jC@戋E,DEw""mdy]Pަ]Aآ"r"""+KȈTOM4ѝ HaG#AҽݫZ}M=O ,e,I&c@׻Z):isץqrelQMq[hi]5Ud k\O!F\@="c6MMiZY$aISI͉$9 O4DDDT$h/'"mWh]h%0k)%_fO 5DE^疍6cmKYWkw_Td:8t#pEuc8f'm\!}E#\U5u!)ibBC8$hv Y|]W-kcieQRI=Dώ"k#֒w ? <V(P`lSåN=SP2TW髄qt"\9""Ԉ&)_ Ik#nem>]4zc?DZsUL$W "*Q?:").O@pwuDE+_}Jr}M>DE $rv""0HwBv""a"s∋G2;v)_{^;g_.2vG5uIh]@t̆U3,!/]rK^I`VMW$QkDXѠk@"-L;opDE(psDEx'ԟN=E¡#DDCP>= Nzh?yDESQ7h舢?"ӟ烯hfr?~FoݦuP5~($\ S"}W8DXUۯpw"’gzk",9*O~(gS#ЈJ|t}DD[6slke hYÁqЈoMVNQir~g'^:_""ҧ 4DZ,:ǷwDEO>~ЈF GDEM3~C{ʡ Jǖ]8'P4LjiO2OA>E0h<9?Ob,977"'=iE\xhOn+K-i~DYC@8;Diϧu?NH7{Jҧ_Nh|3ds'?tz{ȴy'B@''^:Qe2"y "ypjN EXdEIZ]?wzy,j@YLOӳiTAE8'*}^߫]}a~OI( sU;@p<}+ vE#`q>КzOޱU=?-0hh먩bz#vakCc ,2>(@6 =kM#I׏w/qzno\n5:xֲ6j#k 1kx橫G&?uG?xk˚-,@4В}ZSNGTXA ?u:{Q$} whuTYncI i$==^*O C~ESd{ܥmSuGIE~էtd2]4 <}B{B.~,TÒ=uiϏBWc_H[*?+#p~DTۯv?QBkOti!,ˏꩮwP=k6:4"r+cٮ5֚uV[ꦤc]{=,x9PGwϊ߫E}EfAw^j*ʊ"I<(-k\EdN#+}::x;J<|sG~a:18jyq,O֋V}9"ӥcꠑjOt?Nh'=OLjPϧo~tZ\kq{AUZ>#45ʺ{VOKYG<4Fud ,oi ZR9a.My8I-ulG+Xc~ q!i~x :O=:c 9q?b/a;!\I<ΫV`>$eDP̈"}]ȈEix;;ݴ*FqOJ](M%5bic[%}vVxql⡡]_p"SC9uTm_yrl!u 'XmFO̝ow7FI_Z3ZTNvOQqJڊDDDDEipDQVˉr~VST6zșcpi%ұS^;&5P.xS5ڏHjj ˉDEwh.䈊2}]ȈDDDEawOb"('"*"" sDEy</""" Rziˮ~E+@grӥO/z+>"'5E#=ѧP?>Si~zwzOyExѼOQikwi_, kϴsaI(܊V>iRi}%F~Ty Qa^8h E%@}WO Or*g]_g3O'}Qӗ?*,gJN'+{{('kzON٠QBf`=ȝS(5@rq⊽-ފ'U~^gQ}ڢڏΊό~O r>OqnMQ^ڳ?g^b)[Vxݪ+t@=(-`zhoOGߪ(\ޡ=Z=qTQ͙Ï|-AEQ׿"ûlu]M/xXfx؋P"J,ӏԈckFH'h:};GE}̊M5:zuR,g7$tZU=_E =󏯵#MQf9nuEu}EQ@}^P9jTiB(|4EFEXxzR:feETDGE+ǰ4uEAQˏr-xF?ݧd4&}Џu㫵EQ?[RwVTMUQ!GK#:IYnzQb5wniLJEsf'?h:B,]==Qd2M>?DY \{5Qd${j1Ls\4V8ADE)s!.=-tSTH8st$pDZUms.5s5Pƒ lq#4DE7>DQat~DX-Py}舧loDE(Q"۩C∊fQn `Ja`T2*ցZN$c9CB",+Gvt#_5CZzd-w ?CϧTDZhz=}舤HzQF_DQ>~DP:O3cRyq""췕\YkeiXӫYI_@ZaSA@^(eLͣB߱\*Rx=mȈP̈24QZI<INO{dQG?dυQF0g]+:|b-CX{ZAI$$I<'($h?NQEωDEB9D\Ow""rLnɗYkrUKPAd|J"""*ڈ"}/""yDTDEB@QF^O.z"+Z^"y""! sDE?b ,s\_OrǫT-律wÒ=7=ݫh5myD<&˭^-uxlNQ=qlaE]u䊚ir~DQO4UО@TDaE$SKO#fY VK={sOKjd$\IiP^=pt\J*;>Z#[4/qaB/ *~Td+|"*u~/@?Z_=A@EisGn=_MU/G2+K+T>\~Z\QڊR҈P~UEq>ܪ<"^}A^O>sVDpP!T]򈊽-Z]-י:wDDor". +xl{Zs'4pnpyw|DDDDDDDV=Ȉ.'F_DE"""*D\Ow""}=$he>DV""""\O؈2I戊HF_ڈD]iDMBY\'RG_WAD[?""h(DEqסDE׷]}(y">̈{Z89k\4 \5ފ, c&g!4!-vN*o :Xfq4lO ∋H""Xކ}"@>DT?b"*舷ps , LiU=tlhdNYbk"-"dyHݪ+X3^▚8)+_J"-i@yQ[DQ4r$O҈{u4sDE6fxܵ?_)igz>ts(!{6r-2zw^r hd2QSGOotO4⩁t""ypB"+Z\""~DTDDDE1&|ds]4q9Rpkds/cn[n=u-LT}5QCMQlG 4%Ğ$DVF\Ow"".9=`.Q᳨$9qe54Mt;Ou'G4'!ьiqҶoXf-WYqt G/`dWWԽAP&׊/UZۄcvnaIKtOU5qTKԆ7Fu-SP3h֏BݭĿ{gުɦk6h% F]-2?Gjݚ@ёZ{DVˇܣ azjUv{QZe-z>WDOQk~Š#T9(~~Š&?W*3}ȭja}aàuE)մPG tWu4OFbE>'x}X*ރX#QCЊΡSMGxh{QQ$p:""Ϭ""My">at=؋h/ȱ]_6Z'z>=Z5NFt*|fKO n.u^ko. b-('Gngjt%KkӴTĢ"ڈ4DDDQ7{DEQF\Gj",w5OӒ"+QP9"/wQ@ZGDEDDVˏ܈2I戋7&'S?K8U  #H"B@戊2ypj"+Szt 9QVz~z'GV]=nv]#_R",tDN\J"(DDDDDDDEr;5\ۍ[j`|%$ÞG<9!"UVR|\0̒jKmF[ sI∋****疦yjgQQ+i^z$I$'RI$DP4D\Movml6Q|\HZ}١{|V= Y5c+W +[>I~p*hmk6[4O|Zqi!aJ,ĸ1pHoDE/Q#DE{$s=#S^ AD@C]GDE+_DE0qZt}8DYPN$ws'44~x$"H`rvDWjO}_}=oDEp~DWz1܏v/KPخۍx$ڈƺ: jIGk+tDESjy4!'ժ",ԎDE'88 QZj8VQTToDW|AZߋBDT5@T""}I҈ԞaV"ԁϻ٩DE%@:zג",'_G#껏""|O{bquϏhmkD 4.NoOZYCֈfUÂ"->J{~>DZtMnuwӊ"-"zx@xjLbxü@Ot:̢"&P8Y(t׏Syy=kڈGu:>DZ-EYz?Xz"-&II>F΄5PI&_ $2Yyxwov7TZlYEϿh>EG\8r朒xdY4kG<8n?A"̍hh?EOSdpoi5GR{>,GѠ{J~֙,jIxv_r,DωQO59<$Y,>i?NWi9J,Cgק@:Zy"l`sNs:FVsoZ)y{/juSV @v;=ȦS5C֏`IROo>!S)jYB’Mu?W3Ǐ!Qd6ueivraOh =CJ}@YkM}_j,N:ӏ䟧p,gTF;I=DW chXNU10~r#W&NHawکР7?:+?4z}(P/N2!q?S;dVA?z}'7wȣ4 ӡ}UCQusȱ5Bj;Ǵ)~)Ί#ӐIUS5EN>dcU(wj(pJďq)Q#N"tD#rN>~p[3]8ikEq*w;jHazQbz@Vduyȋ H[+:fRF~G qo*C|u@{=E+4ӗÏE~pXN?p*r}aYT̟Gf,D}|4~ZbsxX2Cp$rZSsE#'N+\9-F)ӡ"g3URNa,2}]NkM-8}>UZ`V B>{]YLXtZ{u<4#vVqg܊%B@T2ypj"+P~DQȈDDEaxd̢"""*4DQˇޭ..q>q>EjeWZ)ګ}}$ZZ*ij$= DEzt\ֽ~:㺿k_|M8+̊w痢}ˏܵZyDTDEB@QF^O.DEb"""+KDQ؈DQ{QF=}NH.'܈T$E+[E4u}Zl>{gpЋGg=IW89Ep$rҧ]x??yE{Y}=O>'wjDZT`8~DR({=ݧ+ȴ%']Oc={Qa8'kZl]B+@ԋMөDԞ}CQiTt?7Ԋx}2nvE+cӵ'DOtpQbTy/(.w?v"}OMy.Q\#P,gUk`'j4ȋCCv.׷V{4hsu[xq"5No(_Ԋύ=̊@ѠӠDȬ-י?gDȭ?b+`ӉkqEB;Fnǰ(\5ALڠtPp> EzaВ!^[jiEQd|KxsEaw{~"ˎ㯧~ڋ)ODX.r,G~~~Q~~Z,H7Ԋ"băcЋR}(tG(z\~BvH#wk >߯֋RM8z>ן>jL#=.nQf)o˴~dXѿ~tZ"x.ڋYr4kuE̎Hxky~X4DZDE >8^DUۡ""K?XDW~{ϯ(yDO}eޡݪ"(C5~h3 Xf׷<}u@$ߙDDQ}'"(]0%] V:=ƎJ֙dcH&9::\;ZH< "/iך;{qn?xw(vDZB"+Kz:"+Q[_҈ȈsΞDR8>ԑ/'舣.܈2}]ȈDDDE˴"9"{~F=}Ȉ}VZo4+e|.5dH \ͮ{udx*n5D{!URK0lTWKB#[ Q}4K"."ڈ4DN|"+DT.';"+QP9""gB"+"+K'}{R՗KcX`s֑܈m""4DQoӒ"(Z\eZ2j"((\?gj"(DV"""\O؈2IQf[gkN[K>AN5~Lj଑Q}99i=+Dɨ gLFuOAQOxO‹5ƽguz|OG(z>О(z>О(z>О(z>?b(̍ u*uGOEʝn}=*/A~dToN}}|:)kISL`C#d]5uךGD\Cg9+#{^?~Rn(W:z!EpcG֊u]Q9"^\>Ю 'Ȋx`ʠ"+>Vˏ܋%CG.'؋!QRdZMWKL)g#SK[w7Mh.cՓIRI35:OҹWeV;bάIcovH#e!u0>88ESrhK.(muV5TsIO;;]8-6Kc?q lٖ;eʱKmR1#[#5."K%:9`+ּ}DDDVˏ܈2I戊HF^O.DEb"""+KDQ؈/"~dDQȈDDDEawOb"('"""*4D]6`)5NGQ#㯣DD\9q?b"('"*""4DQˇX='edDV"""׳O}Sh舩{"*i4DV=DQ؈s`#B"(Z\eZ75^<(zO>D]/"y""" sDEy>DDDVˏ܈2I戊HF^O.DEb"""+KDQ؈[ح.to)XC謎pĀ e9x#_v j^|Y>38pG^5y߯읛CVumi(dltF$#sNݯ9v==|B^v"@pЍGQj(:hf(oȮt=N "=>̊WXY}V#DEDD^HZb"+za?EPHOЊ k,t'&xiߩVr{GG?E Uu=UOe[oEfsU>|/CR"u>CzW}SDTu"Z.ѩFjVODE ;CrW>(VO<~Awi:Ntޟgcfg^O<=GJzg׵qX\;WVϥo{8;$h{""kuDEZN}"-2Jxo^dNL x{;ǽ-A:;A;isUvO=H~"-z|}GʈFRu,4ii3Ϧ}?9(cBCEQCǿڋP.EA>i$f5wz̴g ǿԋ-};{J>\Jd_GӉ(#ѩQXI>G?٪y}}g3,EAZi~EI7=I5Evo.'z-@E;"$ǿSUiN?7be's[ ]ϻB9{^?Pe5 49}IsXoSH_b)Y4ܖ#goQǏS̝4hUXUˀ -N:O j8O5M{>^KJzIדxE8۪w%8WOw=;M>^@m>" p8tu75XS~j}8kE]]塚>*x|8ATgb Iq<Μ{pz'Þ8> w}ECNt=SS}kOQP}:z/]]4 PGϽj 𵺎giZNFϡ?B;zXυǿw/zG=zکmA>"t}C yV?8\>E}W^Gˎ4yy;.X3}|zUfVᦼG>( xJ=_eDozOE4}ԏ?754:~Ē 9p=ẙ8GGEWNZU$v~XBj>U;z}KQ8G|`#N~>B9?ދO>`q?OjGNZWwK"y8-J9Ȣ|ej>ε(ǖX2hG^H}C9~U $?NJ2ypj`QˀV,\}?2'@y_άZlkV#"%UYAb-6X8E(x8?E,aQݿEA..e-:MH¸y^9HjUwOj"+Z\edDV""""ڨHʡ s(Ĩ}2ypj"XE""($hE"+QX^.?r"('DEDDT$ee>DV""""8'~tXsK=_OʊW<ڋLN߯{L^zkS"'P?>Ruv4"Ӥxnq~4ҋI~g_E;[j-4"$+x_z-:y׎@NgZLӒNǗg|^w(%RI)@->j;}]@}{4{9}ȴj _EPy^ڋ qѯOg͏bPNY_ˀ*u׎ts/>]ݚw+@@G><}[2,G՞']9q<}K2*OO4vuCocSdz~|GQT7^}\O"Ù%:4q7ŭwڊOxݑY:vEN:vDo\Ȟ?ӪOdV8i˨v?oa?j(H$piv"MßH?hsA"K/܊Q?~V?aȧeK;y,:<=K*ОHz@ZG?B,{}9 GTVWEN5~@tӇ/tu'zEgKϏ"eC]ȣ,"cuvg"]xz{EIqy}|,W8z{}]Z-R"s;G>Qj}=-('h<}xE#z}>Oo 9 Z3c9}( 9G+=NZ=G.?Q֠xEu<ts}dwF{u>J-R~@ߧgv)A/.ByjH8q8T]x\G(g2OO=hxӏngDR :û͗_ghDE}:}"disDE''!""zt?b",zc7+ψDE*;gn""K=J$_/_{Q]xzODW O^%􏯇>è<~TDOoDES3G=?DQih?z?""oDVDE'_PDDQy FqwWDDX{ȈJ8.vˇr"/O|Lȶ)a mk]!:J\'`x;NMDEap"yDQˉF\OiDEDDT.Z""l#xp=}9DDDDDT.""'D_؈2I戊DQ{~FJeSG4 tr,n-s\ QyuV{䨹١dUc- $i%M^}V^H <ڈէDV"""""""""""ڈ:_4DR$DB9D\Ow""DE^mM[="`V4vhv>b+K`E;`$8H?b+ 'E0ho ފ9q?b&E$E a<.=t(!&7ޖjJOK΄dbJއ|$y.=O=>鏐];+VWc d7Nޠ[\Ƈ>"FOn+N?̈/"B{ DWt;jZ3DDDXԑVPNr'舺M<2S5< dF6HXNiDE.%eDQ"""_wӒ"(ˉw""eDVO4DTDEB@戊2}/dP9"\ڈDDDV=Ȉ.'9q(/"fvJn~OiT^Ds:"+KIݧDEgA}>DV""h1"*h;""""O؈j""~DO>DT>""CZ}`r"(ވDDDQj"(P9>DQ8io}=(~DVq>Јme: _" ,wBE;cvtm "+ DDDEip$DQDEj"""($hHD^O""/lݿ?edN8]{Gγƹ%H:D-{tgӒi5dC?ۢe6ަkeDc7ʅMV)%1_7ZI s/K[GcYcKXƴֵI$I$Iʉ~^}y.Қ}}t{4=|Ɩ)k-q^?-ߴ~kG[z[/6\zj;pgwBsFZG1""'SϚ"+ };F[""Ǘ/G?҈$DDDQ=4DQ4DQwp""pvw"^>DV02>DV{rDEśu4-q[sRS9#Axh{C\pR"*4DV{QF=}NH.'܈DDDDDT$h/DEb"""+K""̈Z5DEvt=箝dzCqDEihꈊT1zDf{y""7dG(}@o'^Nr"(QwM~Bx=DXӴz;'^N3QaIRNxsDETؚ49ǀs׽]]U3XۨjGAQiԁSljrDEMSώ"&~DZD:gDZL?_$qqѯo?ǻzQC]Mgܢ{9}IR@<ΜQK #?biY}8a_"j'~DZۧ=;NܴI$>fF ɣ?DPbp7'-F8иzrV4LJiEƗ_O΢s9}K~@E\yI2t}4 M`;~^|qiYN<~Ҵ Y`n=Ix}>Be N?2,O?TԞ^{-2jzEw;9iպY?iiğWi:w~YNCM>5'8:It[R{>Y CN{y5M>~ ,g#o.C!˨}?"'Rt_ 媦vi}A=rrr8A5}g?J*GOj{pN:"y}{F}ww"C^~&(~Ή(;Z G/OͪuEvpb+P'?0E$:_H*{ԭ';e+gX`*ok+!vQȢtgRxWUZ^Jv߳x"t ?UԬ?U:}CygUp>³c=`"’-xr=W%ERŮrE$of۪iX~ ,Gů >R9G/|siox;y֋Xyqs~GZUF4$>+#kSzQ`>>cN:ޥ];GZSۯE$ZTN:nMGjP'apZ)wiE}?J5֥ <;>TkXC}= EC1qQi}*9{%N\B^{L| ӼصhfЎ?O4Z\$k[~Zd@B֢< _VˏV){F;KQB8zQO5}N E1CҨT$jEy</""y2j*('y""""""""""*uC/=%nZʈy""! sDEwh.܈2}]ȈDDDEwP9"C{}>QA4 xZ\sZ){I?*&ӷ)[{wЪgQz+Z[ߦ';'"z{Qi5wQNCڋD?贙$I"s>=ЋL}5EwzZDNϏfw};`I(h?OYR-.z5Z9~tZ<XNk2)@-:Z|u#pWO$Zl Q؊G}hj.Mwb"+ ?GDQ?b"#%s9;QgZ@-{Z\OoezOr"(DEDDDDVˏ܈2IOԈN~"ֽk5hZuxD^yya6ރ+JǾJT kt7]1E'"*""""""""""\O؈|ϩz\HD_.DEg?IDE gB"+?*"(ˉȈ3x ?cRʞ{:pf҈b"ڈ4DDDT.Er"+QX_.?wDE$DEDDT$h/'"eD^bUFjI/5rxi:@ORzWTL=8/=ޡ `cbhDlqs#-Ο$5[}c;D=oDEiy>DDDVˏ܈2I櫡>ˆP9GDZ?q;za<2Rq9\}Wz>]Iz4UwqVIU@+"UW;f@y~R);=g_f >S9xyRo4TEr""""*k";܊AoS6?]"9"f4rA,l)XFG$r4{N{I*ZCHsH A((*nVYGYM#ᨥlOcAk ꋦY-.+}UuU[&vZw;ާs5#CHwՊvFJ?x⾂d}|QGtDTDVu""9"ڈ4DDDVϏ.ݜ;"+zzQZX;"(iFh-w""DTDD#TDVt7>D['qNE ':TTCNxi/8"")xȈ$eP9DQˇވDDDV($hDQ"""ɢ[)䫮,u=k5y kAsyPZulZWlErwE= /1t4^G!efp'){v-u[*)0{4%W6{wTx^-i`{kI`響:ҹ5!,5:vDVˇ܊(t~=#*O""xЈz>Јz>Јz>ЈέUnvW/¦ cO[MC>tw[ޛu(ůw{!eCmVv,˨h֏ 8kG̗;OxIv}؈tӊ"(N䈊2ysDQG4DQj~ob",wyNhDDDE>DQ<FYЈ'h.'Z񜂶꧁Š)^fD[L\~DQO2H"(DEb"""""""+ ($hHF^O.DEb".K렋1ͤB [;xrsi=::*6Hg裘k,X,#V\+e ޴-^K3ZXƑ O4D@H䈊fDE!y#܈DSGoDEyx"_t=N=(sh9DEѷŒSq#CQgkJ>]~C""<|~DW4>DWDEwYnp: tױ ^׋};::t:8 ΞӻQވFT{zd^z\t}ǴDE_;Wj" GA舯{5DDɿgDEa^:QY:p }h>?oDXϨ'$jVO8ȈtFvODE Ј'3~Ԣ"7׊I dni׮FԈjIPO??~DXRUvtBN^}C҈OiUk=ɪkǸrDZDDwz>Qir~䈋Lr{x}"eaEBt0$٪Ӏ6m5"cy`Q--RX4ZQϙhh3(N;hܭsGhSI<G|Qk > gFyS-t$p:w"ύhtԞC9q+Emu?"c {(\}KJngpq+K`rF}Y}4~ZDӒOQdi:7L~xOE\tO2U}MEPOoE!ծvQF'k5srպkJӥ7W<<;=d=uHV5SԵztE9<{Ϩ-.Z83RO^@͎>ן_w?\O_iqEN#WvWaV~r _Qf'Gӿ==Ո.gE;`}=eQb>ߨz}?Ggj=~?XPӳEBOzΟvi}ڢAOݢWC[XΪ׼=:NSqh5.nr*^B?gr:r?z+;Ms=[ZaogК{ xs~Q>aMHK}8k}ȭ0ڔ;=G:KGۯފ1ǻ^=oHڭ;Ѣ,)a׈qj?)UYWv_ߢ,7@;vWQeWX~OUeߨ=ګOoe~\tk˘aNI$w?IwyʎZ=G:|Gv8z,]׏ohxUˈoooWA9M.zGOrWs SԹz5E>2A;uTN^V9Cӹ+R=\iAZUG=x~Z|k١{BuŜ{wZ5~QUr-:H:ǰׯowZ3iFI< p?M?8@=NHOaTZlZ3ӘEQ*FN+Tnz`p$XWڵXfN>J?hj.'O?EK3#Nڵ'O+KhSs(Z\s:zEC-6FhNOtN<4z~pQØ7jk_M} UREDUDDT.""@V*=%"I$h.܊=}ȣ.'܊2}]ȭEj[DDVˉFI<"*"" s(/'/QDI<Q9"ڈgQZtQLDZ\k>S =}<QH5v4w(y}=S"u'GisE3"&p?R-p5}$~ށpEO>~R="Ѧ]@?NvNXҊTZD:>U?j-zuJjyz=~Zs̸;E>NH&8"q(j=:vdzJ+?)EUuGyUtQ|X?oEj(Wow:'~dN}EW{?"(hI?Vr+/~Ί2{O"TyVï؊VwVG0f?8؊'ݧ!Cj8#^c_\uvHӿ?z'!ǹ=:5B,Zxk vN՚鮽?M(Y.htRGPlUtqiE8j׀cQB=8;ԀxzbϷ"ahN8,w uc -8EG OcN:?0G!ӱ9iWwjOOghj0A=8"sG#;q'aC,Wx@EO}_c=yx}8z(jq Ә=ޏXXb>=hi}E?G -v uC=ڃNHHdN̊KO"Ԛ)/Er)po_˵Lo:I({xXtDE(>>""=N")/{Qd6_""xp?z"-.3"x =cn~;!(?"'H_o"K?XDCP A?X}Q"烈|}9~pSݧ "(m~DT3i}zʈ8DE'zݯDE_^DE ӑO3'_҈7wڈ2~Qqпj*cվ,CQQ'ڨ.ڻ̊*DEj"(˻ϵ}($d==}Ȉ.'戊h'uܽDYE"+QZ^ވ22"+QZ^"y""""(ȈDE0^ZvnhY՗ft2p[S%3tmFL][)y湎s5qkZ湧G5:GDDDT.""W;gәDEp`ȈDEawOb"('"+ DEߧypj"+@'DE gGb",K,s5x ^sdz**LHXG6{H#Qb"" sDE~}.{D\O?b"*""""ڈ4DDDDDDDV(.'z%%!.lt0{Sq>phi[T?cWͷsh< $/Dsu^{^IE`XkW_kV7,Z4鑚;E OW0rhyJ+Q\""""""*O DE#ck?N( Q^Z^ފ}̊"y;H [;8lsRtWuTfpnkOK07wе}C$;ݕnsy[d"~{xV|[iihw]1tnh|@ eXF9#qdsOiEoV84Ȃ5z_@5w:*; -=u e4&OMS%<25p:9Ue"""""""""IP44DEgF%-ވ-qtuzK[ Egw^*)/_b". DEwP~DQDDDEaxȈ$eP9DQˇވDDDV($hDQ"""_r"(ˉw""eDQO4D\3ޯtm>?Vt}Qvqgh=a.SC}ZZ=}@~dDT-hODEaӳ]=(Z""CS"dq}[QFFz[; 2"*t?:"+ӆ_e\DEoCON a^çժ"(xDENw""ouap騶BMƚ@A?o 5DEdDDDQ{QGωDDDEB9;QD\O""r""yDTDEB@QF^O.z".kۏ?&5C}! ?TyN?~忟}?ߦ-EC0?r'?J/5729a&A @#Pbs^GMx[tRq ʾ~=MᘼMƫKĚ)nu?A7ui@[enEB戊h?W"v~DDTDEB@戊2ypDX܈2?:"(~H@<F^Oj"(\\9EϟDQw{mL%8HC&5?΅RDEՂ}]NhDDDEw|DDDDDDDV=Ȉ.'F_DE""".7KyÒBe\]2HQ\r:G0KbYPѾ7ߘxHp?f͆vJ{QCjূ>.{j$&IϚy\$s8kGDE0 DETDWϏQI4TDUkLވDW5Q܈@}Έ6PHՑz>>DZqQ䈊A'Q"+ĝDWѯ؈=w~tDWu~DUzx"n<\1ZKeKM)LֻZwfU چVV]tЎ5$EFTtr")% 8~"*A#sDEsjӻ""'ܹ""~DQ=zZ8w 4EQ宾~DU8N?r4PGoR߉?>Ј'zFt>ﴟoNR"-~=v{a}^=|NzQ`IWu==-VPϿQiø~B"-2jyr(j}?Yixju:Ƿ܈L"6y_gbO(>ҋPcrv>%h? o"@LJڋJdZQ׆B@MojqEqPIԭyA}^RQި:<~J,]_h9$~|Q4 ;^\ڴ/EE!OViSM<~s[߼r GbuzQeGqvTI?Obҧb-B(uegOwvZ]~OOr-A8poOXI'K1v\x}E˽٪5 O3DYC=?N)u.:"bïaw{;BҦs;QewG`TQuXO5= zb@H<5n=I׏"9, *SaVw8 *ϨASy8@Kg VuӗyrE3`>󒇇7i4v,gJO7YӪVMuP@T:.CBQ:pܽCة~D㯴dVI<>5'*U8}}}1,} QGD-Eiwu#*8ȢtO8{~4Up?ޯmKx?:(dsg.G/T<ԭ4w?Q> O6)D}z,Ia}+;fG'}d;]=;G0GG%k˼z"Ò9zA;ڋX58 GoWs~gG?a;ߡE$:8~uPO!Z3ipz5" GcUR8}qZuAUz,%G/aq+V?ooe>[ˈZS˱Ïj]AOίcRaM8b=iZt<ӵ^WkNӱsNOεX'-#4<+KX`@s# >\kZ3G*5#}~JjLAz@ZTԋ\Xc?M}a^ið\^;iSEg?r-bm;x}ޟ΋J>~ y~nC2-9V=V=aHC~B-2FHhSk0JHe>B9;U Eb@Qj"""""""""*2̢\>QˇފV""""/b=}t" 2}]NhDDDEw|DDDT.Er"+QX^.'DE$(F{yw ,G~m^ ;/Id$~Rִx"'<~~Y-oEmIIvSr,kW\xpoQh}PI׷NHk5>=:}sR='i'R-&j̑PǷ<ϫ5I:t::܊淆ZӡwB-:I$wDd{=CrEwPC˩E-@5Q 4wZdEA}FD"1 >ȱ8"iS"Iޞ|Q\@{t,g鮯 x:jGu[x}#+>QkON?/OtNНft"`kQS̊2FVqqEsj<&ԎxwvEo;QVGx8;_ΊQT}QFRLʦp柰}a.a'S*IGs>Ί2?*,Uw9}0<5Ȳ;]"_W"d~4n} h '٣rEjqTpӡ9"s8~g/q'^?oGGAB-F 4F{GffW]}qQnVN߫QcIEF}NEcQj0OsER3QjHyvJ,9GW'vZht׏?X\9Zu;}(e ~7C=O6q׿(gnB{>Fu ڋRBh}^‘R{G?΋^~O;ƣ^"ᓑĐq=E'a~.ȳdFKt.~e6Qxwz"+<}=l:O~HlP}^&qz}hc'-=_DE5hZA#VNZ:q\On(DE(w@_舊d}`z>҈M2"*`2_"X ^?Oj"(?pwFe}g_̈7?:"(Qi'܈ӓ4""'DE >ЈpPDE>҈?&ٿOO(}vusnVIU:&4k"hNq""DVuJ"*u2"+ DEx"""zIw")gCY8DE\eZ~dDQDDDEB@戊'8Wr"+QDrDE]O6/©-dߔtEKyЉ Ϧǭt5uMIWI4T1>z^c )bi4(҈zIˀDEip܈"y;T4Wz") /"="3؈>F\OogmҘ?·qYwOb"('"*"" sDEy</""y""""""*ڈ"}/~6zc>/:!EȻ .]-5ufg@jusMN({QrZӗX EoC?"\>N5GEb'C?""zJ"('"*""4DV؈xaJVި<$Zh80QT~Z\OwWtEj+;ϱt?E Ȝ=?_E A^*2 X_>^~XI<+EEPyTE `ʠ"\~z3؊`|HE׭<(c2#oIѐV96hǝO}@xBI[z=K/!]ɫubOQ&VZQs5kIƙ4pKGyz&DG ~H~DWvkh~TDQ؈DV""""IDE$DEDDT$hsdY]*l<5OTkOqmQP; ""çv(2j"+ '"*""""""IDEq?qw`0DE>ˆNx"@DEj"""+\H5DE^:DEDDDDQ wDQ"éE M=Z{ѬuIDE$DEDDT$h/"zF\O/"mU4VHHYxv\.|z9E-eSi tB<3\1[mmeEQf-j~)ck4y:14V*K}PIIK x"&4CXƁlj[-s縗9Ĺ$I>|/kqޫ'ݮ7}K笮5 BNb}Z}uiވ,#ZDU$e"+ =>k緊+ gWxz9(1=zފ#zzOFwu9qJ*".uνÃ[ $NӟQ3N>U "(yNX-~DEsivT-iZ{(Ȉ k̊vCZ8E *,Ⲝr Dtx:=\!S76ƅյ?v[:C1u?C^I/k|=<-T"{FGӽ3Ɯy}H#P~DQȈ-DEiވ7;NϯDXgv]#Q̏R".n.thvzWRޘiHzD\R9q?b"('"*"""""" sDEy</dP9"G U.SWAI$DW"">ΈDDDDDDWψQJDDDE#^IMu:p(%+y5Ӱ馈I'" $r(DWa~""H?h䈊P9b"*<""ڈhn|:<6׉c[`'Glh 3bD_$߯-Tݲ+u+dwjj5<i-ztù.5:^xꈊ;hR{}舟O"tЄDW "GoN>XjY>DVП"+|q =wDEӖ}9(u`45@I<=@rΈ}FAݮ4DXSZ",Y+;w"k.Q$Cvi:\~D\mU_-LϚB:uCZ91%SG`5DE%gqwd~tDX2Uz~aIUtDZtGp>#ԈMA%O{``KP;Oǟ!ٮj7}gTDXNqw4DU`>QOE>BSQ!s}A\l.:CզO(h}jyzZ LƿN~ҋShO3wv v-iy}?؋PtV~g~tZQTZ DkEFt=xi˧9܋Phj'E.;-E~ qzV<>ҋ.(9vq=>~ťO8NZQk >g<\~ҴYIj hiӻzgS?Ҵe/׉k;NMO܋.8rUZ\:}%j4i<i-j5 OZqV^Z\i'Wkǎ_uE֓*}v->I~?_EQ=QEMSo[d~i?P<ϨsZd<>N"#OS=y'q㮃"}JryX߬sE;bqV.'  οo9rE;`_@V7srE;`=˯#ݺ 4 tSP9V8QY]49O%S@곧?~ :Sw:#pΩz>УЊ'Sɟ_O5OЋ)gzqR >B+ 7q>tUoR6Gݪ(_h<~9E]ABc?3׳M=pUY v>XӼqEʮZ>Heӎ==9j#+1 Twc9j{ϱWP88ju~*̬)!R?A'ÿҝE:]jbQˇ޴!QN-üwg^~Z"]:;^tCiC̴j;Gr޵SGw٠o?AW-b =qׁQjJXGv#E> 㷰Z }GZ\.T.+ZpG>ˉX馿>jLA 2jB~JZ]@أZdbBՠ_t׹LDZdi?@GQhus:g?/}=i?ziH:?='j=QQϏ٧h(kB-zpRwp圸Oark̟䏴{8#SZtzӇ-ZuqӏDɾHz9P/Z)9;iJ];oXrNȁDE%A:w+IE%SA^v}|L#$}}N;z(kѧ/Z,'Uss=^|]<7$PiNØhpP@xG8;WB}=\FeZKGvM_Ί΁~R*|Caȝ"G۩K<u!noWj)(ڊE;fvpEaJڡ{=>Y8ES8hci,=ǗԊ=#|u$i.9"ᾣEɃ?_TXlsV;xQ%jpUk'_O-=vzcQ!x]x|h᧼9W~j<ΚߦQC Ӈo-{kkח==7FvOQGnQj~9h($*yӏ"{x}")5};Qc9p?Et:tXgiESxvvuEᮼ4Z25w) kvX~kr Qc=vXEi=HZiy ~×b-=G yUগP8}}Ћ0y~dZONDS Gi""'NDWBNy{Qf1}]ڢ"S:^#ڈR{F舎-np?/DZ CL_QGڈ>ѧ(&(GרȈ䈊9=ӻQS`DE_""}""O2oDEoDVp?@y8n&qu?sΈ#9҈2ypj"+Ty""s{(7+Zc|dj1#8".ڟgOHu1k<SOu᫙kiDEQF_DE"""+K}9""Wr"+Q "(DDDEipDQsDEj".ld]`tu$I~]{Vͽ +gxGֈKckzZ#ݤngUGb.ajWLQ DEq>DDDQ9O*{3̊GEoX({)i䥨vH%d:c:iϨU ó]kži*[U eox=о6ctŷ\CQQ_m{##FIx:FvX@Y+P9"/DE^OЈQX_DEf=Q]@z @~8"Ɗ;/:I5ʈ_ ꈋE%<3z%I"2DǴbDPˏQFI<Q "(DEb"""+ $he䈊DDDVDEq>4DV"""ڈ>|J"""*ڈ"}/""yD\sv :G]ND֎: DEB֎d>DQ"""""IDE$DEDDDDTw`DD `'էTDVt7?d4r$_EDV""""Ń?b"(D=d""-4_},(HnM)@oGVQX_.?wDE$DEDDT$h/'/""y""+HFƹH汌cKkAstq% Nq$dRO< 1Y(I$!H J/GwfLM/ZM5ip񼃡!ҹf\W9,'V9kNjo?f46n-LڙcbtT$h:75Oz S2&\ojӃ>GaQExyJc"9>QZZEpx*0,=~W%agq4Ӛ"aP9*02ypB+KaEb+ =>Ӱ9÷=\O?b+|>(1zpȹ4+΁MXGF{9 Xb8}r-^{+|>QF]ߨcTTw}~PyB5#QQOTDTէDQDQ̟X::O|-k8zbD-e言t%4pHn4`~erZ9q?b"('"*""+ǠDP_GӚ"*jt"9h}Hqw#戊DV9/""ڎ\~>hjᠤwLKQ)D,sjNUkY*%xP+˺`:@DEȈDDDDDDĢ"ڈ4DDDVrDEq>DV"""ڈ$@k7 eM_MM]KvX-&1k:jJ ZZ Zz *x)(ኚ&OKKM Y ==<, dlhk@<tFI X΍B?AQkG"?1DEgQ(=_H$=DWb")؈. OdlwEP#n~GuQ89&[4%x>7H8DEڂyO^dxsDEڰ9xDR }CA:DOߡ@P>"*U""t:v}DD+_X(92Qh3PiDQ:Ǘ/""|;>DP4Q@ꦎNy"Œpeh fIA".<2}#yxIl@tt;"-%oqvu>@DE{O5DEߧQ`V;DDZt}CڈJu4(MKש"->Zp<"tqԓQXprDE4M.=oωc΃Ni2؋=׏KH{O/΋T=YמPE?/4Z`pӐ~CNwZk_ҋ>&:yz9S71Z1rhx( gjLhNǻNZ,O3YѴ\5-"itz-R(.'(~W~V<ދ68:}*5+Hmj)EFMQպ?{Z$jIӯ>"cg!B]IO"YzG?܋:(Б IVŐR!ڬ';]=A:AȞǰ"cu}_[~C}+Im :^WsQe2txIVV,juT {nr9-.jhG4$}I$V-A:~_YMo .]PKן2") <ެ$kJ59iI=樴jtE? s+Od6zO3X^{~?Oo`qVO2]PˀӷrEO5t8(?ax9S [3NdJ(%Mu@~V|C{ЊN}Zʊϊȟ;?:'dPq_ B(v̏WE͟<(O*Ȭ8s4?E$ @zUزw˗E$Dq#ÁVlu\~~_5?I=*B*Z}Q`9}>PHȄXό^54wa1매~UwaITYTVO5259q U'{TX2E>HR V)ӏҋN8~wդwC+Qmto=f$\xzt;[A5#;Zl ~pSGgZ=F5P}~dZ{ٯZAjKGkO>axN-A~z9A6qTḓ*H$x(p?Ե&?Bc^N^bЀO ~_֋J-5~U' x-juHEm<ӘW-buЃ}Pt:M/!UzJҧqT5ZiWТ.'h>=i~ߥkr:>JHy('֣~=BFQR==OJ=ߣڋ \DDDDDDEaxr~QO4QO4TEDDDDDT$h/'Zˀ[QȈDDDEa~ߥdP9"\ڈDDDVˉFI< jVE&>Y IhJMzd1Ef{uwEhWR\y^|}HݯNZELLJӷҊV EtEz-&WOE+Ho..Ӗ"jf^^J)XyG2{-"G'z)H׏Ӈ'ȴ*5~dWRO`pȴ:;jtEOj,Z%EFԟ{;oW>7QhLOu׳g?IEQu$sw}S'wAaiU=ަ7zj-JWV2zZ5-7<0@HE{O"VۅI麿PMϥtMxJ,WJI$ZE^UhwCU>TNװOFEQҊThY0>VȣsI<Q\ڂ?EgE#j]߯Ei`􏧥<}Y{b,UO-#ߙc*C><}Q˂,ï1EaiewS9{tE ~Y=e/oj,g @w?N(-#ދR<wӚ(9sNHiТs\UI }mO(dhgEE6huZO1(h?jNAxwh(z"5CˇIi(\uZ#_B,g7NV?ḾP=z=}ޔZjx8tP:G=!kZ\<ցs-Z7?Vzb-*t?,n휷@+mHvM7.<_ШH^K# $cts^湤q(߮g!^k4r`J,9s?M//ICEU${Qc̋\N}8z-~ 5Ð {=jIg-W5ͧuel.zXy=- $=7m^+ !M=|NN%Fѯ Al\l_lajxj(:]UMO  Ԗǂ".Ԟ:DE{\{e6VhODEwoO^$_BaO I<ΡI I:N6)wI*sĐHZS `=6a|zr6X8C)P'dE3LrG,oila{4 ADE?_̈T҈}Xj@$eXj5"ȣUrTUTؠu=5.$S?Y6 QQ[V Rz82Ƽ0TLG`?DE-i0<٧U'Tr8 HTGsu>uEYh\!0Uc7Z8p|r05ÃA7?:"+>^_w$DXǸi#'Ј7J3sCZ8GI%8c;KV+[#-loL=!GEۋxO]gYʶT>(1M,Fo-6XĤYo؈nSKj$Hwik鑣QI#Q" "*""""""IDEq< jdB=j4jX_9{kӯ؈EjI<)Z5\5VNr",>|J"+KDQO4DTDDDEձ=Զ =0{1xTP9ߪ%1%"#۪-Z 'HDV""""\O؈_* ]"A45o8jyJJ>Nn?VYp{,|"!ʩ_D0pdD $뮄\>ҴEП ߧԈ\G7iD }H2;'שO ߧԊ>}7"j{ϴx^>V9sQTG ]|[u3xC!1:pO E_~[}![j^Tc^j)zȶ EUh~r]4\<+^}9q"ITOj4@Ey>WWe+ck<2+U`9q$c[-5'hgGл]/{n-Ef~8=8אr`*4 +C`THШ\?b"xD\Ow"*uGըWӪ"*uX_.?wDNw2I戩>Ҩ*5=ڣ/'QX9q?b"('"*"" sDE`9""WS}S}Z\5=Tez̭DNw""Y-۷_N%?V.9io$D>kĻ(' "'>bnv*OD8?Waރ2"P }OW]y*t;h般:i?DEoD[.}{:i)]_#KckZ 5В@" &[_]7O<\u,CǀwQLe$LrZxdN%Tq4saoXhCMy"{"(o`өDEh']Oq}X{b"-^Ïܲ;d!ͫ#lOFxpq$ jl^ Zu0o 9loR9M,)#qdӡkAcTDV7DQ;Y;ξD]w:J~eY[[-AK <:-iDַ: AoqQZXTez}_Cj8_DϊFDytZ}wj(Ea`yج,p: óF^O.VE@O>R+NR=汍5sKGJ+zvRRR0ͥÄ1=@s"ӽ-r(A<Ob*t7>TDcD }Hx^>OO.#ziWY mƠu8CW0t?@xOORF=9-w6;BLmE!s*nph;B//W"T$hq=%ވ\""dFqDEu4"y"{=NQQN>D\GhMu]m+Xxk"."""""""\~DQO2֗ւ8tĒQwnEWAOw Yjlc#h"{Agog6wja4êMz/^Y꾒H_jA_%|bMAh4%9æXFEZ\"yI 5OI%>G_M+M;\%fr1tSxpuPD^{ p;"+zƺ}]).Z"+:>D_51vY(5l(i[{cs'])tm\wh#NQ3DD8>DO#fꈊF>CuDEڎ}\HDE(ӇV?qDEkKp55PTQ^*AᮃӮz"*4 x""|Y"֞""]{DPz?DQ|}J",wU uOhDEc_DXΪ;>DD[3$4Sx֡=ƑY};Ql7jx}Z""uHp(dzވZǿawi+o~aIW߳""tqJ"+P9DQˇވn~_ҋR;O?( Y9!Y:r=*J_ IПggPo9jQGq*u:]"agg?**e=c7q'Az= 5ZjI'uE 5О=OJNF]I'zAZ{(>{~FOӪ,7J <ӂѧMxY0+5Q?**&'}H?IQ#^=izh<3jG4WZL'_W`q?֭}ukOjP=xV׼i2|q@?)V-.i"iK'NP~g+HAE8sωVi'}kJ^|wz,FN4 ,)fq#gәE=GV2j|txE>~Ҩ\?b%>ʋ1 8m? Qw6J'C_Z-j2/˭e#2:9|Cyw5X9ZUZK=M%\.蚖)"v dv]b>Z}Td-}+I'Sx:]R7ϖj;wh@ꦍx_^5ӏ_EƷdT4t_b(0z=с}|>Oa0̓̊'S\9^E+jtx.#@8?2)R'˞?:we29}ЊweHʢ$kOzvW޵HjyqzU#^^#qr(;Wls$bטꄁjTrН>Q`IÏhWu 5^"&AQqi Tn@VZls rAӗ-x̵jyѮ<y{e֗O>;i3PxqTSݢᗤڋL-A?B@sGHYB>ߧ4ZT8*k.q􏧥,EǤNqEM%_C5^+z5T|~+xS5ڏHj%Ђ?GzpAM=_5W-b4 N*"}hӷ@{H:~.{M/!ګV;Iˏ#^Oߨ _P;{ty4~]["g]{t}ॗOr(ٙ> Z/p?q9Z[2StEڝ[[򌶲ŎUi%8wSUok{ \ֵufOW<_4Q(j: EƞQ%PvceM :x + 9e}+43qn~q>QK\"asqdis{ s<;G\&E""""! sDEwhH>l^VYnU.btS=MUWT5Zyk$lp&y.Z$deyR#Cnjt?b_CetgOӧuqS,O{~\ ܨDEip܈"yQeDQ"""pEr"+Q\ѩh#DY @H{d7Ng?)j5vw"WިQ\ѩq(:GH=q%CF9*=zhrROy<;}CS.ТC?J-Y::?R,4"Ҫ& >yP"jflj׏oRFǿ~rG{kqӷdZUD;oJ.\pjmV]i&GN"2$tg` t]J-uӏۧ`ҋ@q]M#} KA^`%MGI&N }{{j- ڿ3B-.yA':}8R?O@>*y˿ފ#7{}Gh(J4\G$zY;Ϸ"gpȩ~WF;qEc%DNH`HAОx%xzwv""*:)k-)dy|MԾH8tĴVQq`妞b)S@O1XY}eG8;~Yԑo>E%~ϊZ(!s$kN]P9#tQjէ= H1k4!ZA(' G ,igEC(p]ӿr(_uHEA1GCOrvQP~ -vqО|>wDXnZirӆ>j@'ұ% /SInhMM)ti$2kϨVxsZ4?gv4>Eie=wȢxТb/oU+65mj_T2RGb>ED݀P(Er".f=Ύ]+*dUq 1VDEb"*G"7Ot?Z"'Oo)DEMEK߉KKI#5d=D\tCI>u+x-Bّ[lmSexi "tgyꈋ"""5Ȉ?|V=8lն^J#s!ZAcuz^G#Ĉ}]~D\6؅-@eSIt] _xr".}CBg=_""ۯ~tDQ:}8q>y"t z∋+y\6i.@?]P (]z_zcDEwk`ugbw">ݞA'#ЈSwDTo=:""{QXI<d**VwѫZQrQ@;[bWSI XK 쑣^x{lIO{GDE""OӽeDV"""vfH4{zu>G7" "-* ji%Mt0@?״i"-oDE"""""+\8s?r"(v6[9c(/q8Yry%Pl'8hIs _D|qU4W^/[dsꭆf }ccsHDE.;U]-UtKOP֖6]|) qa%nG4N"CDB=%D\xzQhDELQSO4ttx&=,-y(ĐP^:Wcwn"?dI Bɢst1:CF]~j"*""E:hOՎMogHc5vD[4ڈI戊vsKV 1F٫kjKѽű>I-!$ٮ v*)|ty|Xedkᙝ`ui"-\ODEj"""(DDDEB9nŽS_Z̢Zj-DvisFM(9ٖYV[Mtt \)k#KSO,!"Asz5!4$E2*rutx􁚓=Kkjwwr^D sX·..>gk8?ĵ'w"Ap>"ytGQ>̊>̊2ypj'A}"%fcxM l 7QW/"@(tm1Zʈee%Qk@8#zGiUoEN?w܊-ފX\ MRNux5y=-U'.u ^>w}=D'~ hz1Ek=-J6451By$OhU؋U 'v"ůCDNa k9HEp/TRIotn9k"\{x}Īگ h"+:?*My"pxa@W͏ѧEj0Oӹt=z}HJٷE5ʦSF<*c[z,2IӤExgľ׾WX&`:D<5ź4 O܊@4.*-7?ƨufh[#= 냇6/Cw^nh=Z/b|oqα _^WD|H]=Rϩ#䎖^w\RuDDDDDDDDDD[\u຦p~ q1ฒ:4EN=A1ۆ9rqZ :wMpcK@!!Sh Sv~uR+z`Ob\ڈ[<(G[c5*)-8rTS\I1Qp xdpkurk0A,BzMK[w$8ВCA ͼ54ܥlzЈz>еrs4;Dl}ecqdELTNC m$ <$H'[:,w۝,pTOG1KƊf4dpk>Ԋgu}oT.:ϣ"}:ϣD>"uGՅr~D>'"uGmYxZn1RSDo\<1Nq c@ւOgu_l zKU3KN [x :yE^/CӚ"u7}vaXo[sGo|gI>F22x1K#Xt:hлIH(ڍ8gFW 4uDuC^:ꈪ͸x1[c6#UFBC'2;hZNԓ$EΈ~tDQG OWR9gQz;OhG0B"[OF'x}{e͉ڣcCgV[殍8 9dzq[ӣWaT>"*;ǵtpX c)|uѳcWFVE1{Z?"}\:"+zȈXtDQA>?ΓtD]ٛ#)1ٯU+1nTO0266B?XD\xvWQY{X~R".o5 MW:`][DE< b.v(wߑg__gDE a=OТ"޿#DEgAWC,(D8=֮N֟R2l4D\>gqw[ydUWk=驪"tN"h%hM'"*"" sDE~}a1|p)%KK`54OBÜUuMv興uvmᠡdmiE% ̒;P|PLkuT/ 5};\EiȬ a]9&Q +oa`tW]hk#ʯ`жXV8c5Ho{J\5U"&I; :0[Ct zF\O5Mn=q 199*kVU`;L]TD^O4DTDE>bqk\Mu|WChDr2Q=p_ "/5ˉDW3CMM Ayx(a0,pkZK""{J|\]Ks0&φ٩VS T+szz~hkvDRn=٭ڭԭ<0>wiҸt""ՃY-hƹݮ2ze{HQq_wtDRDDNcCMuDE@DE<1IQ4P:FD5_YDET$5=^Ɵ>D[v-EC*蛧8$#H#:DY興DE^{}DEB@戋p۱˅0oz4h֞u 5ۦZ$Jy,N{uCG=~uoͷẋo$E,?ܫfIDEyܯR˵_wHIrGk=Lq%{ ?2")xDE_Nӡ҈ç`uDExwi5DE{o2jSKpk mC K8k$k̝m`lwCU-]){+%.lu(F8װ HgN5ވ>hDEKAG{H B"!kJ"(]XOvJ"(Pϟa0[^%YMNX>*m-$6uxl|3ΌcFВ@"ܽ6΢:[ ɲƄ!3Ag)`c^5> ".^o2O!->`N/<860u=Qqd/s\8\I:wDX=z}H$?3>kX/z ~5bnRxTFMQUU7K*jhcs@s5qkIrlWxo5գŊ*#< CPƗR! l'!kuoQpB"($h"<<4ZeTǿދ6-\u;oШ+Zu}__EH}*y~`E-W ;} OVA1Z:@ѮRyZ s?M@ENk )m_Tj)baH&8I.ABzHEQ3~$[zS˴!5#>~ΧQ'`<"aj5{;zѪ%`-AѠ j}4οj-B&r??֨OQ+DpECw>x CG;j14=;O}+Ht4ϼ-}5cOsٯgvh|VW|tBIh>n;P to!a׉?_Gm5h?U vܱX+mu.IFHjb. q푚z\5V-*i"Ǧt `xp4}}-'>,퍡;]U8.޴$'>,B˧%FI%`M8on@e v}8EOSgG}2oZL=?0Eϧ֛$qw͟r쩬F&irUG -#Ix=$ӗދS65cccֱhhk@ cZ89"Nnp.'<& o?K%t5dt-Yp$M>HFuR_Q:yZcIx a@yBώm?T;L8d8j"UUUJREuH4I>O@xg>ꂋ/vvQ-7U|;+e-HPO(qt E=fQVѤwiE:riюGzZ2:~ G@$l5~ Z5ק]Y# ^$k[P=(x⼎ܬF\4cG < 'e tyеy; ~@F0RkTN?qQhǡ#֪U)uHAjd^߱;;t?Qk:iR7vOQkcr-ɷy}SK: o.y=ZߡUjԲjgyN{ױ 41SAp LlqC M (h dq5y`>""lĩ+"*#d[gmHj--.Stlq5n] VM#EB5/ (X^.'DE$(2jjʚzJv'*h9ilQz\Oy+Gñ&1lcYIfFcz$ϕ+=4;>j,掖?ƪ@-aF^O.DEb"""+ DE$DEDDT$h/ח""_"ӧzJğgE?@~ЊVt=]zmyy"E~aGZub)LDvwsDh;Qi3'Eѯ֋BGi'OB,OEL'^Oy"Ъf{;>Ίv}Cۯw>Z.$kw}Z:Gȴʉ@v~NR7^C{H9uO[?X\7 MD.h)cc'`ЋAn5p~mmîe-:ZԘ L8H4-*iA5'yky`Emqw;EO9q ?wyE(4Zd~z)E8йFi?g"׋ ׃GSirJ_<^ (k4I=9Qjy[Mu8k)26޳-n-I<b.4A9Op9Ow~W4fyXOǙ$vsދo6r2 R5hu8u+k~>OQia_DX秫DXϪҊ?BQ2y܊QU?oE*i+h{Y%X#Cqlz +Wߧߪ-AEitgTSw$FO6WiY-]jQp+Eʠ{t= (H}貙3OϽM;9̊#wAE;zvr(st_Z,تsr(w׆H~;u=H}ڊήqsE>#aEpkuU92xezX 7Sk$Z=Fzys]mM= 42*xX_#xh7w E6hui}W'SQ1oOEBG ,7}>Z,;Ϫ,w3'3[]E-b7h{?A豥kDZ,w?ދB\4;tGb:-= 'H:OSO-\jaNϡw/9r~D][OV54PI!'òR86PqP9DQˇވDWDEݴl:hd}m4 ^oiei=D[DWu~D]zW=mM=5}Hw=U%4ls$774:8;ѧ~?:"+Oڈp?ǻODVPӻ".lciR4 GSL#qu+>ֈ31ס舸sz+Y3ENk-MuSUW֗".nhq:qx"""Ǵr".f:])\t}MČC4ٵ4""(ce\ jʁ Q1z]_]%=[-Cɰ}~zF\OggDEDDV9ݍ}QkyN/bϬxkE_lsq:H$N p"/!cwlW8s>آD:i%g 3x:-$@DEj"+IDUխ""yDTDEP;!̢"ݮlm*[lsO&e<5NDDcicm~Bm6O1YtN  h<D\vOw"VDEV-ѻL?mHr0z86@Kx%]$Hid= DZůkakHs^ mwմrSV9SZ?2#*5cCiFEY h:J꺺I=4Da#.w".[YWo=4 _ 5=x_",D\u1Ì 뫬1cys[٨Uo= '[{rK{/ޫ:`?wWi%wA?"\ܿSz]i'MI [ǵڢ**XiЃa qEوh1%ǵ49ފEysn}_M"$Iz*޾vZ+elsfVJ= hs:`WEHCox^~2x4_ӒL#O>iExhڊ-ΧW}}]ѧ}ЇIGqC`E;}}=ʒ WL\OӔ 'g+nN*Y̏{jڎS6?G".5Z)ڻ]c "\Rz)$@;5x)aJXts;Ztp෮޶/xXʆm3VQ)d.VK]OI)#HhXukƾ{Zti[&b6<lQ6DEjݬlv*kuD5sT%\ TJ&FZH%ifnm|ײj[} 5M2gJd1;M_ a.#PA$EƧ~ϹSQ=ށ۩ENW@9;ҹbs[&7p[o5TMpsadzh؛,uesX5R*OV9OhYknYYE3*)a>"g|g!-΀ hM "u}c~ub">j"'B\O؈dYy*x>C[q<Κ ]Mz95%q"'o\[UavUނ]yl:ZzJ{稚E.ute􏫏+EO+/gV=ȉ]~q<]~DD?B"'w \k1^GE\ Q`.{)"i/ӛtDO.[Zqۣ/vQA;mT_Q,.l2^ZHkէ$Ewiz[ DOߧ֢.';'V'B"*~Fd~7$j"'XzOh㕺==/hpQz.Y<ӹ7tq:9l\t(i Doz "{B\ fk}-T'S}?N}/HH\"\:yQDUw?2W>Έ' DU֬,'҈f:vQidyрͥGI 1H"4DUD-qUFzfu3wQM8+} ,qk<42j #(NV{E^ڢ=DDWu~j"S{'ވ۽l nsܩl ~ƩDEȨ1:i.u3Qb(O_OQ"+QPv}?""(] QK"dvgeG6*cBPq׏=or=}NH.'܈e+!{4biye=%tJH-l~Iux".""D ".ye,I#$*0'd_/z ".""":z<[m {.`GI4ÙL鄒timKgM0@ӓC|`ܬFV&0hr =ѓSZW{àI#[6P:>AQFA+È(-"h"\QZ^OzYaEMoo6hƝ~Hl8K a,rҡh=7G>Quz{PFXhh$忬JȤ=ڬ,#O*"Q;*T=XS>̈NzSh苰x~Wcߢ)憦f@\"2X|BŌzu!ڍ9jww?:"᜶Oz+[+H@v]@WޯTE?\uZ'YM=mџJ|=ޅX~LH.-:k'Vms`>W[} "DE yiZDE z"N=6?sRZikj`tqf]:8j5Ј{VKPg*[=WZj*j%$d<19<8"5r"(DXy?DEb"+KDP8usDEiވ;wQE4Xp2{<0I d^I)dui\8Qp~_qݽj뤉_iR?JIi<($h/'/QFI<vkʵdgwI^-v3R) xSm>&=OŅI"(y+i=C[-zjt4p:5KxUvEt,˵YOo[-WUi))kyxkZI%O#6NSR]rhdnA]ha``FxWdΈ1Ύ>:iH`uDW5žDSGhr(9hץGB(Q%c"9""2Eb::c1=F68".zQL戊PA䈈~DRχ܈DZW *8 Doi nhsAzB".v:FJ Zukki7w WGYi)f< l "G}ˎ3cZ2;Fh;=m= jjZgHiKnp=-qEa$DEDDT$hwGg")]}AΉ;O}@NUzg.(HY<j=gy(X@h=πT'@J۵2jOӷQol9W-%mTUE$tt@:4kLjOaE.a{Ok2kMުi+#5Um4Ӳc#d} ZKoUKϏ/yyk>ky- i?Yݼӂ-J]?PZ,ig4ZL(g:u$kJ-Ji~rs?֋S.W _`+ϧ-]5>{~Ph$w~e`yiq>>} ZPih53Iy[S2jVh헫ueYcK)ӹ8A (|֎YZ鮇5ڋ Z*84T3ڨk"}3 0wb1M8OZT鮧~ ѽQ[~Z褚x:z'UrtSIl'9=%hKLؚ8^iHI""a$JgMxq?""zʡ sZ<E؛ksw~uM?ԟJ)~ej%7SMQfG/ȋM'=y"짗:)lkz~>$Q}k EMVrE{;}]X^.?rs.D 驩*"3ua}a,ט55;jAϗB@準r5!Gz8,L'i?ra;;~oWȬFtqRb>-{5JˊӏׯyhQ Xw3Ǽs"8"䄷]FvZU9K'k??(Zrkbr;]Q{1QQC]%l s //=:J@X}t~PyoЮx<8JjQAs(,Z<"k-^OZdB9;Tq};V 4ztЏGEEȞzGjɮxӳisE'J'SZ~j)7Mx贉YH=Ϊ^cz z_XV9pڴM֮i~k4n$^lښXna+L6N3F-{ALJq#dաtО8ji=_w)u[Vǿ(yt#*?1WJ[dotrEnmǦTQ`q|"!xy X"֡]8VQ=㟫K/hYFbTj׏{J-&fsM~Z4GQhVoӚTp=X_=NkvxpjֲKew\mG\i*FyQV \agcO ?B^#CV2)bSRYS!=4Og#a(xqD^Lj'w53$Ŭ֙疴OH.z\:F\O/dczϨo;¦i:Z5$0P EQ^1쑌7Hk^DZ{9sN,ypB,rSy szF\O/"y""""""*j57IqDZL>Sj~YU&>%S^CEjdԝ8]W2O:=(_Gfj)Z5v؋oI|C?J)QhR]OڊfGo"Ѫe5fS>B-Gi>Lѩv=(zyթE_joTˮy}=>S7_Qir}!:=h:y"vb=t?~DYqrHq:}zpqEEUuJ(יQj ;CGv:9;iwh"ԢP'7_Gs{QjQKﳋOr3؟,c?Q{i$4i܋V 8WxE{kPMZyb,w`SҋVN8ދNkȵzi:A=ؔXg]NkqIx{g"1ERj=ݣ(xvso}hyq=zAE./"[Msj 5P4MlutwKg,eǥ5#M EKk(It76"I] db-M.qO>\A59%[_$KsiiZ΢:4I4#R i%>}] -9:j\QHszx>ZOЃXhkja={tE St׈/hEƣ^id5r"p,.e|֖gl29\;2=N tdO>KZܾˉw}9Xuhz[c&- *c < WG]#FZ+u6zU%D<WAta{QGωDDDEQH\Ow""佷aǪ^YkHGVcfx|X^D]H卒#%FH8j1%i:""n}ZC 0tԏgHgYQu'$O*)î XL1s#q =}ƀU30 $q=DZwHwA t#Nz"yp[>DMOyD[˝_#Ē r3;٣@7:DE-֖* 'oTS@8v״s\x "*SPW[Q54 /ykdQuq2鋛j6J{xp-tnz59,nR7;^ָ8NSGb[@Z)5ѱ-L }M#-O\O{ "-ЈM܈(.'xnk4a:~ۮP3@H;a<qw׽#u.{Nu h{8sD[H9DTl΍s9!͙< 0o糀DEb"+K}9""WaHL3wPp'gNeN:"B[tsk""Wkj:$e#hiǏ~"P_r"+v"x"ëz[{B"+ ˿DT-eV;6*{$9\%xȎh* \i##] ^ZD^Vd[[z7&m|768Pz%&e鮭.i$E5DT.'戊DUWy䈊ˉ?"":"+ky?NDVȈDExa>r".+yg*" # $:i$D\kˉDEwh\DEq>DV"""dP9"\ڈ$#! .!Aq$4vD]9m!ŵS͠>+5wzȕ_`wt-y`wp-.[qp>0;ў!avG#-=EEN}[:Ή~dN}S"K{&{.P³6w ^KVƙHKN^Kh/i$hA%]4E5+O Z)ng5 ^H+-g/C5#Ğb=n иt=Qm4Uww?:"*2jj3v~t[K"OQS$]M.o+z;~rKGgE|Oy>o>jtӟG3WCO󪆓Qr)%lRC(`{Ϻ#tnq*0>\:GguW4z}jA_[.驩PL'aycps)apFFIiH#Ӹz5__DV9ih5䊅r"0QX\OԊ=>V2 SO[=\)Ou4v_M6{j)@ʷvk{޳ ypN?wܸsOG \N3SooTIJI{xptZŦytx2NC/^L7,;wUb٥dM3)^8M|kYM)ӄͅĵQu0v~źh SQ=ۧS:?OF}>P:ϡZ^.?r"Sifwa+I'ګ}Mܫ3Q:?ONç`2"OSDEC'zւ;mOCUFySH-`Ei>^{$bI#qc`2O,ry;_Y"+|Q.%[GoI4EC1DEo}?ኴ_wӒ"]Wr"oV*xޯaDEO+ { "I戩O"">?* sDO8GQˀQ>Ոh舞0qά/"'?}'"x?:"v}4E_}F_.DU?B<_Ј/}V=Ȋ/OD\O?b"M>*"*^c2o_Zj5|j y5"tKK$3BHac潮8&G\ƪk:lq8x33"U3MUU4THfW,$q?b"bO^x~EO>EpGk aDW } ~eNw}+Qt;];A{4#(m:VsKEfSKU\kaiغ%{H= Wwj"R9ʲn)o}]dpcUˡ њ2#E^w+nuw uVKS; x<$g,4r"veo~j"[{rA}=hAuV""$Ԉ1rs{%5 pn2Ny4EwSiv>)cd=2F8jױ.kȃDU=_i{ŶC-}Ҫ:Zh7JȠ{JƴjQPcߪ2]fQDTt_ Gu_.y 4DEpp=mDUV\DQZ̢"qfwrs%i-4nZ)m5FZf͍h$uh޲Awy[=u=‚Ө?^'Gױ"I=}Ʈ3-EUTc$9hMf{0'fIKjlѺ򹮬>'{ֱGf.t~DTDDĢ"ڈ4DZ-by!jMDS U= ;Q؎i`m1]ukEU]o#WSW@C#N,x\ ".ol\_^Ƌ5͞EQRANu3O]xt-2Wl:M0!sk99=>7[U~iSQQ>i=`^ukTHzGp"g:Fa!ngtbl)jʸ1Vհ9%-8sՑQi/px<}ȈD h]FcW P?XZ2;= +EWd-)u-\\u.ZCyz?)JGGEasz~*j*cн9;p]m]}TQUU+yGK&AO"vpQPϴ*أ1z}(z5agq~=>Zhۯ =>B;u'Y4ypUo}= \fmC_WQP 2)X8d+zOJ-~V>_aENzFI<+z]~SM97HS*h;"]yh;""K{T'AjtQu; OEiۧDN}踯yu>dG(@u=^%=v8KPkxWh| 2v e;& Y5^Qt!#zO[{Ҋ$DB戊'9k"QFxs2j"(|QXX;8""?",dpn)h{ej DA w2 ~HeM@(&ͲXeugS)PAI"IGSh5'DD[Q DEq>܈DDDZ)W$U[g9űsupG8Gzf X0UѽmuE#;$ "o{ck5cKֱq 5ROtv˶ ڪv1fy\>$>FҀ {c$E&Xח\VH$D\PR@u8KU|ApkI]@o/X2:BZGQ}QDODD\e߿*rLMvx{85DEP9XDE(p>܈DWϏވV_DE]N"644{>{5?R"-DwDD=Q^ۧ"+[DWk$DDDM@tDDGTDN| "/ovI^e2**5mhdtf=EFI)c=du09\^#O89DX4 >AŇbƣsDE "+OԈGdDP"r%NDE?P""`ȈvDEVjx>J"(=QqMySwOjZxM;ug<{"-\ODEDDDDQ{QFs""@DEj"""+ ($haf':_ΰ*d=C{=__ Ѥv'p>ZZ4;{"Ъ~ZMzo=ց;<~Z{FyrJ-^=ˉ-RxksEKG(\u'Q&xzk05hTn?g~ET˦N\ <*&m3 SgZ-LƼ{8}[B x;@*Qwhu<Efa$6OD<E14OorJ&@?_pEZ>Ҩ̋PdM9΋J u>0(NOnҨ\Zsu̴c=Naq޵&-rH?p5PmMAkUljH)etύu&S\@og1ˡ*8Wr,.GvAX)c|2rY^s?mN;[hpz~kI?ڪ^O. =r==s#K9R8I'RuFz)Nqq<^Gӏj~ŤNa;E)dSz,gWSOM4 A,d~㑀pݨq~^mY7:OE=YEO/vW9XƉ.6өГڤrqϗ5SI}ЦkaW5]63vuXl5׻f!Ah8UntѼ|)#BtXw({h9;מ zF\O/"y/J<]%>C_&We+ur7 B:HZ""KkD.%1H ?8H貢O?:킙r@VE(DEb"""+KDQ؈HF^O.DEVgEPϫ`~ZDj)9q?f"R~SjtTZf ET}5pEuxvەRjtp"uvpEN?M(hԏ"*_0 ߠ?oN8Go}hTאE+u'S9zӹ#q="SS73ϏW2)sZLOzC\x5יxY nEI&w*6g贚g^'"]yrvHneE;Zys?`EK)$kcykwЊv_z-:j8r)C }yچ~S"+_D:>XϙsAEʣÎ{yB' 5p?_ТeP{OpyQk=ߣuh}q=$"SƝiyoE릜"-z;]ȣ{4%M&Aקq 맣_A_OQkм; vXBAㆽ֋qRz~$8Up#:pzZ,Fs(K:w`QkлP=-VGtE]RH$.:")ݨFWQ<3u|y{Y(I'"*""""""""""_r"-J{4n($=\C:bke"(jk*fO-DwJ@eDZB?n*;lr;mtDT.Er"+Qj4{}]os\UMNlzuDEmvξu` =fրI$eZ\eZ*/PUQNjJixDEpɯ8l5H PL&O QhD^FsxQ9u^w5QVr5dlDWx*8ԈHOQYwDTw̔DTDD,!qk=Dq}ƭuMCȃ+#W}h}DEB@QKOSH5~Gi>DZ[tu;.(/'舭DDDDDDĢ" DVˉ($h'AO`.'܈@DQ9:"+ "-\[`_lXd>7|*iGMUakD^^޶ggsM便ۮe=6:0Ty""q?J"*O""O$DR~DVp"z")C@航OQܨh*TU1G6; D]dT[jhjLҺ7s syFkXC(P9DQˀQX='Ev"""'.%eDQ"""_wӒ".m34Lk4@ +풇֏{}i+0Z6읒[,=̚Ó>&?`ska j?xtDo2t7?}=dow:+:̝mN}u:̝ OEMOyNUw`DjuOA=z>Ъ̄q>Ut'(/&>gyKoթz?O\#EtuXN!l=kŮz/A~d]YsWB[S$ qNcvr)zwP,WJ"+zK35(MV7GGwft̀<-ʘ__ʦ7װ(]<?V<m =g!DV} z=CNϻTEa'YFaxԞg"3z}Q+L}ʺEaկ9wsDV} zS"Oˣ;j#7ӵ1TU#Yrck;=çEiw=zVDVg 9q;~RTd̢+>#5P9Eiy<YXj;5~p[+KEo]ʈ~Eo="'}ˉDVOq?AQ{Q}?O4EO2"*|K2_wӒ"|K2Wr"|K2>%j?~#}(W}?O2I戫#f""4EQPoQˀQ§_}DU?Ȉ{~DU{G^gרONxt:i˱\*;z?_N"+Gy?oQē~dEp׷'@\*.~U Z9"~BDW ~DDW}'tDW }#\O؈}z$(1TDWxޑ?-n&h z;֚ uK"qD'L\"J?VSYSY3穞j =Dg4=OdEp>OG IDWu>TDWPy#"ރ*>E_}>ũP_o֦{Db(KE^dji}qJ&Hjk{[O.܈2}]Ȋȕj"<\;AjNdUyxz.naOb2φc v{ ΅-հs|jKb0zhB/P,nq zwK ~*Zډ}cQWR"(2"(DQO4DV=舣-#ވ7uv~DPOת"+ DEsDEDDZ}²GW_P(橝ò(ct!x""=[r?RC>DV"?_Ӛ",WkqDEb"""(>DPǘDEDEG"-ލ? N\E d$qkߦ{".0DDDEaxdP9"^\>ЈDDDV=Ȉ.'"""*j}EkY s=ހyܴjߧgZ׏/ҬZUK_N߯TOpXՠ@ *4_"a~ިTwZm?ZK@Owo!zju<;y?9TgĞ$}ڕ__Q AR{ υwrUwcGoܴJx<Ģf}8v({J*dpqDZmZ =>UIހu'QjHӀOԨO̶Txsj3WJ3kڴIԞ<OJ-Jzjf_OE~DpAH=;Vq'N}CNEkXis=Aq<~YCQOEωZts$;OiE5O5G0wY Oک-.ZEKei?/({{Ue;uyY OGgXq~R)[ < ,W7'&O#s?[(Tx5D~o2p>u7W8x₫qV=h#[G\ڦŮo2~z*اeSxi!G_Qc}> )xE;*;e@=}| ,gE?x~Zdv?(E$ܩǗjT~j-2Z~'AN!^< G NZ|h{GaUZrr ;hE,\??Uq Q>ϼ~dZ\q$?UӨa \~#=ЋK>dX ҵx&@OZ-6XԎ-JgIgЪrz?CgOx}~‘?RBai4ٯyJ=}^]8GE3kwa>I=vV5}z;J-v+N#W1ݿQzeӨˇ#y9sy)-G1b2u7#~uƇ^6fv=>Px{VM'[NÒhǡ#}-ǨbYxGr(Y{BkhGAENA}M4z>U Ҥf}F\O-n ?UQ"}i k?ZY9oF*v@>Z4j?h?vOӼZ<ӏn:g'{~b,/xk(皖aH*!c'5A V~C~"5ԎVgyuM%<3'>]U\8zKy*uh(]7i[ZQˇވDDV(.' %9 qQeջ?:}2;O~ E8Wu;yw"wc$[TDEB@戊"}/" PC@ן=;Qi}~PIr}jEYE*j)ԏZ<ч}8hhRsπ?N($hԸA>z"Wڋ&=?X0)_ĞPǸZ5T?oh><ԋnI})AҧCt׏{=R)[p}Z DμA=tR:b-Q/Q'v7AOZ5D-SϷIE+xEO'S<}.Y-ogЋDN\x1yXѮN(}Czz)ދEaē˿E3{,AڟHZ\=O_p"Ѧ${+.؋i^OhE ox,Z4v(xώ8!EǷ-F*tN?xE=|wz~5E5t r;"φ=>PIp8~tZQZrtzB,gc1Z2AXGЋ[vaZ2t8 }8pQkғu}PE#~9\QN8k^[ǀ=ާ"x -~ : <4=|TQMBXB5uN-?b,G\9Ggӽᦓ}Îhӯ ogȄXoP"թd5r"wKA"Trzg4X$.Z.ЏOҋ C~Z45qp$Cc-b{wqt{~àEiO~Qag^hݫZ<4p[ψ? ;??ԋXG.,tZ""*.]QP9"\ڈnDR$DVˉFI<Qh]?NhUL;3#DEZ\edDV""""" s(/'"zOr"(DEDDN\J".yK:YRUN$SY we7h" sБH.䈊γ"+K(̢"vqX^}5DEa sDEy<CS>ރ=DDDDDDVC{QZ{}MȈ\OwDV"oDEaps(Ģ"܈"IQZ\$i{EmhiV]]TbHf kǴ98ثUIx Q +ch]Cb1䆻u^Hg(^DQO4D@y{QJ"zF\]ӊ"*kχq0xԍV/.ǵ΂Gh{zD\&_DEa$DEDDT$h/'Z9qFI<"*"" s(/'"--j\NiG$ځ]VwoU >3]EFjd2(oSoPpu➋GQZuvɕSe:μAJ(?VDow:x_:̝ OO ߷u?:ΞoEiw:ΞoEoSi^_Ί)zZ\*?O؊γ?/E^OSޯTUo="n;(zq=Nh2I抽.?wދ6]CDMe6o-d6N+"@Ew@'Ey<v"My"T$e^{x"0Bvq돯؊Vӂ)D~u'%Q_EDNhEoWp'j"*hDNwѣz( ?Pꄁ̫KQH:?ON2IQO@Eapܮ ';z[{%Ajm-,jieBzxlq 2SK+enNaa\t<ј[I_-pb|P\xF`.:2&87?'UtGUHZAPG8ƽV>5ylW^KfZ7{#&9;G48!b:]5c2OOf_~WByQ_*G_Qfaܬ-'$E>Iz4DVO 4qfI*j"z}f(3Q]ʯC_OB"WX7\,7_Z85r:ecUUٮQXj!*2j"\5QFI<"\GH;D^O"+ X?ݠV*|_q?_"wUaxȊϋB$(}*"*|^`?qT$eS=?*2ypj"=O~Eb"xDOUzJ"V%D\O?gb"zU~/=.%WеF_DOB"U""'舮c?? Vˉ8o!wfjMFCJs˓.Όh9t#G<r"Uw;"Uz~HDE ? *"+H}SiR;OUi{(APo?( 2ݩDR y; V7?H*=?hP)Gw/G%Fz{5⣳_"NwJ")ÿA?C)h7xt/:gHۧԈO~oC{QGQ_ȈȭDR }#~dDW=XDEp{O֢/'\q+*-w܈;V9;:+}"]y""! sDUEyT+G{p:7*"+oQ_<=}Ȉ.'܈DDDQ{QFI<w3]٭+xn VYn.h:j!n! o]jG3Oì)3/+|oG QuY3B}6 ~=>#u<ZQv`?ڴBb)gw:/r9#(ˉʊz}h-E {{Nez}_VA#EBTVˆۯ(^~dWb(;KgVQG{*h1+z4EoC}#|N[ڋ]) !Ri[iwq"óQgNNh7}ȩН OO ߷;_'C{(%An!k͑S8idV랭wO#Hik66r÷H ]{Q\D[GW(թxdp-Cqt俻ڷJhNh""qw"4_j"(A舢,#XuӇ?J"(NPy"\~DQ8@O#DE[{4:{4O騼M"I5#|ZýYQX_؈"I戈e>DV""""\O؈vwf(0%mdd;̕lr^=[r6C,iM|k }"ypہqęd e&֪]r #kz6K#)66t"_}_.DEV:",z"+;}Q_HDEVWӒ")]ڈ濗aDE0vTy""9""?ڈQnu7ӎ[4>M{5V%G1(O_DDW""~zЈu8tDTNzO5ӴDU"棺m~!%~} ]׍&*jyȫ)&4/ŠDAZ@#B>D\ucӚ"+C吝/'<B;GQZ@xDE.q䈋O""ҮWULu1_zYH=^{'UTYQ-L/W8֎Ƶ@;DE\DEq>DV"""D "(}DDDEaxYӠ!A;ooZmP;>zZğOQj4|?j-Oӯ>?`EDx8Nxi޶C'~̋SoiqZTH8iJ-U'>?{QiFZDi̅=ޅjfǖb-RzOWyOw`TMϿ}ZQG^FS;J,:p{E7H'f}cZ ?"bQ-6I]΋Pd`q<_w.zOȋ1vIӋ+GrOW].';,s<~d#g%jsG?Sb/XU0isY i>gSJ8 {a$'O_ɣ^߫֊A 8ro;*UHti:*5oÎ?G+~*^(q}[{ႵXqC~Uz{'ޮmT]F,wSXNw}HNGfz=HAp׿>}4}i%Wƿ7E$=h~}?N >*~^XRCЮZSsE,Z<$BԡׯEK:4?NJV;ܵx*?N$d>B=T@Fh.|?G緗wJr8;ВOR@NkQiSF='.!kPKէ#w'.%iSEͧT5XX~BڴyPGyIk+_z}5JZ@*5ZOM=c-xi?Rjr:7֋H!ǸQO#_a`xV@A85uᦅ4|r)xzyiW5PFH{ybiס5ݎ}@Z\G.HW;@Z4"&oկT/~PiS=\èSI}@;Z4~r);8v;E˼}|B-v~>R0Zܔrӂ-"v~U/-v:_Wz-v~>QO5_z}:rZ\ծrׇ~Ua޾Ok1G4N>F_ZDOT\ڷ$j4S" sDEq>DDDDVˏ܈2ITewVj{ϵ}5owh/""y""*4DVuj@{"S~NhooELYpY "j,OgҋnT;w>_vi.$H}ԋnU;OЊVEJӧ)ooU!pE;G O3"v:,-y~Ec9"oԋAڻ^i.=v}ȴz9uEQmtk4b);{zIBLJMa=(nz{Oa8"{h?i{ZD h܋)Oooh\xp"kpןӳDZUD >Qe3M4C~E.d1},Dr" {Ob-&~c_ӵg"fP\wٯw5,}`B-*zuwtW]πEMP'>R59EKTwRw"t˝؊4~Wӂ'Cc:kTWoE;"GgDẘޞTOwh:kwf<DQ>Y-k'N(pnZ)滏q?qc:};͆}G˂(vz-Vô-:;"G{-RCSEh:wE }="Vp:# B>O.>Xeq "5E Xe#~}=p~$q%nWkH:Oo/AEHwESJtl:Wgz(5pS˯K#ۢ,7 -n'#za8~Z$X8r"ydfȠpERˮxOO8zc?@~[N]HV-Z'tA˘ϨE#y>pR˳_PhQbr?Q蝨WwaG 8-fN-ӧ?Q`ɫ׏gQhXoR-vM@{(=GO{-JFOv p}ȵjW@/X:-J\NѢ,g'TZ./Aӂ-YVE@ `Ez"""(DEs[CDE!-o""@DEj"""+ ~tDT$hj]jo#h>DEK}DDDDDDDEwP9"@DEj"""+ DE$(tUH*ilLAl P$L>=\75kd#|uЍ&$quh~D@ H>'DEz"*22yp }H9bxf6HK|r4pkH(Œ$ݪ(OQGsG;$X{heDQ"""_r"(ˉw""eDVO4DTDEB@戋6,mO[Z]u8`U @,w]rmDkT  %f])H6WQwlC:]"{B*h{[{WhmDww?:'[{:Ίypj*GEb'A#DE_"IE^Eq/̯z=Z\}E AZ.'܊֎}MZDDTDDMJ" s?OR+ z2vjU Ex` apEz˯i?ry+ `V~upa>_WeN}w/4IR=;U:;O\J#GOP9<=E+cأtð n/܎?BCscèl} qtD<3 +ZUh~烵tGQ=>菒6CWY밹v-}E=6*NčԺV,܅ַD[C0t]d-£s :L ;>h_sM|O꺩|>O3e%z^pƠ68ڋEQL<-|1V M9C[-R\t/_wjOUБӼ=?JF JCrh I<ԭ[p|*,s*8l߂2V$ڮe <Ąџ:Mkm;ſo2W;* ջCO@]#Z%4_`:}E#tӽ_Թuq]n,]q.<'Oep:ަh8^ kyn(4|=#:A>#уӣ yO}|8b Siv-'15~dym+ CHG>iC w6R3Q|6Ir悧}p.tpd3 &-!T<8jlXGn ['Htzkyf iӞ7|m/MSg0=ǭtijuD49!qkwA'!E߯So`#^Ti[3ݩE?tNs{%Au16pC#^m&Z#4N㮽:h9Ç/)S/O uKv;>|/ys>3ꓯ[_Q蝸^[N2{֥}t|1S2ךItTt,ϫ䏦2WOtD0q:t2lyYӵR4`p}x_ GuAzWä1oI6:z=饋 =EtWiKKiP8zV]&o,6 `I@@ߩkL- O18˜Xݮr=lQ CZ ߙTPgQfAJiᩬA ]DP l6%%>[Q=E5:-vm͂6oR񥥏 稐c  NAKq 0aX\q:+HѠתV\kνon_Z,Q\ZKF]k`Rh*\C-4$u C꯮''Y06X2@$a8jh% ddS?d2=Ĵ0VQ~+dj4Y+_k_ ?>ook{kIOm[+<U'=5iyO< ?mrTG6Mb*r-_M"-:mO z=5髢w̑ :z֡piy~m-?Su=:qQJƤ-}}_b>]4at|[>R-/#f;+w|_ x<=$ح94j$ 9}Kd~_>i]^փn1[x5q[_,ukEn/híÈQ2،SH`uqiFe~]wG/I Q;?h {]N9}g*VI~M8FԶ=ɗ^>6T4oWV[47* ^t駽+E|GKy7h(_{;iWx>7x}:~5֋?Zs]Ow޶ GfBs&F5%3ZF^EnK !]ap;u<̝-I|~XY QwH[{f)/-Q c̩/SG $| cA!]KtZ$q-%q,\X6+euu.- w践 t:[.ˉJZ/š^Wnpڝ!{cy1/drT -ʴSV:jX2Ffǎ|8N}Mr _t7)E_y?ox(hI?Vr"cP+Q C{E3jTDWHO_$Ex=آqo`٦ob"?{?28Ԃ*+j,H u=M s(y<}般DW8vjzJ"y$DUTDDDEɛWɜNj%(Ɓn3Wޞa0-WU|4$>bjhӊ;s|_7"W]-s];H/C𢍑FEllqDƵc264hmBuxēڼBt3KQS,+枢WYWIeW>I${I:*ˀQbw"9!V4WTegwLI+#VG02I樨 Py?{XY}_.Eas⊈DUu=Ȉ.qԊ"y٨Ew[{xz"(ˏFcCh#Eaa:GjEM겴[ABZӧW _L1Sðr.{ hDj*h;Sj!ӷENQBЊ(EN2+zn?6_҉t;N!ܸzG4Nw}󢄰\~NȬDq?wފަt;\ [%ºcĆ <,9qZ~ҡ`˺;)ܪOةY3dk@:򎇱TK;n5+#DEc~DQG>h'9s=]}DD h,""""\ڈ2QFXG.?z".5_rѿĥpuili٪#k"-\O?b"*""rQF_DE"""+KȈ.'܈y0)-6#ʫ1I_SM5$gŝv6$dEl![1/Q~yn"}S^ 邝"67W3u}舥k""渏Wr")Aj\GDE!xӇ?Z舧kĀ5ׂ"+}=""")Q^<"-VKk:89oj}^D[HJ" sOnDEPHQT^cDEoV}ߙ~DBZDEN;O"Y""y |~e3IPڋ.m9&=l׍ 9=mkC1NLZG+戊4DDDP8s(y9"""(=1y>| "(,9}9"{\8s:",wk""kcKִjxDEùJXKi!.e3꘎}R7AވoˀQX='Ev"""'.%eDQ"""̈2}]ȈDE x N 燭`U;p?o؋PNtUDYu$_S믷EU?8_ЋV=(u>w3~Yz*ŷ{{yzjL$8CÊӻWz'Cϗz-Vqcw\O_W tnwFOogVRNW?oB-JqWpvVU&~o"iqpJN[zM:]pE_NUZ%T-O̓;gJ'O@Z,OӐEEvԣ$ZdJ-AԫIҦ$^B,C?v.=.j5sݩE;aOyF*^\=4S ``f z\{~à#քd6~^?BTNw{) gFӏe0wgG{}g,wT+tQտJ]wE hM[ߴĻΊ5#uͩpWjznvUڳ^Zk}ȱO5ɘ:\Z~B~XωsU#;lu/g>-Ggg0 Z};8}I-JxڋHy=cxܵ8j:OzX?Nyp]V <ziCς5Zᘂ8>-*h}5ʫZXK>$c"գ#(c_v/jӐ@';xaxF.x{ҥZ1FI<֍;tպj9ǷԩqӢ֡Qh/ ]]Oժ-"Vh{Pt:M. ~-2x}5SjпB?iEgINERkÙJ>XC@\EqAЫ4'\g>Z5C:]1W9~a⥓?GpB5:} go1VVM&;Vfqp*)dZLok{p ƇJiM=~jҦn׸v+K}9-rXqZ5Kxxxhy.p?~Z,a}[pV+G}?qE?@#DI<֑#tq>aڴz?W/;h ൚Wp'Qb =F=}Ȉ.'/+ QO5$DTTDDD_m$r-ਈ=}NH.'܈DDDVoӚ"('"+8QcT;AB,5'h@}ҊV?-TZ%S.8rzQMkܩvӼt(g'E?@~=5>>J-;wSgYCMGwhO}ߑ4[rƿ>(4-WtqDc?}h9yr"^/j-RIӎO 8vR3^NQ'H']{Nx(MEv=vMQh2kÿ} >ZTW}Z(`~Z$9d1ҋD}EѠETI-9S5zy"j&szEƀ;t'Q6"N$<~W;-"y?pv7^.h!xޤS5a>vu:΃VN'OWi<b=GߠMy >QOI<{Eii<~T4(cEQTu!u5(,:}̫O8B{wz"d˷Q"AEAju?aEG0pp1EǟgtYC8QZ=@~t=E G=9iދX}4z{(uv^܋VN4?_`X0<O7B(]o޴ZXAZt9^+t")dZk_{a5tEIy|Qa8jkTZp:p9pӨ#ڋpOGgoG8!ڋ[աE9iz-Lkpp4:Znխww?QӸ% yЏJCw(u؋rSP=#zXnESCr,W5p?؋p@<~OE{kÁ($<ܔ8BY^"ėA÷N.#GڋW/O q7GxkG +N9qFI<QvDER}=DDDEM{""""""(j"*p8;  D[2l4o=ܹuO^"QZ^"y""! sDEwh.܈2}]ȈDDDEw~E06ocZ2,뫛OvGRD]o؈c"@v"ڈ=_MQZ̢"\ڈDW9DV""IDE$?WDEiv}8@sDEo4DDDDDVO{>DV.'ߛ҈DP+ cF=쑏cZЄD]/Ntlv[^km9!Ru9""""ڈ;DRrDEr"""""""-XpS],ZSN49q/hDE"IQQ DEy<}般DDDEix"I戊eDQ"}8i uC'm> xwjku#_p:#_c,-piC%R@R^=kdw"Wr*h{C}C}ME^w"u?hmDUwVWТt1=_E_~VuG]zS[?UB;TfOY^#Ӹzڬ=}==IU:>Uow=_lqC#-rjIq{ჴ̾~㳏؊e糇ڬ/qzg~ejUJgW Xehv:$9`R}}@9D>!4AD=ݿT$e?bW~٢sJ#.F@;37j(HecdV>)cxկFkH#TAq+PYoTKG[ASmT1SU!x`CGwj[KFmgKXӠw Bݔu"mdw;b7^w0* w^QEK| (wH tzѧ5:-#=KkIb:wBCDE.܈ug?{q>4E>ЭDP:v]?0DE {utDP:Oia:DP:C}fPۮJ[(k.5NzVN$#r@XVMM}e- ;N*hZz\ = ۹F_oٮQ(Y5(qL/P[-SIG=`T)j%uLCqjQxssqH&#KL<6Pw<U{y:Jy!g=8I0j;?)_;#A>}Zަaūrz擣 w9 l mٽDdx-1<9-m :Y NlvrIJ2At,gm39Fcsi:X~K6T?W wv;oYg#bų_kZ;yN?Z{"_s;uqd *][NEb;>.p<4pPx|kY;&P-j?Oӡ`8\nh/kvcrl-2B Ҿ_1j{4RG?֧O+\iu)RcpsFCs2֒$t{2twN ^hw*&PIf:z}gP;F^÷M?7895n.#%7KS[Q6kEN`],u2VC ,7 5tJvrmSKUJ)TCMQxq5K@55uUՕ5sS4˧S+:O>dd6I\ */5b7,_yTeƢj*dNn$経`cZF4wrAg,uWC}C}C}C}z]""t;h舝.SC}C}C}C}}o0 }]5W5Od{yO²٦~}QiN|5T|w.y̮G_G>n.'x'O9Ouin4}%,)*\/A[h," [LGۡX&ZM.f2GW>.YbAZv(`.uUN` |H;E,r9{jG'w3헝͌UIdVXfqlk#`}")UV7DS6wD(fU)Q~U~E3j=HQ{VVhz?")0'DQ_H>SuooO·r"Kq 􏧧TE GX)>_Ti=D4Vׂ"Iqw^ۧ颏^{xڈEr"]y+Qv"?{4txuI4$pwG9is h% I>7 +MmS IQ]]Y; L AWuAcTpJ˽Sx X#X48uZu9iUԚ'w2>MЭ=Cfc}GfC 9muG:G0 W 9o1zGr(AW;}Ht~}#+ w"\~VNŠXX;8+ gWaiXVW+UHZX}4Ey<؊VG0vTEwY$hȟzvjO`-vcbf:L=j+zOJ.M;Ǭꊆ?OB+OF1zpȭ.ӑGWΊyZcEDT=~tDT>"ShDww?:"*t⊚̄MqQh#މ>‹~t⋫b%|NKO[4#nlCݩ=!ʽ?vR:: ٭%TUt>4p룜;4٨<}zP's<}=4∊(,#,dEDVO4DQˁFA "-ߎ9 xeK* 8UOn`oTvD]!DDDEaxȈ$h̢"\ڈD]5f4,jasmDWG$DU/qz^oӒ"+\_DEp$rDE J")zP9""` h$D[p.ӪCÐDY=hw{Gx~}DVGiDEw_ab"+{uȈ"O>ASnCq…jb/м6zF""0y**皦W=D:YNjW8$"wWgވDDDPA}ׁ""ӈ""iDEG.]NHDEc(:xqDE <GDE }  ".7/޴?^FFNe8?kq$DDDEB@戊"}/dP9DQˀQXCP9y .N:U;*÷xRGZp~DZ =E*>E5}Ա+@wˏE@8O?9E*-ZѯUc ;ߝQ"a77O5 {x-wp?Y=hFCF_ďoeN'Z-B}{>^@N<-b=zڼ N~}=ȵx}rU.q'u<(ʣ=ݣsݞC8$Byznm!SOA< >"F@hA9qV8G<{8ZX[:igZ<Gj17ZhU2>ȋSvϧءqoTI^|_Zhy5ӻjje;}=(8cONyEUͦ#_oijQZvvQP8uz+' z#Tĭ&n|tӼZqʴhsͩ?M?28vwE$J'Nӊ-Ez==kGZxzgEUq<]G3NYI]KP=O`Q#Nzvj.׎ӿVˏܲp{TeePnrByvՆ?~E~#TW|8}~Ήy:(I:.JZFZ[{?ObeWgv}cs1Yۡ}H{קڤVInur,7[\a9?q`#VvwzBw-R :;%ѡj $DZߝ,}qNª P&ׁK.gE0:Vʭ.ܴ׈GEUS8qN.'ܴx'֭ZOO=j]4WO2IO^>hF8j?Okk>ZDßUi>ŭSɧ.#hG¹niyOʋK>aR0Zb~z~ҋG=AOG>Z,i"o\FvowP.ܴq<88ß%{?Z֠\@q 22*NNg֤i?c㥗G4vA̫V+uiOS*שݣ{i37-~ZGO_X^Ncyy<k;}qQ-"FӞOjkp?N~P~ţ7Vp:QExQYn*g{x+V;y9Z+?AhVˉvʑ_O򪴒8pj~oFJjEDUT$h/'Z\Z\2}]2}]Ȋj"""""""h\x""*22ypj"+Z\"~DTDDĢ"]ÇiXφ"xET8|",VgnU߻E1p;{h;F?gh9r-ǿuE2-3.?Wb,iOFgWE3NO?+OuE35:?Dwg,7AO۩q$=H"O Ǒ#o4QK;5?y؋n=o٩Y,c߫-M5kCo֊@{yv?b- M9uf5 }4EDc'}4E4k"*d8^f<8iө"'@}}dhyOu>G8"ȉ?OЪf{OR,h??OG(orӻQis}C~΋Dz=(k{O/J-G"J->z}M>h-.YרԊVER^@z8jfs:w|5˷j+O=T/F`⊢?Y} (Tu> *^}>VYgEah@ͫ:}D:zy~bv)}zXE;8witU$F(w/hB-J)Z}c]}z(^ޓˇh= ?J,GIg!ao.^AwXn=QkuzB,w7=5({oOգ"/"p OEM8j-r)8cEoG!k0I,9P'OXEHpw"p=a⧗^rןfE)<>vѧӏ -vMFzM}:;_G$Z㮼w΢u ,w5GQn*i5 ?^GXR;^/OѢ-LXDsVXO_nJWpX߯[[ϻh <hO -zڏDV""""IDE$DEDD]򫛌'yq߈¶B\FIukv=0.?j"+z>DV"""""""j3"('j"+ gA<.:OcB"-:Aˉ?""$DEi sDEy</""y"z_9""nDV9"+Xuw""ɼJ"+Qt|qYm[8U^fJ\d A 2RF bȋ< AiAЂ"= DEr"""""""+K""( DE,K}E?Hͨ`psF<Ȣ"EDQQP~DQDDDEaxd̢""*2XƪM>ITtxLZuUЃO-O;yC(ӿV8-bۅo1(E?UXk1,]F w= bΆG҉}oD"uG:ȭ$h~dTDo=zΊ2j'K{F ̢* Z\XI<ʌWr"eD[:y^E=Ϳ\CEA=Tsqc(̮$U@=*5"+oix@h\ǷF^"q"_]3>pa>_We ӷB@Qȯ UჷӓzNt?@ '>PeѯQ`}T~R`Dx_ЪtOТ>? Pq}]zGyzL\[ WBZ9 }'E5~ 5}ZNP:Omq+D o`\.wdu,'^=+2Lu?p+nN甗Y+񋸎וRF y0!Uewxu>? GHªKRxqk$nsk1:hGb`P@ D Zxij ,aX\"75A- i:x ZCApXή}}bsִ= kZ k@\I\ւ9xiY8 74= QIe嬎8\@jV;u:]٧Į[ y/g7*j5_z)-m ڜWmp E Uɟ~&|>Z\?y_n? 7"is[ܳ׺ 5f;dyiȻ|<|']-ئǟ{%8/ERxVyK=,3>&C-F. pޮxڿ˷m]4zSkŊSVzm<2Gc)O:Z0yMK\å(Gv_ \vwks~ Wk=ZE׳N<)~xj{߲d|KeOu^Nxy F]A TەFEJM8amv`H y1ky;Vkq!].1S4˯ŗu,/x,t䆆夗4vMts<;u1le$Vˬ*wSXteKzI㦫N~ag[vq[5e}5EgF eX^z 6p㮡+{ugmJզQӍ5Hi1qeusܫnSu]e|<כنy33^%0ȯ5N겶]]_AܵEq7oR"""""WȈ}؈ڈ~dDUow:"*v~_A=tӒ"""""""""""""""""""""""""""""""""*h;A=:ΈHzuDENQS:xDENw}{"*"""""* AFU$up Dsױc=sH-s\-sH\clfOލ UO\^d&+=q$Fĭd?s SAQWhCU|, @4w/h~c6 ǝO4mIHخnUev,̌(c&5Rl Ƒ-tz] eҸ&s$,/&2tTu 4na'M)t0Xݐ2/񖟆-aB*ok :)(Cg%ص¡ei.or|{M3`"t!9Il}}zfwjcuF ]UëZ;ղT:֞&IÂke{vkJtҦ]M_Nz-jYe8Wvtvvq=/;#fqˍʄi-Ox3Ied;5wpZkA}Aj+~)YU~U:]~E;j~TЎ`Eڑp"4؈mG.?OةW҈lw479~߷"çר-Jiܶ=RX{ ߠE3e}GBDR}>ΨHOꂣ/DS 5?X^<"+=>>axȊAWg2 㑧GKx < ZNu|3 ϯ^{y &?UZ\39x8:؉eTQb&CUjЗ ;UTExx ξ<}t-<[ЮE^f $AcNCZ8B~DZ-diDE gh::"+#"*""DE O/{܈yZZDEGb"(\8tD]`]h1_VȾ2մx,xt8|QpQpDQDEj"""($hW>S˵1ݭVx7ܝw9 |g4Qq 9{qs㫜\OI($h/"zF\O/"y""" sDEy>oPDZ#h?z\}wNu~Z$j4xգUӇދUOv+]S'9~tZ 98Bvppk~ʋmU'OGr-FH$vTO>b{;=~ŠNdZ-8vڣK?JI<9W?̋Ys'~)^t秤Z$ ~=P+nU?F~q>[FÇs[Ng5vwsEbllkִ8IXxqZSO(ZqVvm߫pΈu8s=rFNT@}=i<j0ǦNNU:_ζTƼ~Z,ԁ8 gwk@yZq=CЪ%zA z#({=nTI==\'ԣZTh׉~HX8T}OZ LgF >Q8}F]?EC!~ua L[w{8jh:]h3􎖝\~R,A^xCZDIz_r"M s9w&Yˉw}9F8{Xy:~N ՒҋKl'?iVXO}AӼV}|;x8"=?2vD=?oV\j|@}Ȣ}7P<5=N?~{qR6qÎ_,GBF{=^UN#,N{>_W8jEv*Z5H:R4ZpZ8vG=kI^#vfg?i}VB;r(١>*O.!<}Zz}K]N wh}#ӘET]woڤZ,~W"n=Pt L@9 ҧf 9z>ի=:{B\ڴYۣǒnW}^+PZ}w.AÿW?G.+\wg/I["go{=j#}JX9gzQh7Gu^y9G y k9ǸyvZT8*' 1K^~{sjF}?!>Э ns}EP贙Ǐ^ˇT F;ikzBGOִ㖣^W3yVv<~#\}+r;Zg=h.'<[vNN`9EԿ@tsdcMO`oЪW؋.6}Ъx{Oo. Y(ᮇF_g˹>hǸ}4y4u;S?"ҪeiaS8ix?9EO."o4"eē_oE;GY׏wZeDk`ZDtIzNoZDjI!^'E+\xȴ4d_r-2Z57}A=g/tE~ΊV@B,yC;ES~Ԋp-n Y5w}BA-fjm]E#krq"tV]Z-r'Cݺvvv”ǗkfGaTXQZ3=N(kTЁǁӳXfSxk"0 tXn:է^"ש^?$!StZ|un*WGΫ<*tz>@خ >pa(>pr ۩WJҸr~pr .v~`TdU^Ob;M>WgN*"Jӷ}z+H'E hGgٯ);A?N(R{Nt8L?~JuHկuV=ȧkZ };O2uOTE"}VQuS]}V,?,dm61ݾ,MoiqhЯ9>90}Z,q{+q_![ 8,jS-K5mGc} y}Wj{&]Ea覛- :Ichkt8!8 rRm_:JSON>1ދj.,DDDDWtDE^DE_""h-ވDTowވ"A?"޿4=؈OmWG6}ނR W:*jI9ayqo"(n7 ]C+-Ֆ2jJA!Ӿ9[ţ[ γme;}X&MFL n|r9{%] H `+^H״k8͛:I.CISGW$pbVzy$jLxs.S3cew eqPA_Mr; Mzpi#@`ot%Í諱yu$nwMse=PQ7xlm%E;5Mki'HK>|& 3lFMK"Ej-t礆|Аד;98|KȡfP>W5_?wk iZq^lyAG/=t6 Ͷ;43k}eCխu>;mKҥiN O`xdnj]P̾W[f3OeFkJί *uIp3888ˊ5kn~Y*vs6l]֢ $ߗ>rnfyvTx_sc; q[գ;Ǫ61iW1KOP!?S` y\ +̩5l9%!C-}:s3 l;4ڨ뫅'-#FV(v_g݋9v7pVQ{Ku24;RPĎ MMGP9X?7\ ,rB,oH>7F={kB 冹k^5{C湮p9PG5=E=e<tUKU U4zzya sps\ZA@ڞ<˴w̏c99qJ">By)0}")/L}cl~ipE(2}]ȊP[j\\tMΩ_B򃣀B8d{uƪm4.w걿y=C./ ̷mNs*)~o{MR>:OC6G7<ҽR[ae5") U:z䈊Mx}Ȣ"<W""9Gӱ|ܿ3~sSOQ|>h!xt] VI=ts}̑Q "+ d{F<}NH_z"(PחQD<ןj"(Ȉ.NqpӐWUZC {֎׽;IDE[jk'zb][ -Éu'ĞDZYxd̢""*22ypX=%DP9"ڈ4DDDWi$ ??w4PN@oӿ"ZIwfV::xTZ-Sdz'E@ѧ~Oȣ}>Vܨwi5X]59~AEůN_ʋmTy>Z A~ ēZCq]?'?J-ju}ȭݜ>>Z8oԎOY~DZ:NV;?y+nԿ@'(Xu=v˸+!~աUFE_U(cGvi㯤_ʶ[~N|D\KOVQ7Hs59Ie>q(Z0p=4~?{֍4Zqt~jѪ*9}Cڋ28KZDӗkLJQjæ#S?$/N}5sTYb GuB.kyq?NńA_} }=-2)<M_~ŏj'=Қ cZ7@;~ݢѨS6{GE-6Q45)Q`I_{>x $ѨV{>Ft(b}> r ӵ4Zk ܈>Q{V+:NKsx?!Z2= >|JjMzx}JwyrZ<@8x}|Z4O1uy÷@A"^m?RkPb--5~\:~^G^?B-f}O}@"gfRvN{mGi B4;gb-&kϟ h=OB)^Fwh~ҷ#ao G.G.Z\˟}9㣇̭vIqVq-f^n:Wj>>ʣ$kIp>SGӗR;*-z~j5SG=5iS J2ypj)Ď<zh л~r;xsOȋEpUpSDZ4GӞr-J㦿X^.'ZLpӑO\ӡ [{9AZ$kEܴ$/r ~Ψ'yZ\""̊9qZΧw/ITDD$h/"zF\Ow꟧j)zƠ?IO}oj{z-C5e}EN#ӧiOg.?EUV{uQOR3ԋD>?b,_Dx vr'Oȋ 8j8kzp~NO{>-VoZ4hQhv{f xpi*]Ϗ-Oӟȥ!=[rO"5QK}Qhu.k:@`>(5pq}hx>z)@=wwETSi}dR@^[r:CSÂ,FwKC{Y}>~[~wI<,b-WsI]HS;>^ZTμO/e Y'8{)Y^J5'tܴE3u:b-Y.Fww2*6\;i35O?k4OԋE^n<=cS5Ry~Z,uO{yRq?w"Ҫ*9xv;Qf goY$9}9@>O`>^t5q8qE+'j~֋rS8w5"“~ZgO=_3ۨ|k>Oʋ9S?b,)IpʋYw{EI-z#gZ~ש9b;y;=)պv5Et<=WG?'AǷO~tXr:onkP#_̋@E">ΊDEaxȈ$enO/ς"(DEb"+}HH9qJ"('")8};Q\H`[ {\4c>HⲎZ)ÈǏՑ׷tDX/""y""! sDEwOj"+Z\eZ#ٸ6S0t;ͩ.6{k!tGr{G""*ڈ"}/X̢"{QXI<HsIii8""ܔuM]GkDEHF^O.DEb"""""""+K""WwӚ"+QZsDE$DEapDVq<=ĵDuz6;ldT91jkqv CpkL5F|dE}‚[UnRE]E+I5?oLu1epָi?wWt~Πtzʡ**J{O;7եz\5Q:s>a.wzx+~ ӎ}S')DzvʠuH5}Ex`R{DWI>BlOw1;}O>COl-N>رT8 p_X{; q0ܻ,q{vʺ"w |z}<wy{iw z˅–i`F9:rc\J+`i fofmkL.qҾ/{O nizYKv@t*]Zto'4t3H\y@ݛ؊[v=ǝ|gkC0Cizd^>c~I/\+_enu=Dv'n9j!qÒ[<""~b"'?J"'?J"'?J"'?J"'?J"'?J"'?J"'?J"*t}oDD>""C:Έ(DTDDDDDDDDDDDDDDDDDDDDDDDDDDcTDV7""?O:?OJ"+H#?OJ"*""".=6k7GmmMWW4Ӫ-9Qɧc$k[, {_e>u-$]taGRx7Qvߞ_9^S~vF8hۭ1bPYL8]GQ {CuyjF69:}Eu8koDVV801TDwטu:w8.vcQ`)@pZ"dUvڛicxyͿeEEWݕOå= ~/ +vO;k kGHF{PjbH\}-I]6ξU;nr[P R[H!t]R>]|aY~%]AF,ԋ-\1},l^yn6O*yg[XlޟoUk\95h%q:I({$kƹ{1s@kZ)/q O ǘjoa]~ҜtMnM@cXFj|LǤ ?u9]/|ԛuC#:ۏF|_ Aо,c<d`s#~x.P$kuЂ9~UCV=@R-#;Z_EaԎ:EagwB+QXA^aEx (t~=\ Ea""UPyi /V>oA#EM@+2TFPTkŜ66'yتtʝ.r.wjZ戊Z0 9}4B\{Tow:*uDowڊ!NoEN?2(ǰ_ТtOG{D"ԉ=?gEi v{z~̋[1?~h@Go_NwZF1:C⽬eB)<t#r+zˌ A$FGt4t.,-Iver"/OODEa.܈"u<""_z"(]Ȉ_^>Ј7 ?*oCŴNiuD]ODEB9;QD\O""r~D^y=I[r73vh꭛},j)i볨TŤ%<#"W446*KmnJ**:h 5-%-;#1kZƀ""k"i"atDW~DRGӚ")ykw"""$qQJGDE0xDDp:")"""+CƼ"?}4DE DE6A !3_}zDE:zZr?Wb"*us{DE@HQ^=iz 'DEw[Oxzq.n4{M;.6OuZm;7v:8<|KS4QQQ,OQDQ""""k/>DQ"LJ+A pB"(x}҈$D\=dST֊R APttqg~esDEj"""(Ģ"""p.'Z9q?b"('DEDDT$ee"h?OQ~,JhC~Zc>y@9iQj:Z[hu k4O-9]~Zx}ŷtwu>dDZ`h.r -9=G5@)Z>|m|˯z.ҋP}UKGRTjG?i }'q~2']ۦO-QkP>ym.{ 4kV_ w.HQIq0;~5ן5q'1mj^tO 'J-a}޿GBӻڴ:p<j7ݾݪ~\uv"ԃGt+_;Z4ǁpqEӨ:z=UO؋S wXoNxTzUxb;:-OpԞ:"աh]zxU<4[jEI hF=h[i>TOJ-FkNow> u$ x{yEB^D{VS&geժ\thu*5Ai=[wVQ7Q$NyAqhu3k^Ÿ8z)*;z{4|9~Q-xDִf5@nu=ȳ>t KR)9w8؝`~`]b+?;Twj$\8j=~P٨>O`~T̪#؋}a]w꟨B:w 8_S=jvǷ-6X=aH ?J@Vˉ,~ՄOAZ2y y"fppRtZ4:UQh]Oh}ޭO/Kq3:{*nN]`<iW4~I{vZ5C4:\]eS?QpZ={ -f+wjN>Ҭ/h7B}_QprӿӽFI<֕;ui^ςcNO>Pt V.'}iqB@nOڵWMob-Vأ.MP;{BFn4`+OaSC~}J='hu#qR z[[?NqZ'^'QdD9zQTirEd8Qܩ:6ѧԋ!}$ȴZ鯰w=Iީwyq>>Y<=?vѪ]HAYQ׷ÁQmʗjtEWSôI~)I?`h2jt)ۯ 9^QhuRπ"ɏGO:7^̢Ѫ%7(7h>!($k~@Mt I;IEsYҋL؋!IZ-:Z^}]9H}`OoqE^Q|sH![L[.LjwP|UZ~Di(j;;;Gӑ(:C}8SNDE t3(Zi}_ 'ku7M{A֊' A}}E˨'{O4XRh5ӗrȵYxE#]ׁk?9r(9zǬ~t[=vp>}NZ>=E)t׏"\uG'>%wSt}@#kTխ:)#qRR|{#"zER]bďXnZwZuA^|>X2 wv"đu #ꟸQaɫGaԋ\:9 fZ,Sɧѧqa,,wא$F["KO{xu,iKH4SßwoxEܔ=_~dXgq"3?xO[:,B9!FHnZB~O`kZEDֵkd_#q֎.= W>OX62WPFM;a?9=znJN^\iE .T3Zk(<XojAk܋8}޿J-]>U.܊QsDEj"+҈D[ƫrhi\"k*`<GQݻв3lP$RDZ&CKcr$.xqoF8]+ϸؠK#{S{ȈwDEj"-i&Tׇ;ӂh:RwSF},7ԑ4u1ɽZop':JG=xI$E4DV(/'ЈDT$e?>9e6Í1iНxF y9"[:(Ctp4 \_;3"Q: :F״yoh:ϖDDDDDEB8""\>DV"""""""Q@DTs9ȈĢ"""Ӏ""J".ݗM ,Šg. /|]$=ՄXΪzrèna 9ks%F= ADE"""""(I>OxjOWyu1 r@s} ""-SgUk=Ήk+5И指7ieDQ"""pEr"+QX_.?wDE$DEDD^bs ljclyB}9sui:-R*j]9|n]̢Ŵt,?`iB/VaxUdtΫV27hdc.(_$k@Ԓjt; ('O@涩wOjA}W>̢/=X~ҫ~Ҭ.'ߙzyUF^{QWʽ-Pp;~z+]ӓ9qWBytz=*2IQWޯ@fsbTVϖK>C&5T#-.a#qB5EpAB .EcSG[) # ̆n-:ԊA pnKXWӳ! 8jhR:zuOwӻb㎣_Ez )ʧw|#\ yy|X)-*PkmS2x= '\v-^[,F,܊U3\:0z%=p-?lqK{`h,v'8cpe©] /ݕ:AC QkpNC+QӿP),hsη6 {|Y$$5ӂ|>n0uTW\Tf3R=Y@PMSfi$.Uծ!ť4nZLrG)?*uq=J]O- (#d0E0≍895 K,HfIeK+$q=9kZڛҶp3VVHuz<<.{Vh h p EUE] DEwC_OFߝ `5?O$DZ$M֦Ǡ#9/I<vj|Vjﳈ#V>DUww?:"*(=?gDE^}"HDUCDDDDDDE]qDNQWh舝GDE^}HdDN2"'A}>̈}oDD>""tG:ȈdDN2"*t;"t;Ȉ>ˆDEDDDEMp""K{'܈HzuDENO؈q}AzQSðr"+tӚ"""""""""""""""""""*0 􏧧TDV?:"+z\;""p~iJݽ%B.f.EO m8kTgN |⛙83q,"Ǘ% Υy{"r7'u4cW1CMP곌aۇS`:KUV`]JuCzŞ}OR㭮n3Q;a3>$xӤMaZ9t~{Cz+?7n0kAV]N)g>*(~QͱzԺmwu튫RMOQ>ݨ.-Y=OZ?ڊ73TQR*% hIdpdqsJ(]~#eӼ}vٻ=,5yQP?2?O[؊ޱ:aOjA#Eo{pNz޿DV=~OTww?:C@>*':Oq"Q=4=SC}0#MqaEanEDPǖ}=UaUaE=Η'J" 9tx|=-n4T㗸O\~JKAzEo]+:wO,>嚹d؈'8wqDE nPH(I5zZCt<=#9ar"+PjI戊}FG!aq9譮& ]'px9࿰{~XrcOTIK+g48w|MTz{onpDE>Oeor\~jwCQ4BJ9d-sLtnDD[8WwӚ"/V|y}AeU}s|s] ^rYC]O~ uD^lk"cZFƆhkXֵh",×b"+""NkG5{kZ֎%qzQs%95uok\~6A o"ICtPޖHL9'{pDE 95$OO#982xDG=hhDWu;]uDR5QN;x}Ȉc")};{QLds[\st I"-N[-ޚQ5(@s1imiT9""Ϡյ1FGF =B".FcZƵcCZ^ "+"*u""*b"+DETDB@戊>zh(iz"*DE7so0]ncpm(T]䕚[Es=>MxrDE%?$htDE rڈDDDP?vw"$h DEW" (? MeS?lz9Ֆqv{ZQp"""+ $he==DDDEipDQsDEj"""(Ģ"""ʇ@[`N+VSj\{~N~TKE{?OX}oދnոhy(A XP@r}赈VVF>Zzj}VOӵmjnJ'C?xqEEϻG?'-PNӧ܋T>T?OG+o;"-n{sߣZ̗>iV9"{M!PƓyg[vY!V,QVgsܜiȵ8Z4;G(։RiED:[dz\O^[rz/o\}z+pZ5Kß?xt7}8-T'~Zlpt?P;yh-Jxs {< } y}9pO<}KmN|~Z,7AҬZ=S;^Zm^}5$>gwՅr~Ū@_N~B-M 1w$Z;5GqQ-S'K wQj1R4^D}z?PNq>xzǵ|c~IԒ*4k< -N&kϫ}j@LtOb-Rwzq>FNS'V;qwOr*&ӷ͎>8pU-z`ϯEG~eg{䛼Z5(-xz?G>htϳXTۯӟpQI{>Fdou,cW 1Ӂ?g=h?($mrj뿭?gY1ԃC"’#Aai\?bH;p޵H*5"}isŧȃB%t ~ZywƧ9'ӻy.?b-f^:z~ҋGC~OVওP"$n#*?Oji;[z4>ZTQZ-zN?g$Z,\Oz:z8}>Ե@r_qEA*i\}j~_Nj=}NKGf'O##]=_n*Wc2}]A˿ʪ vsûZj?'R,#_η%+֞Z?ܾJ4>sNb;i{j\W-H\Oӏ܋A{΀4n:g{EN8UbiGHև+x OÿR}QݨBtĐ=#̢/'i6˅=u=<}l`SIбZda:ӫQ>;{TQyVym{in6"Uց I'VXNMaQȴ-ph{FrRkP8{~ЯtL'x oo.ᒱIqq,C5dݒ2IÙikqżwP=v-Ç?V1XI<ֿH\;>?QhRoꏧ. pSߧ#-p4?N~r4=c#VN-"QkωPGVVt?*up*Kw`OP@[4o}軁~Xn,qYR+⊪׌C,erj0:;D^I0ӂy7VpzODqjvy^J*?Gk%TuM}-D5p#tN\Gu{?o϶/nCaV z]_c>6s =_xtKfXyw{ ֩]ϷOʱ䏣zX+=EˉDEw (F^O.z"+i˻eYLVICEMIUiYP$cKmf#Z-/٧3M]\OzB_lƝ?|Nx7W}_>WOEG7~~hG3z zjDDDQ{QGωDDDEB9D\Ow""aȡ~xׇ'̋n8\´iv-9w`voZ kDSGӟZv"aϧM>[z;ߨãQ}|SO7$ҺIY+CZI;(򢐻˵}-ݚwˏ$pq(E{;o}}Z5S=Ob,h"۵ѾTY pQhrFzYqhs.|ϳD\Xh *cSeh|pZX_!oQq@qԴ)_{?TvQe6 9h V&gKz\4EKϏ?opEqGkѧZ$"cuϤȋH]t[[gEto`GG89C}]Â+~@ݟr,gsӿȫ~Ecf0ys }~RfG={yqڋ}bjya}ƪ&|GGNZ Z#ӮR4s yiދ.9\t9QnKO${|Ɖb6y] -f~h^=ѾH=wLqk0Z<ދ>=E+twVZ,}qE]59zEBXwחQE@-=k~X Gfp㧨j[OaoQb˧!čtGp=oz)6+k0]$kC/{;]zHE]٩ \0k/ed4+zkd<5nCUա⣨HjuhF%1p~򋯙KeG|;?"iv8"0k?_pEO#(B5;>~X2Ƿ[E9݃UNx~Xqv;+G@E9q!krR8=_-PԵEnMW;F6)PyEMyt[~"tȱflrE$rHDZ9cZ9ECIr!kmGI_S D\`l0Oa-ҋXӰ"QHAy"".E*L]ǺTM#*Y"BK".MDDDE]߷2Aq=h랅d.]F ވQ97{ZI<Q/QV&yb 21/phrQ1{"+fRNC.uiäkeUETdSI=!g_=CDEb"""""+ahg##h_F!AmELt6HD5"-}htPcR#4 zHp vqDEi>]"/@DE䈊DDDQBu<ODE-#_S ]EhsljnzOvSuE.%$Ԁ{QpmMrI! uXH14qy>ScIG]LF ث(-kji&=/"-πDEH~ǐ>DTHѭu=ȈTeՕ6QQQG~+: xn:CO>yIzo`u5T89v5c8qteڀ#PP9"^\>ЈDDDV=Ȉ.'*Lk}% -;.Q:V@ײ&Ep1Dz5HHًn?`Օ~I_Ip JR9d9jFh+ uڈ$k;w7c/էKTjӨ.Bu>VѭUT?\x\z*U ̈́^U]Vr}I}Zu%44Tt肖gv8NyEvrXp\ͅUHfELu:!WMwn$Vq*-ͲW\/'f/+ly)Xʱˊb-Cx5n.6km%V5Z:>4Iz{PCһ9y>k/6EWw˪_5^Q[dpӞ||R4b]tKiYM姇Fu7,۶gۯ.)žkfq3z<5KM4xM U$j$Iy !p|>3YQIeY⍳ԻQTs\ }rLo ]/ ڊ. Giۡր[1[os*d]{[e{]ud,!-ltZH nZ:&RN4Q1%n5YH qz"3_~DUDEax"̈DDDDD\w>n.$=ا'r Jm>hmDE] "*;""?Ozz[~DWi$DDDE^wDE^zDU=}=ڈ҈ ODE]pDUNHDTir"'C{DTR"*tDEMq"""{Sj"*t~̈ރDENȈDDDDDDDDDDDDDDDDcTDV7>QXX{b"+H#DEDEt/vMAwWzeҎ[N:Zj]OKUUCQ]LPSxu q¼۽4M16uv5+b! .MO9UE>\N|/Gj_x~@Y+'{-;{s-xڞ|mw-ԴKEm{˷;Eh-pTzMDNf\ U =K ྛ<6SYfƦgZ?3K9Mq9}hU,v_i)bSSUBfBIFcuXee\QA4xtpe-cVLj׾{S<w%6̎eنEXjta9:g i쮮mSk[ki@#Cxu{ h_r+}*2}]Nh!ʹgeQ\3U3Z(*+Џ2CK-Qy)xӿ{QBJG>+7b H=¹?MKNڍ;@}$Gev}aJ{:x$r( aL=:}^=,?Qa'+KVG0EEih='zB+ aE(~Ȋr4y=⮲٣GR_ hNxq դTUEv\hn[{U [_pE=z"ٯq9]y"9=cDV(-q:#llT>J&Kuuik`7Ѣ+z"M#ZcEMIᮾ5<{Q"ȶ6In~ M,r$<<HN%gw('5M4TDUk6_KT3GgCЈCȈND[S5ef=Z?kFBП}N")rDD;LcȢ";Cr4^%k];u568_ 8{EH"ϫuIMUn9WC k5uj4Q>N+mUFgʋt}S f1fu(wC22[#VQ=o]E܌2,+(Fmn2M3c!$iš(cNxx}ȶC,w8 Oy[~SU Xxr¡.'ܴ*p<}EbgQӰ+ޮ-cEEjx~};UڴIS%Z}>s>Z<~@f2-?0}eG&zb,ꡯ?fDVÏ.=̚4wC^~.88}}ߙPβ"ypB#l׫[oW*LUOT5)&.tpcGHu\Zϫ-J 4?(*nRO+Ie6Z!ak90\4<9KX]t:oO(?N#M7#GBu*]?OkIg$Z,vHȏWEUF>?*Fc[N#EN>Gwo2>J9q?^t_UZ#qn!aĭvЪ j44z]x="ypjvBnZBHv~whk0xz[أ[gd;aIIF d6S7V60$CWy>ҷ!#RF5xq/Eeh N_ziЏj~ŘG?P> q:p:zڷ #Lgt>Ҩx= ~f1.wQxk`.kaVӂ5"dS?n- Μ?K㇩yP4i='ޱJ}(V8nr 'rQ{VQM?Ir9NN?2yW~5iQpro_*- }r;~ʷ'?gr[kr,5Q*M[km>]A!RQ=槍Ok{ OVʹW4zx댣AFv"VmYL/΋qŇN_̋e._k/61*MK{k%asR[>aZ+o zw1kZ55Zt 8-IiQF_EDQQU $ :4j!ԀU^-t+ $hHD_ڈDDDVDEk\Kw$P}ߧxE;9_"ѦS?T2-W!E9wޓ'j+}?z-"}ȶG돯E4E_gQd5ă~[~o?~"ȏ}Wڋ.>u(Q:opzQiD~>Y өT[nØ?GOޘkt"}ȶcׯW܊V`~D#N}tY,|( ɭָӲZWHb|YdP:[#!MFkBsJ-1S]mJz8Zd#1P5 Z"*ۑmv9ϡZ}Ȧ揧`-SE83O!}?p:p~r-OG[nN:yEB-v:,4~"*]y=2wj0 l~9oU<\Hw >Ģѧ~'^wEӟ$zzjDM:v"g>=v"۲qA r-2}5OE;YiRMlj~W:J,qR@ռ(s4=@xɎn:~*㒅NpA+E!4vyýO>5"5KTI^ N<[?B,7BAshzTI d-OC'MNq(ZZhh]T+i!xgX1sq7:ug=:u᫏Q pR>P8iκiXQct ΋_#N}vz, ˟EBG-zEЋpR8tv"ŐkӘߧyiCЋ\qyq}ܣ(+2r5=1Ot'iۢ-~xz*ilc*0z>;u'F?Zu苬 ltIx@ o"T}_%{Τy")9Wԏ_hsRrFkT=CV, I_OR-j ~t[.mlu}.lSGg5x@;ZDX?W̋w +NïExj-z>â.eqWdt2j<'d7#Od Yߧ"ۥs"x""iƱ8}} մr]2T4iRIDE(eiu/hH'N∋[թѾv f6 !AoKuD\Јk#PQjIpiD]+.{D\O?b"*""n+1Y쵱Vèۮbo1 ?""wbCusteѰjpDE(\DESQ4 6(hƗh{DEa=ڈ>DQO4DTDE5<%<){\{".a:r zUz~舸6VVF^ d^#}nk~QDE̢"\ڈJY $E,r95:9#6K{CԈhdQ,4pq59Z"-\EZ̢"ׇ!"vXtƖ tR9s^CO@q$hF\U5kC׸ qsx5o\/-B +Wx e{R%Ǧ@?״Ͱzzp꒎ Q\zeUkzu:>7{"I% ~TDB}=DEocU5B-pdo᧦2":Cu-p-o 7,֋e4MGPfG;c$D^tqUGgOu" Z$DEDDT$h/'X\22yp*gnr9GRjy08vxq4+3CZ7Z;Mq9"5ӮYGƿxŨ߫C-P I.5<@ׯ>b+ώN]1.xS_ivۦc-#^][OZ>"MgK@ӋuhjGmCb ] -x""5e,UL5l 5,wdowdl,w"=H()I""CDNw~_4=؈[""@"~j"+zzQSB9ޖ~O:a?Ob"+KgDVQQDEagq"jgS|TҢGCcaj3x7nE~EFU6:+@q9&);OTUX%=֠FU7M8pr~-xqj騣 mA(IAO5/ǟo+n<lRkpʝ|P۲shqzs!O|-?ˏn[wתwtQuM~nt+Ԇ7dlqYig{S$8zy<83,e\qلpz"l>Fbne|V$h5&WJ`54V˂l?"p)Z*j(gJYaS6]}>ح.܊}̧l~¨;x"qRW$Vi5r獍RܮJ[Xgt l~8Yb97v֞=_Mvq20cKֵ$ִs%ڋ}2ƎFFdQEGO1:u2i"sB+K\;=UA#hWj2Ȫ*] w;}=ziiauIEa#}"c!62641c[5hkZ5׀hE#סȭ#CQ59Mt- {8V5uӸk.OPZnl>c8oxas4#]Vq-p@%eUEToQ+xo.Ej,ǼzSA=QZN@nWb'@'Ei؊(~ҋMRX(>õySZ.E#ZFxkב|W]wD:2uh{S5((ܿWƺeuY3;q淤#HbF= G x.oC{Gb-G)EiވDV9]t~؈"9Qvg`/;M]jS_3)jeeL2h{K xD\wy([-YYCfeS_@!{Ip"(?*"(KA"nd_vc0IV>< uc?>EAh/"ȷV xg*Z$ 40`;MQ{`(UX-ɗبGKb{$tu戋ӭGGO0U5A@52ΝDp&ZIt!"-NZʲ-DU53EBb|1R Xϴ};N;\qxֈf_Z"+#".Dۊ GUPJȿ)"zcԈZOqw"U:Nrf>̈́h;^Ȉ#"y""9""}hDE{u_oKTΆvM;G[\船 ~D\3W.ԑCNDfpyDEDZg궂-$^EzDEȣ.DN|J""""")",rdDF1GYH*T؝gj8u=ވ:N`uys[٩kN"DE]HgN`~Zէ3""v6z.?Q qXH޺<>\{|,{={9ssI<".~.eg\t}m\7 h )X/:P:EʙfW(dae44t4h=5 (~̈ǏHB<4}舡st9}Ȉs;G""&3Y.S4M[ɔu!*"1pޑD\m[n<{3e"Bh)*g[+z$?Fu8LS$=$8ֱq h∋r[uW2 bɏQ#OpqTD[h^\>ЈDDDV=Ȉ.'c|m/wlƧdrZ[O4ϞTI,W CL4H"-Cyqؔ-.yj5SKOKIlt]G4WIuqhnHDQ"""p.';Z6_p=5Qjvm;CSš囹9 uk8[ ɰZS Y}unWShij᭕ΖI$d`1`cH( ?WޣImEPcXiߠu|ȵhIjx}Km}N2-VN jxG'gֶA=>I_i|8ULJY槸6(QTK8LV\Y}wȴ:h~Oҋ{ݞQ{y~PڭT\*iEUD3#rZ~ ?*.Ym>SphFdq{-w]`zy[F~巪H$Oh- ;}?*&#^-V9;PV۫CEDKa.?kosOzUh|x}oOgxFDJ~\WLc7|I*vS_K-(qO,{pQ?-VOǙ>9cd@ײF899c-sӨ# 2@VTḪoEEfQIf*"sdz=ES⑼8#F^O.[nHӖ`2ypjHpp>UhR:s~zj>[~×E?g5`woԑNi"bgh?X*3*ѯ&ב'DZ`{Oɪg${~Z?*ǐ}m}?ދpfuM-ctT_:cTw}OjەN÷T]]/kvOORֿsL_]բ=N׳kAv?!nAIrZhdڗ.Nu}4tC i}|C~(phqج;K'}|#Ԏz ;=kBMxҋPdz=5,û4'L}Qןob@?OJ)ݨ_Ij>{?*BJhh,.mWzx[t>Hï '׮p@HpqGr>ɾ[:sIy-p@ E;-uS\ǎŸ`#A4¢ڞ<~ïT$kpS;P=#~Z=Oʷ%1}xWFt{OOoʽ[jkpRs,=}L_WE)Pc.'ܶKe/5mw*CC)`wH*5Z'/gj=WsJyM#吀/ hReP9 sZۭAptm9rƒ@= >QG`{KSm5=e,iaՓA1mX%u-ѸǹW7z(E__~Y'm>QWvÏ~[znCX}r-YdY,~PDWG.ӧhE]R!$4oIDYZ I:S9(z{]qh5n 5vd<S-]3OT[ng?ۂ)N]j_(oV~ſr,ieS$2IãxtsH#PCmEI4yd#yxzKz-r3i)k5O[ıGb;>Z9=yfCwE /JGH>éaq@pR}x>ZwN`IQ~t[QE5kOTZd>Xnׇԋ_'Q{N:E4XRr!ERs"ŗ8="w꟫''Q`KH<8q qS#QbOӵEQo"-g"| 0{qӮE97E$܋qXj_`ERsbɣHrjQnjNCB,)K7$ZGWu,_xE)G?$Z-f}z,$؋rRo[ ^]c"|M\ԫf9:( -Iz EٶG=jXf)cp-CLaѮou$h pC?z.H\t{k0Ӽ5/ȯDDDDDEPG>}Ȉ~\$յQ\Luu.a׉kB".(ntYN4FHץ'VCٱgpaX("{YP=uc;;"mWUjzb zDpy5DDDEwmYfQhdgl85@ K7=Z;Qw7,ye,oSkF4~]jiùHFu5u†N]=4`S3!h ӪG4@9D]In[W^W'9T1Gl.lM ;.лE(/9ymNX|ך]x_) |'FCKti{DE"'WA# ӎ"+M 6*55"tn?;8""\汥sZĹ5wt/q0ѿ2j&o꿤#)CRy5DEDQ؈/DV~tD[F$@2 :1Ս<v"-]5Nzi"-~ 2RQj%iFYGR5wF^/i>&z|=-:zʎt믧NŶnJÜl>k/ۼ!z_pMA\|2>@۩㮇,-5u?/_@=z>Љ_TE/'<J4+Q<J~EQ{\OA;}8o+`TeӢF b#$zO,Wx}JeYM3$J${8IEQGשXΨ4pXWq h=SW{85DUX%gGBݯ@g#N!xg+`M}csJV-7MOqkX>?rPb3 gHtZį:HoKlkǦJx`=ӝmMK\{ql֧xzxF;UJ؛W;K =fg׳$1J'6n3蒾3:iEOWϏO$󩻮l ՉI+iηrx4٦[@4N&L{K(0{U6| G$q Nzk-6[=;unEGlo 5iǴ]}]^.UZ 몸UY;:;:nIW}n>W\8/EPxfzl 'ݍh-5=,b*h"r=},kZӖS" >DWvkhDDDDDVz}_MX^O.z"+4ג"+}DWwb"+Z;=MZ^/ЈIUCI(mdMjvH9닉XtyB9zڈ"Qt'(DU=|?O؈ z[~DU@"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""*tDEN}:yDEO""CONwqDTDDDDDDDDT`""ꈊqDEoCz"+tӚ",uZZGaDEDDDDDDDDDDZ>,֚?^RI͑FWz8vX|GQ=苐֮4zB"*c~nDV! k{y}ت9i-sHs\CuQp&{fw ƚRZ.9:XnFYO;i#>gn[q : ֋eE{F],MKOo|ptPEgܼMT [ ѣa\pXS['Ժ ;^t\OҜ>SmVmUC޹fY#^)Uӻ(gG~l,u*lUg+C\ZYbarM[7:aY9&u=4T?>+>"t녻4-"vEPtkҦM9*hĶ416#O4 O\s2r># :Z_C'Ee#}l/-h,;շJh(q3K<354y^7+詤[^ɠ:MKOÁV]W6b>Ѣ sEByF^{ h1{twy">Х#U>_DQ8z}_MT͗yP\v3d<<{dcױ|oi-s1!sHzSςuyQp>u-|J]5T7uou7}=ZAzQXd?zQZ@<*uENGӪ+?EoA?\_QA{-w8u6?æzp}@Aj^M9zǥz>DV8}|X"cCOhQP;ϩ]DEo{GEa׳O;soׯgEOOҊONDOҊ"zQOҊ'8495qxEs)_#}O{1asֵi%q:89^fI\2{;OKNJZjV9e4ӵө͆6;@Q ,w9=NJtX"nx_fA8""9DQ"(r"(;`W(.higk J j"/9/﷋⫍Eʲz[xF7քDZ1$DEDDZ=^ݳ-w*e#-M]Lֱ{YmsZ֒Oɞ<y5\gpETYUgSK- VMץ]O[{-c]#".^sQ8CEK' c띺4qqgݺ"ky舥k$DRxݟoDEC]= U=\螚VK:uQ88r 舋6}3x2< ><]<@<kUI(!gK4x Ogj".r%g暩-K]lq0O0l=]ȈNDExNQ;f]*,󳆣BA1ëd Zu|~4-ihHg&aóDD[5>WY$.s㫜Ku%qF}DEz&Q3YzFOj"-W|GDEpp=QDEr"*i"P{G""̈HQ '"*""9÷yIȴ^Y4zPcW=C(_?or-jY:?-b{ο"U|ϫZ}zNϯ-QkT}B^Ҵ*N~@}XBNږ͠cpt?p?.a?9Y.By]?ns+j ^:8:Vgk" P"U_pEǧC~@8gk O =5XyzӢn<~r-ZhO[{8~ULu.="`=炉hD:ȵ"ùmGJڷ=-q^n[\\oVHل;cO5>UMOڭ~ VG'g?' EB4i~|ȵXygQz:?-f߯(ZIߪGj-Z6 s?Zi_ROK~UWܶY?ߧ܋ZhC $AHǢNǑO2T:z~r-B1GPOE=SxܶZ0ѺTwӊ*]s<9TGOwkEU?@xSQO^&Ǵi}J&;[vC~UVk#ԟb:ţ?I?My$Zv}_B5䞗~ϻE?Q;8h~լRuN|ET3zAήXG=?ykǧҢx֏0xv}t'ӿZ3jh->r#?NzȴY=bikVwRAvzBۮVNx(}v\ek<_~r-~urܔ䖷h:qk9U~U:ܔmXtՊE®ToI<B~Ÿ)5N}qSZ=O;VW(iynk~?/ʯg?i9W  'Ec9{1%kIkkFJUiW y<}mi[NeG)KM11{budhtNcK?W>*#ҷ'?grȎ@:;uK 3EOO O~* >^'W5YzOދ/Q=վnip܈"yQeDQ"""pq$ 9}h9}_ȧi;Yqo۵"){h/'}PET _ʋ r"ە>H X:{ -}yE8p_ӂ-7?sdzWڋ*._S~[j"k8>"*ۑdFI_d[jOWw"v}?r-YdS1ڝG:}ȴJN~@)>_)EWf5#@ogQJZ QJNZX>fG~o ~(;N}_R װ_Ҋvv_ݬ1}W)Eo[z-M(Z_/oj,yd߿Oʋm}$<>Z5W![;=mnaM{~^Z}~Eqk{h->Z2 Zu!^\xT51H:}Kw[ө A#hIsV>9q:H"p-НtJ[^wQd8amqmRH%-D kN1͑!AYk}-}<ӷWtjՒu8wMUOWViϥ:9seckWJ[^r@A'@֚7k㦄Z$P~hک[Nr,7r?cQ~"œ}_?UC}ȠP{_ES~0ȋqGETZ#th ?R-Ja?M}"h/Cޒ~XK$}`}"ܔ$j{;Z|X2FZ'14X~ -zNX/:4zuUX,w_$[hGoEQ',wb-g"7[_kcjOwH{Sq( ")9Wxۣ[~=CO@>ЋWO^_ؐ__oi8AESPH4[}zkq}E38=_"$鯧"ފIh>a_yETS"""_r"* ]DW"""g2LO{ 1i#DEg#K$I%ĝI$QHE"#ZOܸDVˏ܈2IQ]F1Ó FGDR'G:j縹N$"(DDkuy}舥DErK(w &jx_z"-\O?gb"*""rQFd AP{AȈM4R8#5q:j4DVrDEq>DV"sױc潤sNs\4-sHD^k m|Znqo/]uʒW4=D\ !Oj"}/dX^.?r"+ z:OSӿ.h./'DEEX)3^:qyD[ɒ6V6F8=pADER@戊r;~DUDEB=}Ȉ.'Z^"y""""+\='D'""8=݁SN҈=N'Ј"uv|Uc2Z}`UTOSs} A"/;w7jqr}}gx ⎹r@.g'5EŤE"*O$DWwH~hmc%M0hѐTj ](hk4~DT..7DQw2Qˇވ\V"(d̫KEDPONQc_N{kv.`R'Xok2Z qh8kn]ƕ =h{!^TSkXv8z55"kdZS8.h/_iK\UUb}FQFdsB'I>ņN?N­w?2*;`Txlj<9v*QW>R}W:/?J’7^=5 ˮn .s'vXƘZ$O\bhx0=˷S#ou*hg;CP@tzp]?a *m ^.{4: yw6պ'6:Qu3t+2yTRtcNxJs e԰+k5TØeES|J\O= ƟA]\˼ܪZPL 2߈cMyPPӴo+eފ*Hih\#swT\EP ^{J"+Z;54DEr"""""+K=>/=O̢"i= >DWvkhDT$eT4EapWt2"y?OF"*""""*MA""ͭDiO1/ϋQ hODZG~jDWt7DE]p"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""*t~OS?O}舭Nhޖ""vdDV;舊DT aPDEns""XችRHOop* hԸ.Q:x^8#]ywD҈ԈpB"'KO#ZX}5DD#"->h_m6ݲyVah]T5<ֽ,J*j(p|54I<.)s$ސuZ9duߒ9 _˭}lf6|r5ýQkkp<À ,.{*ku~dSx2 sIP0%*X·ۮ>>dty\: OR]S^y] /=}q/_385/׊Xh{(uSM+hqtgR˫\gxY~cv8w15Xk#dUWjIhKÏt''Ot|Nbd:p4 xrìzye*!ݺsmedH(Z$?,CV8t~5,vG:yr\Vžt[mRTPW *yZկh!s5U5lUQAWK;TKLM:s!evkvG_,&=wme`Q^,JGUn[yi=:sXBG5;Pt :rX~e:C'>R+K}%?'5px?z8GQ AEN>Цlz=|GToz+ N>+Z@<֤JPޱEoA!cv.ݥ5FI魰N^f"b*tvEȭWϏެp~TH<!:ON޲9~tV}"X({*pCOJ+z"tȅ +_G$TNh/#~ЈAN4DEaDEa∋MKֻA[&<:iI6p pbtfc4y,a!qB;k^ חַEh?z~Ȉ,""BZGw"n~dDQ029qFOODEc5YHd6B$\&v4vh6e6U|e1RpcGTU3<J*X|HG. ""7[`lS]i1q+vJO\2zãѢ8".""ӁQOtDW5H==NDU")^ψLם="+/i9\N"?R")zƜ~DFDE8zDEp"8ADEr"+;HOh>&a!p|q=ND\G>(DDw """""""*yjtDEDDDDMu䈈ͮIzQi]N+a-wT&ьc$.uV xPx@]舡 h-#ވ29q@]^?b"(yp(xq:DXވ$DDDQ?N>J"-dPpF I*wכh_9%q.sIsNxJ"*rQF_DE"""+K}9""Wr"+QF_=Nh$hHF^O.DEb"""""""()rv}i5|:~C>Z=O#Qk0 5;y[n Oj[~}yEͿO"U|ϫZ?럫QE?P}r-[>5a`Qn _"䦳498 !A?9Y-Ro?G_mڎ_r-YkLJ/nX9_ oS~*]ڬF-R/ܣ<Ҵw/"!>>_?or-V>OFwQ95Ù' o=%j0wPhJ:~'`aQUU@~Z _3OϽڭ~h[Trv}hSZ@wۑjQ (ߩ_gQkvX__ olw#/%/Z#@ߧT/c}mw/"A _LJw?ju|ȵ?YEk} \UjG0>Uĭ</Qj}#pܜӳOP9j=wU}koԴNh(@v>u$piV{ݕGӇVN)lqϑksnst:]H-ZY $W8kY6ft)cpHM]ViX#a\&ANK?mZ\8O4;M@:qO+<}TG@ȏmT#aLoyЏpYy^*iD~E m:[lͦF $):J8Ĵ2I.usyOblTw:ɮ7DjPke28aAD[.wz~OTz׼}eV!ȷ3}F9~ptZNZ}贉򫺉r8}]qy~@>Z$ݾ =cZ??Z4JdI܋E5\%7QhӍIĪc_WkQhjܔmXEogUc}n oQpRs"_ ~ Qǫv h3 A~t/-Iz V-ȯZ'!? OQnz^<>Lï(܄hUǬ}pRF_=NKBz~W@?_fm9sՅ乺p?_"?w~=C[lZEG/9Un ~_j-ow8=C[Yષ/&!EKwދ]C}2jѧWeU w ps/SZWU/ח-M߼(V?'}?[UWU$lJ a`d/GDހֳ78 4M]OyZG돯SC>Rr-=UjȊ9q?b+ $ed̢*"""""p_IO[z<>xkGi˫5g{܈ ʈX9qFI<Q "(}DE{?[_ȋqGE;\y"'MO'pE"Ecfh'*B)z ;[jo6Z-O>->~9S\ڋCmE3 -[j"ɏ;(~Yqvcm>QTB8؋oL9:=u:ދoV4xvZt貣:}DRAfE;4qĻQ(v[?X}r-~OK9_"Ч="8kÉ} g ,Z5p܋@Z%>:uw"ʏEA_[O}!W"Ѫt>߷_ʋ1mՇx}ipiC[vڎGh սE t=ЪYؼl\TCO\)5PNK ]d5UQ\mԙcn㺦&-h#5oi[])iiݪg|bil/(&v5VF=ܩ"]H 2(wxSIsZ=_Y '~~[iE̗v#܋]4p~"k߷MtYoxT"Ӟ}Gct?YEGDX<}@ڋ^i G"ė>?L^:,gsΟoEЏ"yn(%'1$WEFzOE'gwhߧ܊;F΋]ӯկER7^dXZ ;GEqx(=.==:U 'P8΋pӎWEyYk_.ȋ8#٦-Iɿ/Ƞ3ETJ,WX=_"yM{"ԜX28pZ?Pn($W~yEiU~4ӿOʋYxtD[[5@'ED=;Oȱe<>"4c'ӧEފY~ȣ/'Zx""zJ"('"+x_z")8@DEawhkuy}舯. eZk@ v"y">Έ@戊"}!R8\u&?hiMgˏ܈2IQQ DEy<}般DDDEip"y;zI_7ZPI{[ v2Zi]\{wO5'%P9DVJ"+yNh/hX^{8}^h/~DVDEj"+KDQ9A戋Xܼ',H?sHO"-'DER@戊2ypj"+P~DQȈDDDDDE=NHDEB@戊2} 'F҈'?(HFO?9DEi:q%xoMڎ }lNv1pV,{H{im>@'bz e'z]4d95J". ""9"""*F^O޶_ÓتmFA3lAzY&7ǡN(KM4F观Y!78H=i y(};dP~EӸzEDXϘw}?X^.?r"|ebfC .:)F<:7?hHO{=4҆d[kQcҝu;ݧv{"]ȍ}:jգ.",GOn9qDEOӀT.aR7z8Oz@DXRUs>{պMy, *˟j{B*{*Vgwk}=kޮom֪*}LttqMQ;sZJŭSK[psUEKM ,FI -e`eyQᘵQu2[)97UdhXigGRO+dltqcswk>^Ú=9;,tW O,$ce5/WSG>f>gpkMES״JM GK51:Y 0wlms5ceV60kί7_ i#_i\(o*u-V&]e'jKy!co'4..}Z/{70ޞģbQxRgTG 9uG0߽Xw6dķIg>QD>SS cnOsyi.l{Rז-ml?NYǫh fkXֵ k@kZZ4 hI$I$IԒxII+$i,|I$9ϒIq.{I$JipUQX 'z}ȈȈ/n}=:"(5DEx`$AU@'DEpa/X^O. \٧"+;ϳ"1DEvr""""ӮTҾi?OԐk>keaoo6.37#K^9sN{VA4 B"QWC}.?wވGDE^zЈ}oDE^/DD?gDD?gDD?gDE^Q:Ȉ~dDN?2"'@<>̈}oDENw}r"*h{"sDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDENDEo@%"+KH(-ipDEigqtDVv{8"oLrFknӏ&}kRA⻙@>Aa+9XA"*""""""""<_]∊Έ{xOaz߹=i UR|-7fGo}%]1:-݋f8-Z>Jh('pӍMq- Aiq>]lM-lmdw/q.l3k4/%&{9y\}4j>}kɽ\h?c0qOKyW \#n-VJWƐ@N)lfCrxĖ.T4R"::y8-^w;B"-a9z\סui#l|4#= zQSN94zƿb]ZRxΪx2A⋣xvFQ~dDX.GDE"""(_b",wob"+ A舢stzF҈DEMFI\ t6=VQViֺGlDEzJ"-gnWCavn7*552gk'^kCnO -6G"/}|yxv6vGwn0dM+!]$lJm#GLǸ=D]ib"+Μs>DSzB") ;u"">L<U(A]}|Jp=N<Ӓ"*{ЈDDUkADUvv""<|>DW"Q5DDE#"cKc{\}hnHHiA-n?{y7]>QDU$DEP;u5DERxrDE@oDWb"*($eWoDE¾c73&l5a Ά5Ų~^=HJNI$I$I$I$DX%.DEDEj"(AϽ+׏?$DTDEG""/'i;50΢r<rHx""ESy3K ?YԞ$"ҋDE$(̢"\ڈDDDV(.'9q(/"r~DQO4DTDEN@q"j{Qg>PcWu|ȵygXo(\mg -dq6" =B&wsH rv}m_܋c8֎pB^Ҵ*N"yHgN~~Yj:>T#;ܶ@ {?E`~i3}O.~Gr-^.N({=:h-VY{x]?f}-Fv:hjxcpTIՠB5A4#?rj΃w}բU"fcklU>QjsoKh5|ϫZ0ԣ/üiڭ~([TkCfzǩm~_8z @i>xH>N pwܶS}gg֋Xӳ_DtԁH[rfB>︢ՠ'>Tu[~5jpkwڢ[rj8hC֪xB~d$kYcx8z BooF_ZNw e KnT3BGG(֫ oǟ]:Ͽjo7 sJIcťVWLLT,\iЬIgɐ;`.(MĶKrdLך ]0lkQQ`:5ҼF4A0wM.0FwH]WCFQVq3S|rɚj&ر~XquKZAkmlOPF.e2,8$W&,qV8TF; lj{|!x=z}/oo+voNk_U.$nO!^m$slDvzuK[/{Ob ]4YĞVOOשN\Jv@w~=}@N?R>rǨOj)c*- 鮜FQ\ӏZ;5 qJ-&zH#'-wAgk>΋IyhO?VHGwgpJǟ ) q[4>k'W5pBy?.NT7tk@+qҷ_o@:.>?"GЋJOo)H" OUnAiS>Ru:Z>*':ХV=_+T8 Z'!ܟE9?ەv5T~Ȝ͞Tdh5/Ǐ֩C]~ '/gjxNoW?-~;mڂz_NN?ַ~iދF>8- xFy;i5N_LHh{N8= pӃX^.'Z=INȪ(:7QO5wޣ/r*-w_\H:ei9W 9>ʮ[}xP~N%nEOz[?ȴ_ޥk=}OVsZWwӚ+QZe>DV"p=jH\zF\O/"y""*4DV8ȡ~D}WEMz,?ȶ_3r"~EsI kj?̋!ک;ynIp"ѪZzO?z)[Oߜh}Oʊv~#EUq"̏E~",ݧѨW?z)XI-r-W3E';4Y1GEVpe0{GEzAk?_wLgC>QmXukۧڋ48GgQh5m}k :Ɲ^8}`CodYpP<*SNڋnVQ]K_Ӓ-v7]9>D{tEzAXh3VtǷ"ih"Хfsx ҋ*7->[~=u} )4"ѥo1Y v"gBxr_ڋ)stZ\xQL5NZ\qo"co1cTXR }9sΊwЏ̋NB/h3hi+u>xOׇCt}fN@;7/&l߷{_-7dK݄i qT?ZskX>'o>F4:rv˟ۣ.cG V((۪+"q $ƚWwͺ-y$0T@4 Pgz֎u.lϚ}-=m^O0a2+Lg@LHfZKV]Lw iigg6J5f #xՒZ{&O+eܜ%G5^ BO}w]OTHO k\zQGW^:╌hE 4uh:)ݜ(q:~ϹK/OE}_X׸pbÉ=}CB-vphP#Τ/ȋ]h<8x}+QFs]yTXgA"t㮚Nr,9LJzyiano>Feq:k #GE >aǸ4h>(@E7 ?*,IנֳC(}ӯE)Aonz~dX"ӼsGbҋ$-z8lk(4˧o$[iÑ? i;z4W?ȋpӍOӱqE#㧷ER7ϿE!׿i{~",7ԋYyw܋7RO4Eioʋ W{O>X3s܋rsByW(\(@'[s)EC x"Q}\R"׉"+ˀDEq>܈DWӉ""\O؈2I戊wiDERxDDDDDERIwv""")8w"{QF}""M$kǴpkDEřME;\]|''dEF_DEa$DEDDT.E"+Qs7`ݥ÷t[1 XN|{o;:"+zϠ""""v~tDV=H^h/h""pQY5Ӛ"+ gnyЈ"DQ4DDD[r51xky.9z\*ԮDQˇވiw`~Z"pӯ}"GӽuxqSIYOGm=0{VCP@UDΒyxz"9$h'IF_DP:Oyh^Ģ"|vxϨ+K",Wz2WwӚ"’ߧϡV,*}=Nb&ˤ<:~vuחHӏWϳE^G ww0~|)6Ƴ]<&,rV&:>4:Zq=H&Aܹr뱺ZA=TϧQ4>(!<:zODM’pz*V%`(*={Eͥ}ָ$6*J @hnWAj fml5p_ɯ69C4u!Z-"ZʣHn'ϖ)orKUn]*Gcxm:"To8Z*;O K5A=z&qlQn }j߅.\dw+,1  %Id7AQ<׼; hu8s|J[M<ᣘ<_aqO&Dv~ږxijߖVcge5R.rkiߖ;'[^ F{:IR!/Hvik( o.3 TPuZ \Tꋭć4& 4]UɳL1_v:i)΄r#6̏d`6ȧuM|qcq0\t82G *~թ$Ai!h1&ytrS5]z*}} DEvIzQS}/qzSRyQQ>_TDW?b"+DEUP ^}}_M"+K`W"+ 'DEDDWij舮 hȈ/X^.?r"y'""ڹ P+o*/ѧbT(=ߐHh$DDDDDDE]q""CDU=}=ڈ z[܈DETDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDM5戊#""C{҈"?J"*tB"*tȈNh@<"+KgDV( ajv_T;Qz>wMHxFIBWhG8=%rcZֵhh=-P 8pv"*"""h=,>DVG0#DExx-?}4DEaa""R;ǣ",+x(_O]n]CYO H**cm{KOrɦ*Yy_-)cs_yA U_ݐW;E]iX5Ů eo'ql=iU Ayս,?/*,5{;qx[[P枇VasEOKH oIkI]gx߃K{|Yu4 ّ5^"c珽Rʇvj7OmU[+J}©չt,{LBKQ]q51$5c@MO'q<B|~_bHV%bIU6=#5yb4d #yO%Z'pK8Vmhamn[/:3$ѽ#*6W<Og6c둂s\e-R9r3WTz) et:ZMnw@&ԖxzO뛧[}zWH^ZA As@:A^5{Z9c45pծkvGo$EUɁwhDEBDE^?'DEw[}#_"*j4#n'EUG?W5Vs}w .:׵W<\ZZD^C9>DPzxpDE"+\x?z",w84;?J"(ODQ9qF4҈ۡ Ohл]4u4DEל'f)^Ml]'Lݒp,aDEj"""($hHD\O""r""yDTDDDDDEB9D\Ow""r~DYp;Ԟz{(֕ViԠ:p<~TkGk'Yiwەm׿PK}?[T2(k]5lL]O-\8QmʶO}ȹ*H㧁1u.:\8IV?8O=xkF}gBy}c B~G"I'^ʭo1[z~N%O&}oUswZGhwޢu=nr?B@Xom{n-8 y}mzÓ>?D_ڵh,=GBc^>u+oŨxr<4?nX>j;Ɵ?Pwk"-B-"G`'hmvz-Zuf ?:5`{9k?:-Z~u Av~_̋Z#=~4QvX?xnV.TZ@Ȩ A#TU*ƟӠ%svPCjW#]9}<$ӆ@oCLJp?Z-RЬߡ[vI@uZEXzB}kAnp`= =OX}\~R۵lnwX^.'Z߬~j+@__('Z2A~P~jj#qN\1'@ցĸCAi[rc_#1/{CZ4\8ִ<.m{Eݒ+8+sQx3PWţkty|Yf|͐V8:M[yH=RhXk;O- E=1RF#s,\qq%h9%?W/;oMs_5w[c笭7_v(#om4R,ۅ-VPWS3V*zx,;N>J/pkon4= i(-T>r{U G$^selfCrԇF+'"ǫh*J`F8Z:չ"lm#O-\x`X,遭kz>693WՐ^5CVu ~s>Rm:OV:`?Oj|OΚ>twQذ4̭+SH*-&i8r/RNOϪ-&gU}= Z#PxAH ;4vZ,5*Oo pzJ-&ۧZNZ#?WfyEA$}9i̟-Ly~axikZ+u]{92II@=}pҷE~ORj{pS@_;>^>7?*-R>~TQ=V?`_"*ӟg?\0tNE XNϯ*c"iU$;-~4SzûNt r-HkևP㮝>fI-j75Cvk[j #x?AOG~?woZ8)Aon$z~dZ}EaXx?pT.i=OשyJ@Z<~L\&?Z,R~Ÿi}_y{]G_POO>L_޷ kܬ/ruҮ[* sZ#{}_ʄh\Te>չ 3ɧ\ڴP'H8= Xi}9 >bUZ"""""ڈIHQE==X=j"/ryp,"b"""+KDQO4DTDD$h/"[EV=K\#G?Hk׻j- y}:e"ۓ~$R@E}C(F߭۫oȊpxkB :-=o[9}ȶ@`r,85#j<}?cˁ[j^>">Gz-p >"g1j"-R8?aC^:{y"sv+q'>#;QhU$vq\gC>Qh[DYG֋@o~ҊfӇE4ОiEճ8~OЋ%EF}z?*)G(Zp<{ ,·GEj~H~Nd{9"*wb5Ej#oU3xqEѧ#uohxkB=cPxp:B)g9jO#޾%C'qOZ5T\s_EvB-x')Ö;tט(ɢ}R'zi2i}ȦkA8EG=QA%R;Q` ͧMt?܇cQY2!bBfyU41pjH>S?.Z5^5 fNn-cߴ`MPә2 wƽ8kL?[3-x]ӎ~ʸy(ӏo 8~W4K9d5Ϸk͎~4JVJj)u1]@fQUPKHXNl>rx8zy mfeymC#u kC*9TG!2Loi:W\-]?USgL<4#ua'Ew[LOҞvC^t'^쟙L;t]Idxxf,sEvy*DIq 5~jXz"sh;;}'KSzԋݧN?r-vG^CQc$dtv-NGx"{ᮾQn fh{/ 雫q-J4"4wѯwRYo5߯DXr_Y( #?Th{5{,YOZGvoOE! {z-Lc^C_E#:_Qki:}谝ǫNtEiAӗ2t(t}Zr\p\~ՠЋI'ׯ؋rRQ?Yqi,G8{nE!i",7$~DZ#{uvErS4=_qВ=NZ8:ڋCӯE`ߧQb?Zg$XR-Hgߧ܊<5=_)/2,iǏݠ%#G>=z, \=?/E9zHEx{-^1G\֎nEz!wOj"+\4O??̈DDDDDN|J"""""""""""+ ~rG,QOᙍ)Z8j4"kMG(${4bNFkCDB@戊2j"(Z\eP A9{{reWU㤻_ű\}zgJ#NIriw|DT$gDEixԢ"[<(O"+ ϩE㼓DEy>WDEj"""""+ DEX%VM_v""ߔ@ɣ}׷]z${5DEMtx}>DQˇX<\O܈2I戊<"*DV.7(4ww"@krXˉDE O2I43FV6HFI>7At(W%%4It<,|Tҍ\B^֧xǩa/<{>] wQ8"(W{nj6k岶ZΪj >S3^X% {Oc;'tnjkm5ҦwB?VFptSGOkc_x,g?M sDXoʌ\>E%@NJ|?j?^NDZlzvp/טN6^~k a j=xxJGIx̸.[$'XJOH׈VRV,^}w٣3y}|??OK%Y:sx}4Qc䪞w7bq Xeu>m3ʚF$ne#,=K/I +PX7IJӓƮR8<׈86KWn=1iizE ~#wlOkS3`ߧi2ត1U+osFGOQ?/o"a2xJt|"4n{ f RHPLwvx~UE-rWQ¸8HyՀ۩zeHBbPѴ:t4t߻Eя۩mUiCGlS[)bhGOGI4w5.W\uSW\jj_=]mLU3DTDDDDDDDEpi=DW(AU@'DMt >Ei{GԮ X^{jZI<"  =>DWZ"+Ӓ"""""""""""+ Vˏ܈$j2I戨<(Fh,{K\"=AT A=qOϿ FISiK;8DX=ңDUow]SA=W҈>DT>ޗwDEDDDDDDDDDDDDDDDDDDDDT-Eksk[q$NzJ"Km)[3YĵjF#`{DY@y^֞=_MXX{8舭 h^{xk aȈ a5Ӓ"vy(+!uA9`DzgLCo_$T[/kpph 9W ތ`[j@,hi8SB!0u+?(6/;>L]meqns6tfk2?;5=Mu-=Cl~9i5.gCz5_}`gr*;aUK8]R|%8Zʪinf fvp3VCQKݣ|Z$'Aq6J]26#}DRq_0v돕;S}986sAEMqƟ0AyRPS3F|Z<ʈutGosx<K Q'м˺nv;]m]m:t(j\tUqSM35׵˲TTմUTWKP$4GQO4gM=C`l̗Y|rI} ǮtW%چ]|*e=M},"=`W4AB AZi$S]e2py}6n͕qPI-n| Niz5DSڻNDS6B9G A<!")'+ ;:"y+4-NM5扩SQ:G%i`\ur`AM?$氏gFzI}v'ʝ}p#-#-sz/3Q{$P#+TTDE=cw{ "+#"(?*"(HvpZ[u舡s!؈>crZHVxtjDE/~rSl4[1k%ji[*b0S5#0"k K]~4iOד^\`T[r"טuxiV}_[vvx: >}!huh~QjMi>h~a4-8}ȵTn~potOjCӻa~ߥkQOrIOOe$Z@@Zyz>êەM:J95q׹Qj_Âە_E^ϼ*?Co{/E@O5Ezݨh=jP >.Qjq~e 8zy4k8z"=ߕm}z"`qQ-N^Eu<>ݫfpipB O~k#- tQsZ2ßAO> @թ4p*m' -aY&qqzzMUlncI[XZY :~#EQ,p=qsxB܌;lF]H$6pڛV L6{\f-q;UP 5`m2:Q?A-T/cRT[h\6I;&IoqN!{5uӗvx`r8AEX[|fmèҦ]uv SS_UqC>ΛN [G;x4RvoùS؋#5d`<u > $3p~jOi( :w?XOzC z2Ȏ5Mt؋OnO`R?/zԡNeSЬOj!]8ppZl"hypCNj }|t?̵#ԎҋEڝ9ޮZ=fz￁+VPyyZ#:X\G)A(sկgn*hkׯB-c]ܾZ >DvO34{}p3xO~Z4֡?w/P9\#4hskh4{/TNKpӷFtpE?PO-OW5R}]NkpR;x~`>ЋCUrS7bZ=Vގ$}@`wfV9?*sy~E[h'qi}v0zukH։PASui!鯷n2ypBЦC<=^Wڷ?XjӨM8zr~@Gw*]>Z,N~[ OȋH{EӴhljRth>onUh'7չ)۠oq3=E=d(ֿHӧӻOFyH~{q~?;VBi;="E+KDQO4DTEa~ߥP9('ڈT$hǟB\\?gj"(DV"""\~DQO2H"(gV( xkwQm{hGA?TtkiEpm[[tN9P:xGPx4%Gz"UMAh{OcTu:p#_^P<۵ 8zg~tS"foSxH=}ȯ<88pުg{05Y:}>i7~>"ȍÑ}>̋Akƾ=ީq?C?Qӟjb=cP%_"9WETEQLׁ<!,d#H(#1i]Z~z?N`6QhA<4fsi״ s~ŠJr8駥! ԋ~QŠ{xdbcdS_l-":s"oI*45=*,7w5(jHG x4,-Oz~ϠEӽtπ(zq<~rQk4\s>_7_{AvPy٩hzs^x4Çw{`Nzwk=,okQ O܋rS7Siz]a8>ȋ[GOEcF[-o>G,G\ݞhFGp sF%3Nh5ދӼZcFPj,G8Z4Xpo~a'R\i̋ j 9sQnJ@;~VHu:tjԠo?M*,[Aϟ#DZ#]>̋wE7GӟU$hEDDT$h5_DEKU~iiDE[ϏgۢIDZLռ86Zbhh-l@xϣ}Z25u+}/m/wvjZF^zńi **5nڏO[}o[iyX_I˵7z7ShıIdVZʛu%L$jg/^HGL¸s:< ig~7yfGCtkhuyG;)ɛ88vnhfd{ecOA0ȍd8y |jj]㢔-jՋ}2G;ꍎo0aOm{+Ս'c;ܬ4SdqtW؆V$ju'?jKmKq;;@M+n2y6uO< v8ҾO|DM@BmEpa(WEisoZ""0DWvkhDDDDDDDDDDDT$eP9Eap XI<ʰyE^}ꈉӧ2DEM5DE gB"+i7j6S=_ qS5kkQM-}h A<##"*""""""""""""""z\{"t;""A}|?OQ<>QWz~̈ DDN}"t7?zGp""h;""h;""h;""h;""h;""h;""h;""h;""K{'܈tDN}"@wDT?gDD=~tDT>ԈGDEMqDTDDDDDDDDDDDDDDDDDDDDDD^h-iڈ=:""B9QPIl_'Cӯr˦Rd=?R"f!,>DTT??Ob"+XX.r"+ 2"+QWR9\{x"{}_MQQp~yp}-mKAEeV^lȨLH"m:G=j1*'H%|ESnGXh\+~zy56x2|:5|w =@mI3Z"kǫ*f/d1BpMM@XÎ:z9/w-c7 /K5 3k\"IdK 5Cq0_5v:XK[Y$]56h9%侩nm؏]ʤ|4s0*KUw $uE.8^@bvֺI'hţOj;Ah׏].>ay._G㗬W GKgUTH%%lPNK Fvu^.w: CYCQU<6X\u7}"mbVkL[p>=*/܎^[`Z*L92\$k N|n-{\a9si\\ѯYyx~dpy}Xy=:~dTw=*v*c͐|=?*ilWrQJ.hDDDDEyiԈ Eڈ(^DDDEB:".)bkd릚6y\bOjvW'8ʝ::ꒂMu/]xӵU^q}8""( ҈QXAZFO""|DX7[mmƶA%-EeLOMHDEj:`ڝ4<5Ts#j;jqӏV)mʦaP~şNGnÏo/OD\Ow-bݚr~Cg6nU3uh{ֻ}%gx;}@B?HU3^LjǘEDZǟc]NAضC4qqҋVGx+VP@#ʄj[v*5@mP-˗F^O.Z3p m.ga}>U=<9v>M0K/pxԠq$4jI 4 I$:x+G G=_hU, ѡ%ԋ]kg+%٧zík -^ kJdėGi p]6&k1<#a &ln(է’'ʶq;]2U IZQrʄ̭2Y5wP4-VߧyQˀV=K\?`~NTZ,k˻Q8}_R.ӆxRIӞ]JE)٩<{9h;@Wktԏ_9q+E#@;S8 Tk~SQ{V;ԟIT5jԁz8~jd'N]r5Z-N:Gog3^X8pxs(jrrЋp3}V)O qӷ@dzޡZEIqb~TZMu>=.:̷;xrVq-y N|Āukxzd-nh>{5QO5ԿF4ԝOFiNbܴmx*-ctUN5sէEOo)ϊ4<_~r-&S]>rCދD<{OP>Zx}贙w+z?Zj5r~ŢԞ:z?WJT8ʣ$kD߬~T[5c$i~O4:7~';>cj~H)Z(:7E.'b"zOr"(Vˏ܈$eeDQ""/Bj\DDDEipDQsDEj"""(Ģ""R)À$}iS.}E(y.h@tqȲEu>Ruמh?Wӂ-VA_TSFy>(r?"ˌ}-}a]}O8}"75~D[vۧ?C;h27#Qf0C:Ꙧ9=1S1{.gE*ۡyj??ܑ^ :է(9٨#i7Vh~Y ~[vv==-}f=HZv諸a;E;5(Z՞~k8h.hO)D9ñGg<4huQ<9ȎM8sׇЋBY㳱C] _S3??XENz{w"kO?G__Zͧt>YOh"Ҫ" x;)uz- A-G#̍; )Z4r-.Hh~QފvĎzr<‹IzuC)A}`E/]y}ȱMB*5-&yԊ.EO0}zMX^D15L-? p)prѮ@k֕y #hhk ^-d, O(͗/f GQҺ];& 'x$5rMq7iVaqby;zy^v7즲:<[81ǫir0~Lzn uwTk2"i=kk 9Z,9 y}M"~a(h=xzk.C~Z ܸ7.|Gp99)YI=vh^GqE!YE3׎n=4"ĕj{ڋ_gxhxAÙES3ݼHog.n%:{D[ͣsۧ֋SyR-v$kߠ"đi'A?gQ@zNPFA-j1@E@z~z-HOkQaѯy}"qAԋ eH#?J,Iڋ]pڋA<@N>Z#x=p??w?X?G(ʋXotk`{t֋rR8z{}'"vAߩTZQ/"5?oj")P̈";DWq#N2T]-خ~{hZLw8jVru?^->~ky]9tn΍tocDZ-{CG5#By'<{;>jJ;~9v(*e6I q>뿮ԭDZ4a^y;vּlj]۹ig-`5TE.9ޘZ肊@]m2aI-;2|$uMe {C꒡KEYa6P]/1:0ݡ+G3sURNA$^,ǮS[ a%x 1ۜkY\G5Á:M8j3 >LogW]O'6U ReeX隩r/ouԆ,73MtW Y ||[9o/z@[egٯ\YF]@ O=Z"Qz]""AߝzzWU4؈-Sz~R"*x~:?OJ"+z]~S}Ȉ=:""M9"""̡}uK f#gz|l2<7=ô.Ed !ַj"'U^҈AQUy"NDG0?g4DU戈""QXA"*"""""""""""""- VZ|bs _7ۮBOC+ u|)+v3{KRUtme J:;8yug7vV;gu3=Ɗq>W\]TŽ:9Lďxbᣛ/8g57}~=H:&8¶t8ʆҹdwYmmn*LsT[yu۵Ժ8s0/%?ı?wOh+}U?ݏ2 c>:%9y餥pѧcm5^̃J&MeXJ}֎zHdφ@XǷIWlm7UEt5*@"sdf9G4 ׶{{чZisKr0 F}djtԦQQ@,MY#Z4ީ"qds;#)CDN2>̋Pz_ydO*{׋mZ~GwBG?+H\G=.5w$=p5uOӹn%+ "(xiE "(HDE{xG?j"(ޮDZG?j"*""ޖ嬱*ƺ͆}Jk-bE8,1#'WAw_qK5m{%u Bzh#Z5sϑĸH_c""ߧz"+kv.ˆTDW;hDE;_NDR_DEpqӁzGr")]cOOwDEs_""<|>DW4DDDDDUHk䈊p>DU/DW5CQkz'\뢦ЈN"y Mll1k4 k@{\^{8""x""yDT.DD$i∊㷇ڈAƝNDP5ᮞDMIuDEDDUԎD"Os mNs|{Mƶ49p妽(^Ӯ܈DQ|ވܹDEDE"+ ;vzaUACO5UT7,FRNROVE>GtNcwpup3L}%zOr"(DEDDN\J"(DDDEip$DQDEj")c }GSCXG:-V'9FȘƴ9.kF4P- A[\ьY[k釾C _3^> Qhumn<("pGrvӊۓZCqWDH߫op=s :2ypjuGb\ڵ8t=$<@b:]Ub>VM-J飇_Uֻ+Ao9}ȵ:~B{حvxJ۵M:A^x"igOgw G~KBڋYxp:qO}Ns[n{_k] [Q:ZTe@JGzV54ѮM +qhQ!N=:rX]PfhLo_h*FcZ߬q;mږhuOED{~ЪY>Gz-ZQr?RەIvX-Rvw}>УZ,Qzeի ]?AT$ehUQgk^uh=С'S)>~QNGDZLDa\y.wsm[.5UX-<8xT@4!s iぽR;N=M|3l,- n.KksQuH3W O%NlF9xKk]å CʹRI#OYND- Iku.>>/|9zב0gUY- 3YwGE;ubֽJցr]c9sX+2EW,ghYܨ@<$R+ G,R;S{tߠ"ꇙA C./Xuk43y9jTLf&as\7:N[,$n%\5}Z c#V0Xy6Atz8-PyҞx}8*5yoU:Ρ?>ҊJt7?>ϳSWM9h>;)Ov>XMCBp}fGLg؋Nn  Yïg5w`I.w`U@B(tA?9 Ie^?O^?w*-2Y9~>ZLu:h?IZ<]-#.|O܋KO`jӴZ,Z'E?PONG5:kwG|O UC!axIvv}M\}K]C*2IVRmʹ?_M5qӁ4.$triYӏAHk˳4(q<~i8[vk-{W<$vG[~f4k؊vGY_ Ê,ÏF-vj=O̊vOWߪgXxpȉ݇"-vx{X[NUpOӇxE=H i}4S;1ip kS]״s费ci~OXEt{hšhUPi﷗E;ӴzB-*Fu\G1Y O?;EM8vS6@tϐטB-.zpHU-:dNvV}(׈߭(xkaIIT28cA*uGS5 >Q\A/}QB OY1r=?_QvklrQw gjutG/} â)kLojR`q?GE XxOU+% #7>#Ԟ*vFI>QK ^_N?bdZ_B於 \Ђj445AזRΧHhc79G#sAc $\%U%ůƼ: ۞zhj]'IJVdB[ wT =֎^l/4"SEC1?XoXOpHדFbH󦃆NB-Kwq:@"=tӆ%RϦթ\x:",IgOUoo~Xrf`EDzGkq?ne =J=N^'Yj[{QD{0EY g.ꐋ ]5'_5NqcHuzxxER?*,-5ǀo~DQ?Z8o(E2I戊^'$h/'"="ֈ\""~DW5DUkuy}舥׃FDUOIDETDT$hydDW""""""ovZ{!M#=]MQ=h UTPKUh]#iǴh("(DDDEip܈22"/o;69 \AA6eVIh3Oj".XDDDEB@QF^O.z"+Z^}4DEiy$eZ^F^}Cڈ"Ģ"̈2=}NH.'܈D@tqpN{4DE-Q] @_FlvDZ$(}.XI<[w"irDEixȈsIzGw=N ̈DDDV9DQ"+KDQ؈;3?J"IQ∢.'ʈ2>DXWb̈&}Y=:\h: -tth:_iUA|gI=tzOSMQEQ=%\USJ*)cqds (iRZ\A 8huQJ 7S6:Ha%eHs e&X;J"ҧ~J sDZDkOeE]Ϗ(=~/.mx}&m_DjZZ7>5byfkK #sKXW\_m[je(``qzLwk|J GtduHVW˷E\wW?GݑkE/[[TT_HnL2cӛupkcxS@zgiZz/ ߿._._.^߾5-3Gx9%:._O5A37[?wf][pu0uEL~_W̋>c1ǰev?GaWKyܟ ?Wxut-SW+ݺDZs \NSSqC~؝vez~ȈDDDEax";OG$DUw|>DVK sFh, t=¨4#BKADVQ[{{QSߗDEj"""""""""""""""+z~nHݞ(?o>^lo#JԠg;wjdEBXYЈ#b"+Q^<"*"""i"""""""""""""""vpDEaidg;oU|jېR}\E.m*wCpL8 XHu, CVj o$keeJJ<+8yu[#nbeg|{7(lȡs Yܢ2[ ’68058E,1NޙX׎GkRcw_nmV+kE=-.s)6i+^yWmۃEEY"1},9h{]N, 'mgÉ7kw8nwK\=eNW6{YԽYfVqq&4jS٫9n ;}z/>v+7sC'YmROC[N%dr=9M$Wm-mꆞhR\L맬:i i=mp Bk_ccdTc տ ] kZ*i%}5Q4atԞdh;)9 7ܖuh먯CQRQ7XZ՘{{K]?Ix*sq^`ʫ˝:@(t+^^;ވ2=?NDV""'/%""9"A_DE-SIM0OC碠pt5y.Kg:{ҍ0b #HE]$WQ[ Yn:zJzz=XYO-d1% t""zֈw?J"+=!C_""DE#_""y""""]ÁQT8>DS5QK4""_~DW"<~uvw""?WDE0p>DT.""_~`}NDW""Z,|M`l=1qi#؈r"""kڈϊ"*""knNwtD@AQ "*4x""d:~tDEq/q]{͝&yasfjύ9"4_z"(O|=h>hQ@DP8z'҈4WӚ"+Qus2v?n@nq8 ҟ2b ". $hHF^O.DEb"""+ $hE"+QX^.?r"('DEDDT$ee>DV""""IDEFG((5#5+?Y7GdHf8(ƜQJ.%hm}޿9q+V{x~Nu~[<ޣ/br:}?YbOTkSM4}T[fk?E@#~{ևR:Z#RtGaV 7>Y;MqEäg~7PyOypii oT3Ә#gj,C=+[5WҴuF9G-x# sZGpFXܫa;g}z'գvi]NXݡ Ъ׻QVˏܵ(C>qTw{U<9QO5'{;PО_h⨵duOB^A8OxZULzt~hh_אPUoTө:h8yi2y.mGTiYMg|DH# ZEV c-!M2=Y?' ~] ߟ9sn1ˢ2S\\b3GK0=V"i>P>;1+\lvMkSd! WMSS hG9Ӊ[vW.^Mf9K^,Y{՝WV[As)i)k)/>11Su9-:PTke=9WԊ`q\˴};d1v|A܏̊A)={ռG}ZU0}\;Qi솇\):hTr͡xmh k7@k1|Jd\bq\ $،LźMIt{ ju5~?ĭS6݈ <]h;d"65'jWx!k.+e·Y("I3*5/|=BNU6~\/M Nx}oTRxʊ?=?:*xuw~П{~tQ:sLjo=?Hsß?:IXϝO$XrL^~~YO!Q`K6Ԡi˯o(x ӇJ-6iȵ Sz?7wz->WIӖ@:GQO {#@9^Ij.~U\}%kHip'Qh4Z(QZMDj[dzB}еx#^?NգMu'.j~Ÿ)CwrELcOraf-NN Hb7әEx9^f׿ -wq׉>K.TvH։;[5'PiF?'3 A?PBan=jѪܬ$GAZ+=':w~UUL]N5g}CN>8jmj;?TӋGFZ#u<;8g+sA"t-cNҧw[^CzteP9NEqy<nv>Oʣ/'&ůR7?*hRy{B-zuӀ<>+ {iYˁ{=E?O+oNZ9? +_nzO  >$[uv~9q+J0yxhR3>^;;OIivz75y<}Eb_wӒ"(ˉw""9"}gz8dDyzF"۵LngNފtZa8E+dOQhU,Qûkwܨn, 5Gf{Yahyr=R-f}q^(jp<}^"i۪gEZLf߸EӫA~؋o԰q^~KOۡ<[v$jOhAZ}k$<>ҋDqn>}qOZw} -hOoŐL!Ez4<_GA"*)OSys}wn_øhiE0wQiӑqJ%@OzE:4ØECaEM8Qh;OTUqŧ۪,g@z{t抺'E?cQP;utSnuOH/Q\"4cqEip<}g%r91%Ĺ |5|mS96\DsZu҈WJzFA\WUmaCD0Sߨb7#>SqPvks]ױ!{5k-sH $H p WST--D2AQO+ctr,N,#pdFO=Z(ȲYxk抬y^c=(aRxCNC"/Q9\/J8=C;ϱg-ߗԋkx)k3]#i]):`Bz5CѪh6ӿF:ws{#C\Ǵɟl]p۳F:`*70]AGѳ# Q4-ˍy"oK=.:wsz,W'~DZ+9~~_ '#{f>PH@rES7Wvs v7˴[GO"I=Zc}_o.O.?HӟkE]N Mʶ-% MDZ[Exu p?J-Q6GG#]K_Z8׵88Hv9r~RY(kuy""wHoϹJ OnkeU0䈩PZt׃Z8i".[lzi,kZ9%Ӷj$f\o餂_L5P c 2t׫\unCShVGQau=A!= "I'" DSph/'"k2;=FR_,OOiߦĢ"E lt u=LK[[ URCk,wY∊K^ ]']Q{ɢ`GE])[V;G&^{I=;e}tCE47K^Ǵ5%i(k*dG(tr0C_hss9}˦;k"um,zZonGOW m'#.?T-z~._S⏴a^EMf4y T%:|5.x0C n-8"/d0KzuThAUIxף2m×3iL֟.DfiUoOE.CgmΊѷv=!GSq/ajS"ʞo1Qk5}pQG'KR8\A Šгx0ȳ+m1ZcQHֽV>)Ҽݏ7;iv JVEʲպ߃)'i-tp6?fW鼚x6d&Ujޘ鬹ESfA`TTyb訫gW Ɯi|LЍCdxDUDE]wDEC}Ȉי'}ֈ/DE*# ss='z}j n{lŧ"""""""*{zΈdDU?gDE^SMy"*7~zOq"'K{^w}*;*;>D@'A}UW(y}=?gDD""tO:Ȉ~dDN?2"'@z~̈=?gDD"'K{*t; ONw~_Sz~̩>EO*"'A?"CON~4#!ZZDEoCOJ"*hG0B"*""""""׬t>< (:A/13EOS&~Ez""""""",DE/ADExy"8ߨ"5v9""""""""+KAzFXGZ"}[ag 27GGq=\Kh:+i=x?}ܳ\m[A/U5G8iMoΧ&s2/[a,*]sl~Y\ pbeCq4B r{p>yOmTņ>  >$[G8<`wi1nf1uv8|IqtV8Rx t-F{ ^o,~^7åf[Mm~_KꧮȶjqVh&W@|Vs: h} U4u45sIMWGYTX*idr4OicsHЅzzz!Z5=M< ᑡ 9 $}Xv\ků!ǯ[-pٯYQEq-TP(+)k'9CH:&渇jAAB8\t]*ehG0VSd}> $EE3^G}9*k$^iCdGi̒= Tw`Tw`Y-jS~Zh;&{y*'K{'K{*0uN}G)tow:$r\ '_ :rgVq٢-91П$Tb;Vֆ vXI uӏWp>8wW]W(\=H5DEfw#v""XDE舠s}9"6v}YڋF5W-pt5HZ H+Cic4CNFޖCVM$Oo^DS\ K4DEs>pA,pI,dQ\$cZ8qD\a*8$UH"QY5h:2<ձҺzYI4}Di@O$D\UMQAU=%TNGE4OװG Cy5qF>Za9""s"@ 5*Ƽ4<"DEc 8w"" "(?DEӂ"(OADrY< ".3Lc ;ޣ:Jկ'݋^n$D]d$I$u$$dQQeDQ"""̈2}HX_DE"""+K""Wr"+QF_DE$DDDEB@戊"}Wj{C3^@?w"ߪ~8T9c:OhCGk->â\~$+Ig_QO28usQmq<9j`?acTG?~DZ.9r}S8ß||^kÊh;"*u>Z-V~bCnG`w} 8;~>~UNNZ\BkϠVi:HmhNϏ֢.'jЀ{r+CcƿӪaq$CٯTݩc>^ uׇ#ض׈jEuܪZj}z-JhG{X׻[z{wx?(;5}4>E==wڶT|ryUzv-R94nj=<>j'f:w?TYJO3óX]Դ:'ywPSzGZT:΋~ax^O]gsܪOC$ntM±AKqt9<^n=$,m¶.A)l'e$/>-T|UMuQjޘz0 O%ywưKx2l>YU,DmRx~G3u'rx9ުw=#xnsM2ڌ3ĂZ(&_`vp w*#j:wxZ9͕$k˳ v{ +F8w~GhB H{") 4:,b\^S53xhE qZ,wvp"lkQc9oТǙs 1=($C8^jӫI|GVAN8FXGS'z#j-u.XljZE4r^kա1IKvƱws]J񃆽j?2ԉsyGeGҎ8ރÚ\&K Ԥ{}#0}*ppfS8D\O(_&^Ͽ)JyI+T__%^?pwpOώ}9->iFǷpdZlb-N*pyz(7<{.ӵjpHѣҨHN'@q< <)Ï'>v؜jK3_|H**)#S 3)i=zKqPrYm'f&iӀJ0v*>awZ9g**jiՍa$D$pW OgkxOR?', MecW-S:+ᨅ$8=<@:af׏[=Hg~MmZo?W*[=Hӓx_ԣ/z{rT$k_zz%vs+p@M(@:q<N VL>hTٯg wi?B4Pa]U_q1QQ#b\$NKX};֠gy\@x#COSyȲ9V!m], eu;"9g]A n|P1W8wt׳EiQ<4xD֎ v`]J;/dox_OUOU4*7ޕywPn#N: =ooEqkHЁ^wo~Ͷ(+-MW];t򞪊 7}kZx@8Վ'H8-<+\g:, 1]IiO0{^ev=(ӇҠZ<ԓ{}ȷ;t9iEJ="ۣ{5'O֋H뎣=R;{=jYż<9NX\O[`-ws+VH#ޠ/wfXmvpmYλe)@ݣ+N+f'ΦJ V:xMҷ%+8~n_rʊtyX+^YF G|~g@R4-ӆPdl- kȴiû雫iOG^}yGR7㙘W7Y01T~E3G.Kȷҡ sDE~}.{D\O?b"*""""ڈ֟xzx"f~M5E}hySᾰAT|\>Srmٛ]u^Z=S8A(E*{!"w׈ELAkyߩnt<؋%PTZEC5xkzfFG -U={?yze0wrEiڋ%og؋D tׇMHמ-<|GڋHP~E;\N׊- .@{:H27j4zB-f<$p?TY vC~dZML<ӏo֊VHNwZj#×M9G"e^t^]z)j ÇavRO贉#-˗}ޤSdZtutEȸ]Eu{ C7N1҈$57HQn_Q[)ۚa* {٫Ë%g[[FqvZDZ>ѧOy~]>Zs#{<\$}8p(ӑ#XOR5GEq?C]xh:z~mPO6^iTOݢ+<뮇s~IEO">zᖪk5udR&.@~ծͧw@nWnt4SS$MLDNЎ:E^]N-ѵ9!Yf>%u? b: ގ:QHA{{u^Ny3pVO ΋YM;Cx3hCj\uS>F"ouoضcѧ y}C+ װPT$jF}Ҋ%O`Y-nO4R5q< "C(pYn& )Ot8cGE8 ȃVK$rWSO,s h&M -9cxE3 soqm,EN i_;=!n{VK#:`uK!R3c}?^zu:YAe56s=C#~6|q}Dc@TBނpW--] DC+yf.?MZGӨ-$n!?Xbز=P^EESU%DGPK&p-{Nckp 㦤TgS귃}}J,W{8{Qkywp`NrТ•iQk#GA~X=k>ŠNG$Z$|}º2ʘi5 3Hjzn*Xzyv<8"\f:H,M؋ēQkt? Sob-J?b+]4}wթx=}ȭVIm=MC'G>*fcHS,PJ-JG=dd]i` xFء&GX1p[6 CEn;_M& Σć4 ѿO2D$؈zQjv:LB7InU5s4qqyTxD\oƆzyHuH^8unv""5@ DEa$DEDDW}C""oW2֙]<1Q+A@]+5""DN|". Jd@z;ur ${ƿ閕IDEI?OnO>$eo ӏ3ވ:F~o𓦬8Ƽ}h&d5::dĤl8rA3=y^6۬Frq0"wg;O H\9c5sIii"(ou1Y urVަéo.%b>Pxk C.Lg{MN# >G]Iߪ"|~ +Yjg9-:987_Hӵb_N-7>?oa7TvE$ju~}m-YST7fio-IW :QDzyټErlU, yk94 yQQc8uʲF6_#- /8%K0iw u0= kRZqjn'7mNYRk FH{G<2&?.mn_m⯧Y+NLnvڼ EZv[(_# eMx?UaIo=(4=؈}=_̈Oڈ =舫SA=:""?J"S>R"K{Nw~_Swns"*t?:"+z܈-ipDEigq" ij&d1\i`ۣGkK9?R"pBh cF;?qNxu2'Ϯ,Z ]2qN4]l/cOgdq~ENmw'}R2HȺ$*( FK:x/>4{.łQ[\+jsA 3VYW/OQNj_^SMNddK[p51ZGZA/ yl)_5{S^-mo1set/o|I"l9#Bkګp929I.HwQq'SZ!~+ʴT:a6q>Y.Vf3|sä"G\ ga8f#t;ݸ* zf5(-, # al`F jz& dgAwG=$~5W_~P-U ]Z xb@\s/W!a4͖bVu$FEj  t-nTytڎq 맽Qth ko!UJ+ڪblm)cZKnsMu3%7geѷ̜:Zy!V\H{GS_6 wHEû[чf=M8*|$;Czco4TxZxjV#x ^nm^*+RҊKI|.]&R"\wtҾmqtMQrn37&mX^WkVFȶG:m2Nfmn;O#1N8Ҟ/=ޞ|Fr qZAm=NbNZZ!~̹"Cxm{k0-׾%%:8MuzypO˟oyg^'X>:ծJ+-_ą&//_?Lix?]_׫:z|.Vl|mvzUV 4>lYMN:Eo\k%޼٫cm{]h{gպ*DZ W ׭od 4g"B+1z uvqp#OpuIq'o\f%}K4LNlc4a| 7)15!^Ϻl~$8d{5C8 tڊ/Gʶ_D10vj͚no @qc)nws$OIC/eotd(jK݂HV(:ZjAS+>]>uQ<,?ǷZuuy۾ ~%3\xo{4A{7nW5j@ p٩8q+ЛmȺ>sqr14HȩzOV=h&E6[C}j2k\-h|5WT{8tQ'oW/vk?e4K:8jK+4pNJ诘+l<,~ $ɦ&EZd=ikO^y/ fSuK[L[=$MpCOjqs> |'H3#Z縆48jI'DEqG d͊ɍUFH:"@3kQ02ıpA_[M]Mc|`*# $Yas:׎".6C,aki$Ja! hPӚ".rLD""׀{2")}}ȈHiLj>D\q2f+AmzŦ~>wh'uokC_K$S?KD$w o"""Ӂ>DWx.ob"+I'C(8咩p8C%DcC3F}>@j".;6Ma5- d}/He`=Γ?QpsnDR5ڈ`pv"sZ\ִ \dD\anIj:5f[@hӁ^D[2uB5T !u".Xl4m 礈6x@CADE5yBeQsDESysDEy<}>DT#舯]v"+z"Q5#Ng"h0J#@=@:>L3b5 jNv5T5M,IE&P"" "+h?Ob"/'~d*.X.Qk5Fg{qk5Ѭ אuwMCQylu4} h-#"hD]O/ ՗_@(-M K+JjQQ4m8kzIHa9]o4]=%sA!&hxGb"-9c9Lj"o׊L~Quv@HTNDThԞ"%W{\QU'Q^Lp %DAǏDZQxȈ$h_Ǹ{QVWKMl*ig'8@TFƆ.= oǵy\6}d[Zl1|QS!cCPQX^.'DE$(h)7Zu^ÏAG5.Օ7Զ)fVSL$s`hE^6{ƪ%]fGp9h.jaNt4񿃁|nH興/QDI<Q "+ [ev=)꺩t5W1Y}$!D++apc\_D]-؆5x[kxp_CS]-u5DuY|VӉ71oGQR,hܤmµ?QZHK"_rޞ\fѢWr(ˉw,I8zzToiL}_Z:9huBy]E@u<>w܋n3g?Ez\;ϣB+A8^ҋWܽ>Р/ח-T~W2I收tTkq%E%,H==]\My8F]C"u;8wҋ`7{EBFN[p93xGE =:ՎFxbx}nTrܹQj#UihvN`O?j-J'.>W- >'=O>!d~MY-#] Z(54N(GSGA;/m꘹~N#BBڬwINjODFUhŨ<8lVI|-,_L$a˴\ M%4"@xO;Ipв7 :%m>Gp] ?q[`M3hhfqkZp{]ukMLDyz_ı& 2KQ7KZڇOWT$spJvz=K<=&QfpY 2GYKAE%DƳRIē r[tvV"د-wðdVlrp5{4x}~Ynw-Oa;N#QrE|JҦ:wA9ojo}(dpvOoTny ؋O@x^gR)C{s۠n35,K*%L iL|8V ]#{{*yv8!#ATLj>>FOZ<= 8׻!sVˉP<ڠlkgʹHSDY5k( q_ry5:h<~ر[Gw{KD~vsQK#=hu^=Z ѩ׏EԻ?N?Un FrߥZ\h._"T4q?Jőڻ~b9ewS UF| e-k╖֒4<4>hFR= ߑk>7F]}_ȽfyaoK9vh;yTXP'ֵVp?*-Y)2Kc_IzV'Hx<5z-"MȄS5ڃ[z>LJɌtE5x}U}=}!S1ʋDӗ ~P&7t=QhuQ}hOfzy=Fz;hQj Ӗ5Nh{}EK=tYlvviIӟ4}hd"j`Vz]Ůp?"k뮠Q$dysR,4#Q2a !<:@ۧVZ\@Qd1=Z<E;_]GydE8vQIidUtT5X_!kt PX2wdeM%-tD:7#yKG4׊-2Zr8=+d؋N9XL$5EIFF04Wq}=}c1]}:{G}H1#NGNnDVM>Ow?qEgGEX=7"o΋zkdSt9W69պIV4Ixv4-eVK}C)iH`VT:Fd1t'EvX+e@L45pJZ5@!fsw]=]45TGQO;,3Bߪ(}_"iMH ,Hӡh :q@4"UDDDDDDDDDDE}GYSSk5VwB נSpD\{q{:iӔo0tvoЈ^#Mz̞ $RG;tL0Qp#m=]uzH%cT,QuݭӉ""w\{")C@" sDE[Cr$o8Gzkuਈe:m]!Zj5 J8_<ә荤6.qѭ@ qRK]rRJbgpyǃZ5s [S6ΰͶƮYXZqdW*[]86US&uK426=T9'FK{ t\ˀ=$6FQE$k:sC!u3ߢ|Z 2 9xgAC kxg$) KK.ƹ qoxm21U2KKhzdՆtwE ignڋugjӷZ8ci <\lj$n7C4缐R^s+){[=ݪ'*{`zʆresɭ<  &OpcP<])ȱ˦1rt+ 0SïQK)I< }vqz")"**O$DWw""op:s!W:zU:zQ:`?wV~Έ=}=gSnDTԞdn$*8=MQ^;x"""ڈfgވO3~DWvkhyDWwgDEvo=>%ڈ{QZ^ϵ uO"tv}>P{i]{H{];IDE^~_ASNʨ_ ""~b"'?J"'?J"'?J"'?J"'?J"'?J"'?J"'?J"*t}oDD>DTww?:"'K/܈(DV"""""""""""j//i, d\@OԳoYgr7Ei5,ޗG"";N^H,DV~dDV$DW?b"+}DDDDDEi`>r"+4{{x{~D@5_Hz5DE]AB"*"DEա8s }$xh]|I^}K,(jIdsYqy>I1OP`/;D,P|qI$~fc#cAsIEQzt_[}#[{㧈 ˆSA=:Έ~dDT?b"'~j"*tG:?OJ"*t;dՃ9O~tNw}NW1Fw[qf,i=dLOy͒Z+k ):νQO1> bA6Ks9~u=5UM̩#E4A4nd90əyw!}Ѷ[ex6GzAЭlSzq8QE>ӺM nSywK@$ u?qnhY26AnyAMOAIAQ[dx}AP>+{Ƭ*+"eLRޡ->h'c23v k5 F_Uc8~='ϖ|m`]HG`z^02kmy=…ZBE،_q‹2٪*|15v1Cѧ fxZ֚t']GYϔߙLz٤ZC#\ޒKȬ]4ѵr .c4.wv4ҁg]U҂Ӯr׬Yg_6h׭[C~3CMF֗uuw]ѭ∻ŗŧzpwJ3"ÞeԶ7y]xE;MnLi]m| #IkzCKjQ>YGM~-®sSt wCDR$D\oSX5}dzGWAJ Ncp(x5ÿ"":P}-B'nN-GՐ }bqj".ZQ`t@LEc jq<iۦD\W)]PȪ_LTf{s z/ADE3TI a='B~^G42jmiҖpkͮutLtCGT& ϗib{\'@ӡڶK4~ҭCwuhIwUpT] SQ#BeG =}98F*Nyu_ow{SZʋʺ3I9kjdtq{zZ;Xp>UWBxQD?*ĸvQZC5ǵ ]ÑO{y(ϼ{G?m;-N7hA:+[j揩a #ڋS_Trwa8}mꨋGk <"Ԣxд\2^}GPGPgE1-cjt~;f %E0(iK\.99>89͖i#YĮ1>8(r?z茱p=zc~ziB4=wI}8ՎnG?`0Xq5MGݪ,?ðEQ}#NdavI#;{֝F\9k?AĖ#5Ys[S2 ":9^Lm |@5 ArК?ޮN0iƏs@tztP"V;=w^|3YuӃIhw΃4DQTRq }b=&wsv` >Gؽ9Clخ[x" llgo%5@mwƟkltuǕS[;On_Z|_HF4V vx~XρPTsR >TXaZ*޳^fV:31"yQOP#i> j+L{?B텚a'\vnsە- K sNj#ca򹢠K [5iLVC y5\xwiÊ-7 *lnYsVۍU, r6 FO:I:ӯAcG2@G znK) м~I8~ҺwD\Ow87_NI< `ZT]TZd4i>Ri?jqSP=R-9OS>A˿DZ|:__zs}jS$w}?0E0iӳV =:=>\Ͱw(stk? ;VU.<5hTАA=}P"N@W5h]đPg4ir $qGvrsZlώOԭ.-r}4VSb:ۥk8Rb#R9LKu,jjZ5:wv OHzo<ֺP5qEhyp}NJ5jyh;V z=Qh';ju#/WELi*u)r 괩:yNor`fSϐð+Iu n>F-u@ l2\oWa*)8z,r !}^i{;9UvEߙg 7>aFП]%w=OWr>@Z ɵ[{*!e=M-f{R%H>Flo'O>)٠WQNtޑBݼŧ{VK#MJ;zأ+]f5N vSkt׏i?wF^O.zeǏß/Vto^y~rZDڎZ =JI+zlC3x]VKU {=?*珠ҵq_NjO~ʕkt|(O}E\kKtJwZ5O#CpVsZO~UWHd|8Iy.s:DT$h/'_r+F\Ofk_mP\c`J Z1FvqfP=b*^TmA EKpiJZQ=Z!ȀG`AD=Eg*ArB-𜸔DQ{QF=}NH.'܈DDDVq""y"ߕC4×E:F -vp_R,HO.nGE=\Er=֋C>YL_gE(vEG>kNEjb{=C^4w?:-Fj;y~tR : <"E tQ8j}(a=$;m>P!΋E>y7[4E3^~ZToi sooS1^?WEA_h=4'R#󢿯A><Ztj4TR]yc